Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Warm Up - Ms. Chambers' Biology
Document related concepts
no text concepts found
Transcript
Warm Up Warm Up Using the mRNA codon diagram determine what amino acids would match the following codons? 1. UGG 2. GAC 3. CAU 4. UCG Mutations Notes What happens when there are changes in genetics? Mutations • Mutations are changes in DNA that affect genetic information- may be lethal, harmful, helpful, or have no effect on an organism • Example: inserting an incorrect base or skipping a nucleotide Mutations Two Type of Mutations –Gene mutations • Changes in 1 single gene –Chromosome mutations • Changes in whole chromosome Gene Mutations • There are different types of gene mutations • 1st type is called a Point Mutation – These are when only 1 nucleotide is affected. • Example: Substitution –When 1 nucleotide is substitute for another –This only tends to alter 1 amino acid http://evolution.berkeley.edu/evosite/evo101/images/hemomutant.gif Gene Mutations cont • Another point mutation is Insertion – When an extra base/nucleotide is added • The last type of point mutation is Deletion – When a base/nucleotide is removed • Insertion and Deletion are Frameshift Mutations – This affects much more than 1 amino acid, it affects all amino acids after the mutation! Gene Mutations cont Deletion Substitution Insertion Chromosome Mutations • There are four types of Chromosome Mutations – Deletion • When part of the chromosome is lost or removed – Duplication • When part of the chromosome repeats itself – Inversion • When part of the chromosome gets reversed – Translocation • When part of one chromosome trades places with part of another chromosome. Chromosome Mutations Cont. Deletion Duplication Inversion Translocation Template DNA SEQUENCE PROTEIN gene DISEASE tacgagtgtaagtaccggagactgtcgctccttcttcacacacta tacctacataagtactttcctgaaagtttccggttcctccctcaa Presenilin 2 Syn uclein Laforin Leptin BRCA 2 Dystrophin PS2 SNCA EPM2A OB BRCA2 DMD AlzheimerÕs ParkinsonÕs Epilepsy Obesity Breast cancer tacgcgaaggcgaaaccccaccaccacggtgggcggcaccggccg tacgtaaccccttgggacacgcctaagaacaccgaaaccgggata tacggataacctaggtttctctccggttgtaaaaaactttaaaaa tactttttatagtaccgacctaacgttgtttggttgtcacttttc tacttccaagacacccgacgcaacgaccagtgtaaggaccgtcc Apolipoprotein E t APOE Duchenne Muscular Dystrophy Atherosclerosis Homework Define vocabulary words on your learning targets sheet. Try to use multiple words in each sentence.
Related documents