Download Molecular Genetics PPT

Molecular Genetics
In 1869 a
researcher was
working with cells
and studying the
nucleus.
He found the nucleus was filled
with a white goo and it was acidic.
He called it Nucleic Acid
but had no idea what it did.
Nucleic Acids
There are two types :
DNA
Deoxyribonucleic Acid
For the storage of genetic information
RNA
Ribonucleic Acid
For the transfer of genetic information
It took 50 years to figure this out.
The chemical structure of DNA wasn’t
figured out until the early 1950’s.
James Watson and Francis Crick are
given credit for finding the shape and
chemical structure of the molecule.
Their research assistant Rosalind Franklin who
did much of the work, died of cancer at age 39
due to exposure to X-Rays while working on the
shape of the molecule.
They won the Nobel Prize in 1960 , she was never
mentioned for her research work.
Watson and Crick
Rosalind Franklin
Commercial X-Ray Diffraction Machine
As the X-rays pass
through the DNA
molecule they are
deflected and produce
a shadow on a
photographic plate that
revels the actual shape
of the molecule.
High Definition 3D X-Ray Crystallography
Enzymes
DNA
DNA
Contains a genetic code that defines
everything about you.
It is the recipe for you.
DNA is a Polymer
It is made up of many small pieces
3,000,000,000 pieces !
The small pieces that make up DNA and RNA are
called Nucleotides
( 5 Carbon Sugar )
Not all nucleotide
are alike.
There are four
different ones in
DNA.
The phosphates
and sugars stay
the same but the
bases change.
The four bases are:
A for Adenine
G for Guanine
Purines
T for Thymine
C for Cytosine
Pyrimidines
Double Ring
Single Ring
These four letters make up your
genetic code: A T C G
These Nucleotides hook together in a long chain
These long chains connect together
giving DNA its characteristic shape
The Double Helix
The Double Helix is actually two single spirals
that are connected together by the bases
A connects to T
C connects to G
Old Strand
When the DNA replicates
( makes a copy of itself )
the strands separate and
two new strands are
made.
So the new molecule of
DNA is half old and half
new.
Semi-conservative
Replication
New Strands
This is a map of
Chromosome #1, some of
the genes found on this
chromosome have been
identified but many have not.
A Gene is just a series of bases
that codes for one protein
One Gene = One Polypeptide
Polypeptide = Protein = Enzyme
Human Genome Project
Hs.304694 is a group of genes that work
together found on chromosome #1
This is called an Operon
This Operon contains 1,014,565 bases
Human DNA contains about 30,000 Genes
Here is a small portion of the base sequence found
in Operon #304694 only 4000 of the 1,014,565
1 agacctgacc ccttcatcgg ggctcaagag acctctctct ccaaatctcc atttgcctcc 61 tctggctaag ctggaaaatg cacactctgc cctgggtgtt tccatattat ccgcctgccc 121 ttcctcctgg
gtgcctcccg tagccttagt aagggctctg ctttcctggg cccctagagc 181 tgagccatgc tttgccataa aggtgctccc ggcttgcaac caatgtgtct gcttgtgcat 241 ctgtctgtgg gtgtggtggg
