* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Biology is the only subject in which multiplication is the same thing
Survey
Document related concepts
Protein–protein interaction wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Biochemistry wikipedia , lookup
Biosynthesis wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Proteolysis wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Transcript
Mutations Changes to DNA Regents Biology 2009-2010 Mutations Changes to DNA are called mutations change the DNA changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC protein aa aa aa aa aa aa aa trait Regents Biology Types of mutations Changes to the letters (A,C,T,G bases) in the DNA point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read Regents Biology big changes to protein! Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN Regents Biology Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala AUGCGUGUAUACGUAUGCGAGUGA Met Arg Val Cys Regents Biology Glu Stop Tyr Val Cys Gl Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids Regents Biology Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA Met Arg Glu Stop Val Tyr Ala Cys AUGCGUGUAUACGCUUGCGAGUGA Met Arg Glu Regents Biology Stop Val Tyr Ala Cys Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA Met Cys Arg Val Glu Stop Tyr Ala AUGCGUGUAUAAGCAUGCGAGUGA Met Regents Biology Arg Val Stop Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN Regents Biology Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA Met Cys Arg Val Glu Stop Tyr Ala AUGCGUGUAUACGUCAUGCGAGUGA Met Arg Val Arg A Regents Biology Val Tyr Val Met Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA Met Arg Glu Stop Val Tyr Ala Cys AUGCGUGUAUACGAUGCGAGUGA Met Arg Ser Regents Biology GA Val Tyr Asp Ala Cystic fibrosis Broken salt channel in cells strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; Regents Biology with treatment can live past their late 20s Salt channel Effect on Lungs normal lungs airway salt channel salt normal mucus H 2O cells lining lungs cystic fibrosis salt H 2O transports salt through protein channel out of cell Osmosis problems! thick mucus mucus & bacteria build up = lung infections & damage Regents Biology Deletion leads to Cystic fibrosis deletion Loss of one amino acid! Regents Biology