Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Exodus 15:26 26 … If thou wilt diligently hearken to the voce of the LORD thy God, and wilt do that which is right in his sight, and wilt give ear to his commandments, and keep all his statutes, I will put none of these diseases upon thee, which I have brought upon the Egyptians: for I am the LORD that healeth thee. ©2001 Timothy G. Standish Phage Strategies Timothy G. Standish, Ph. D. ©2001 Timothy G. Standish Phage Reproduction: The Lytic Cycle Infection Destruction of the bacteria’s DNA Production of viral parts Lysis Packaging Replication of the viral genome ©2001 Timothy G. Standish Phage Reproduction: The Lysogenic Cycle Infection Circularization of phage DNA Many generations of bacteria Exit of phage On to the lytic cycle Temperate phage Integration of phage DNA into the bacterial genome ©2001 Timothy G. Standish PRE nut t L L N CIII g Recombination CI Replication t nut RI cro R CII Regulation O P Q b a xis The l Genome int att J I K LM Z U H V TG Tail Genes FII PR tR3 Lysis S cos R A W B C Nu3 Head Genes D E FI ©2001 Timothy G. Standish Order of Gene Immediate Expression Early N CI cro CIII g Recombination CII Regulation O Replication P Q Delayed Early b a xis int Late att J I K LM Z U H V TG Tail Genes FII Lysis S cos R A W B C Nu3 Head Genes D E FI ©2001 Timothy G. Standish The l Regulatory Region Terminator N utilization left left tL N utilization Terminator right right nutR tR1 nutL cIII N cI Positive regulator Antiterminator Repressor cro Antirepressor cII Positive regulator “c” = clear referring to the clear plaques resulting from functional c genes ©2001 Timothy G. Standish The l Regulatory Region Promoter Promoter/ Promoter Promoter/ Represser Operator left Represser Operator right EstablishMaintainence ment tL PRM OR/PR PL/OL PRE nutR tR1 nutL cIII N cI Positive regulator Antiterminator Repressor cro Antirepressor cII Positive regulator “c” = clear referring to the clear plaques resulting from functional c genes ©2001 Timothy G. Standish The l Regulatory Region: Infection Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins tL cIII PRM OR/PR PL/OL nutR tR1 nutL N PRE cI cro STOP cII STOP Transcription Transcription ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins tL cIII PRM OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII As they are the very first genes to be expressed, N and cro are called “immediate cro early” genes. ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny pN binds to nut sites allowing transcription through tR1 and tL tL cIII PRM OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny pN binds to nut sites allowing transcription through tR1 and tL tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN Transcription PRE cI cro pN cII Transcription cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The cII and cIII proteins are produced. In vivo a protein called HflA rapidly breaks down cII unless it is combined with cIII. cII up regulates transcription from PRE. tL cIII cIII PRm OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cro cII pN cIIcIII cII ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny Transcription from PRE makes mRNA complimentary to the cro mRNA thus inhibiting cro translation tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII pN cIIcIII Transcription cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The transcript from PRE provides a 3’ untranslated region with an efficient ribosome binding site before the start of the cI gene, thus cI repressor is efficiently produced. tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII pN cIIcIII Transcription ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The repressor gene product of cI binds to OR and OL preventing transcription from PR and PL. tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN cI PRE cI cI cro cII pN cIIcIII cI ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The repressor up-regulates expression from PRM maintaining repressor production and preventing expression of any other proteins and establishing lysogeny. tL cIII PRM OR/PR PL/OL nutR tR1 nutL N cI PRE cI cI cro cII Transcription ©2001 Timothy G. Standish The l Repressor Protein Repressor protein has two functional domains: 1 An amino acid (residue) 1-92 N-terminal DNA binding domain which binds to OR and OL 2 A C-terminal protein binding domain essential for dimerization running from amino acids 132-236 A 40-residue connector runs between the two domains Repressor Repressor dimer Repressor only C CC binds DNA efficiently when it is a dimer N N N ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins tL cIII PRM OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII As they are the very first genes to be expressed, N and cro are called “immediate cro early” genes. ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins cI PRM OR/PR cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins OR/PR 5’CAT’ACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC’ATG3’ 3’ATG’TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACTATTACCAACG’TAC5’ cI OR3 PRM OR2 OR1 cro ©2001 Timothy G. Standish C CC N N N The l Regulatory Region: Infection - Establishment of The Lytic Cycle 5’CAT’ACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC’ATG3’ 3’ATG’TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACTATTACCAACG’TAC5’ cI OR3 OR2 OR1 cro The N terminus of the repressor binds to OR1 and 2 with high affinity The N terminus of the repressor binds to OR1 and 2 with high affinity The N terminus of the repressor binds to OR1 and 2 with high affinity ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins RNA Polymerase 5’CAT’ACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC’ATG3’ 3’ATG’TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACTATTACCAACG’TAC5’ cI RNAOR3 Polymerase OR2 OR1 cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Right and left operator sites share a common consensus sequence. OR3 CTATCACCGCAAGGGATAA OR2 CTAACACCGTGCGTGTTGA OR1 TTACCTCTGGCGGTGATAA OL3 TAACCATCTGCGGTGATAA OL2 TTATCTCTGGCGGTGTTGA OL1 ATACCACTGGCGGTGATAC CON -TAYCWCYGGCGGTGWTR©2001 Timothy G. Standish ©2001 Timothy G. Standish