gagggagggg accaggtggg tactggcact ctggggtccg 301 gactttatgt ccatggaggc cccaattgac tcagttcaag ggtcactgag gctttgctga 361 tgtagggaga gggccagagg
gaggctccac cccagccggg ctgagccagg gaacctggga 421 caaaggtcag gtggctgatt ccaggtagtg ttttggagct gggcagtcag tggctgggcg 481 gggacatatg cccaagagcc
accatgaact cccaggggcc tccaggcagg ggccctccat 541 cccgtgagta gggtggggaa gatggtgggg ttgccacagt cagggaacca agggcccgcc 601 tctgggggcc ctgaaacctg
cctgcaggac ctgggatctg gagagctgcc cgctggcccg 661 gaggatgggc acccatccaa tcttggctta ggaaaggggc tgcagagggg cgggtgaggg 721 gtggcgggga tgcagcccca
ccctggccag tgcctcatct cctgcctccg cataggcacc 781 aagtctttca acatgatgtc cccgacgggc gacaactcgg agctactggc tgagattaag 841 gcaggcaaga gcctgaagcc
gacgccccag agcaaggggc tgaccacagt gttctcaggc 901 atcgggcagc cggccttcca ggtaggcggg cccagcagga gcctgcgacc cggcttccct 961 ggccctaggc caccgggcgc
tcagccccac cgcttctccc tgcagcccga ttcgccgctg 1021 ccttctgtgt cacctgcact gtcaccagtc cggagcccca caccgccagc tgcggggttt 1081 cagccgctgc tcaatggaag
cttggttccc gtgccgccca ctactcctgc gccgggagtg 1141 cagctggacg tggaggctct catccccacg cacgatgagc agggccggcc catccccgag 1201 tggaagcgcc aggtgatggt
gcgcaagatg cagctgaaga tgcaggagga ggaggagcag 1261 aggcggaagg tgggtggggc ggggtgccca gggagccctg gggtctgcat ctggatgcac 1321 agcccatccc
ccacgccacc cccaacccca acctcgggac ctcccatttt ctttcttttt 1381 tttttttctt ttcttgagac agagtcttgc tctgtcgccc aggctggagt gcagtggtgc 1441 gatctcgact cactgcaacc
ttcgcctccc aggttcaaat gattctcctg cctcagcctc 1501 ccaggtagct gggattacag gcgcctgcca ccacgcccag ctaatttttt tgtattttta 1561 ttagagacgg ggtttcacta tgttggccag
agctgggatt acaggcatga accaccgtgc 1621 ccggccattt tctttaggga aagcagggtg gtacaaccct gtttggggct tgtcccagtc 1681 tccacacaca cccccaccag cttgtccttg
gaagtgagac agcagccttt ctcagactct 1741 ccttcaccgg cccagcacct gggatctggt taaaaggcct gttcggattt aggaggtctg 1801 ggcggggctg aggctcgcat ttctagccag
ctcctgggtg aggctgctga tgctgctggt 1861 ccaaggacca cactgagtag ccaagagggc tttggtctca gtcttaggga cctgggctcc 1921 attgctgtgc tgccgccttc cagctgccga
tactgagcct catccagcct cagtttcctt 1981 ctctgtaagg tgggctgatc agcaccagct ggcaggatga gttgcctttt attcatccaa 2041 caactattcc ccaaatgcca tttattttta ttttttattt
tttgagacag ggtctcactc 2101 tgttactgag gctggagtac agtggtgcga tctcgactca ctgcaacctc cacctcctgg 2161 gttcaagcga ttctcccgcc tcagcctccc gagtagctgg
gactacaaat gcccgccaac 2221 aatgccctgc taatttttgt attcttagta gagatggggt ttcaccatgt tggccaggcc 2281 ggtctcgaac tcctggcctc aagtgatccg cctgcctcgg
cctcccaaag tgctgggatt 2341 acaggcgtga gccaccacgc ctggcccccg agtgccattt atgtgcccca cacactgttg 2401 tagcctctgg agattcatgg tgaacatatc aaggcctgct
ctaaggtggc tgcggacatg 2461 tgtgcgagtc accaagcaca caaaatgggg cagtgtgaga gagtgggtgg cagtggagag 2521 aagtacctgg gctgatgcaa cacagccagc
tgcaatgggg aacgcagggg actggggcag 2581 ccctaaccgg ccaccttata cgtgggctgg ggggcgtgtt agggaaggag gaggtgatgt 2641 ctaaggtgac acttggaaga
cgagtgaggg gtggccagga ggagagtggg ctgaagagcc 2701 gcaggtgaga cagagcagtc tggaagtgag agtggatgtg gccctgactg tcctggagga 2761 agggggtcgc
