* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download AP Biology Basics: From Gene to Protein
DNA damage theory of aging wikipedia , lookup
Frameshift mutation wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
RNA interference wikipedia , lookup
DNA polymerase wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
DNA vaccination wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Molecular cloning wikipedia , lookup
Microevolution wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
RNA silencing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Synthetic biology wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Polyadenylation wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Point mutation wikipedia , lookup
Transfer RNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of RNA biology wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
From Gene to Protein How Genes Work AP Biology 2007-2008 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA AP Biology proteins cells bodies The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA replication AP Biology RNA protein DNA gets all the glory, but proteins do all the work! trait Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism metabolic pathway A AP Biology enzyme 1 Am I just the sum of my proteins? disease disease disease disease B C D E enzyme 2 enzyme 3 enzyme 4 a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology 2007-2008 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand synthesis of complementary RNA strand same sequence as RNA transcription bubble enzyme RNA polymerase 5 C DNA G 3 A G T A T C T A 53 G A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA AP Biology build RNA coding strand 5 RNA polymerase template strand Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands A G C A G G U U C A AG U C G A U A C 5' RNA A C C polymerase G A U 3' T G G T A C A G C T A G T C A T CG T A C CG T AP Biology U C Translation from nucleic acid language to amino acid language AP Biology 2007-2008 How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG mRNA 4 AUCG protein AUGCGUGUAAAUGCAUGCGCC ? Met Arg Val Asn Ala Cys Ala 20 AP Biology How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein AP Biology Met Arg Val Asn Ala Cys Ala Cracking the code 1960 | 1968 Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids AP Biology created artificial UUUUU… mRNA found that UUU coded for phenylalanine The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AP Biology AUG methionine Stop codons UGA, UAA, UAG How are the codons matched to amino acids? DNA mRNA 3 5 5 3 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 3 UAC tRNA amino acid AP Biology Met codon 5 GCA Arg CAU Val anti-codon Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end AP Biology Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon AP Biology tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits AP Biology large small E P A Can you tell the story? AP Biology