tgagctggag agacctcagt gggggccagg ttaccaagac ctggccagag 2821 gcccagaaga gaacggactt tctcctggag cactggggag ccgggtgcgg ggagtgttaa 2881
gcagggaaga ggctgcttcc tatttgtatg tggggagtgg atcgcatagg gtcaagatga 2941 atcagggacc tctgtggagg cgatggcagg cccaggggga aaactggaca tcagaggtgg 3001
agaaaagtga gcaaatgaga atattacggt gcccagctgt ccagcaggac gaagggaggg 3061 gaagggtggg cagctcagtg gaagctgcag ctgcagcctc tttaagagcg gagtggcctc
3121 tgattctgca cagaaaacat tgagcacagg gagcgggaag gcttgggcca caggggagct 3181 ggagaagggg tcatgagtct gggaggagag gcctcaatag ccgccctcgg
atgggttggg 3241 gagggccacc gcgcctctca gcttcaacgc ctttcgcaag ttccttgggt ggtgtaatga 3301 gcgaacaagc caggcatgga gaccccgtct gctggcctgt tcttgccgcc
gcagcagcga 3361 ccagcgaccg gccgtgcccc acgccaccga ccaaagtgga cactgcccag agcctggagc 3421 ggcggctcag gccgaagcct caccccagcg tcaccccccg
ccggccagac gcggtccctc 3481 cctgcagacg cagccccgcg gagccattac accacccggg acatgcaaaa ggctcccggc 3541 gccacggcgg gagctaggcc agagggagac
gcgcctccct cccctctctt gtcttccccg 3601 ccttagctga cggccgccag ctcgtgctgc tacccccgcg agggctggag gtactcccgc 3661 gagcacaacg ccatcctcgg gccctttggc
gagcttatga ccgaagccga catcctccgc 3721 atcgagcagc aaatcgagaa cctgcaggtg ctgcacaagg cgcagaagct ggaggcgcgc 3781 ctcgagcaac tggagctgga
gctggagcag ctgctgccca tctcggccgc cctgtcggcg 3841 ccgcgcttca ccgtcgatcc gcgccgaatg catggccgcg ccgccagcct gcccgcctgg 3901 tgcagcaaga tctccacgtt
gctcaagaac atggccacgc tgctggctgc gctgggcggc 3961 cggcctgcgc acctggcgga gctgctgacc gctgacacgg gccagccgct ggcgccgctg 4021 cccgacgcgc
It would take over 250 slides to show the entire sequence
cctggctgcc cgggccgctc tgcctgggtc gctcgcactc gctcagctgg
of this one small piece of the DNA
DNA is such an important molecule that it can never
leave the nucleus for fear it would be damaged. The
only time it is outside the nucleus is during cell division
and then it converts into a special form.
To get the information out of the nucleus to the
ribosomes where the genetic code can be deciphered
and put to use requires another Nucleic Acid.
RNA
To help make sense of the long chain of bases
the body breaks the long chain into smaller
groups called codons
Codons are three letter groups
So instead of seeing this:
CCAGTAGGTACGCCTTAGTCAGGTTCAGTCACGTACGGT
Your body sees this:
CCA GTA GGT ACG CCT TAG TCA GGT TCA GTC ACG TAC GGT
These are of the words of the genetic language.
There are 64 different codons or words.
Here is an example of how it works.
Here are a bunch of letters
THEBIGREDDOGATETHEOLDFATREDCAT
What does it say ?
THE BIG RED DOG ATE THE OLD FAT RED CAT
You broke the letters into three letter words or Codons
The three base Codons is actually code words for
specific Amino Acids – the building blocks of Proteins
AGC – Alanine
CCG – Theonine
ATT – Phenolalanine
CCA – Alanine
TTG - Glycine
These are single amino acids
that combine to form a larger
protein
Regulatory Sequences:
DNA
RNA
TAC
AUG Start sequence
ATT
UAA Stop
ACT
UGA Stop
ATC
UAG Stop
mRNA Coding Sequence