Download Adenosine Diphosphate–Induced Platelet Aggregation

Adenosine Diphosphate–Induced Platelet Aggregation
Is Associated With P2Y12 Gene Sequence Variations
in Healthy Subjects
Pierre Fontana, MD; Annabelle Dupont, MSc; Sophie Gandrille, PhD; Christilla Bachelot-Loza, PhD;
Jean-Luc Reny, MD, PhD; Martine Aiach, PhD; Pascale Gaussem, PhD
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
Background—The adenosine diphosphate (ADP) receptor P2Y12 plays a pivotal role in platelet aggregation, as
demonstrated by the benefit conferred by its blockade in patients with cardiovascular disease. Some studies have shown
interindividual differences in ADP-induced platelet aggregation responses ex vivo, but the mechanisms underlying this
variability are unknown.
Methods and Results—We examined ADP-induced platelet aggregation responses in 98 healthy volunteers, and we
identified 2 phenotypic groups of subjects with high and low responsiveness to 2 ␮mol/L ADP. This prompted us to
screen the recently identified Gi-coupled ADP receptor gene P2Y12 for sequence variations. Among the 5 frequent
polymorphisms thus identified, 4 were in total linkage disequilibrium, determining haplotypes H1 and H2, with
respective allelic frequencies of 0.86 and 0.14. The number of H2 alleles was associated with the maximal aggregation
response to ADP in the overall study population (P⫽0.007). Downregulation of the platelet cAMP concentration by
ADP was more marked in 10 selected H2 carriers than in 10 noncarriers.
Conclusions—In healthy subjects, ADP-induced platelet aggregation is associated with a haplotype of the P2Y12 receptor
gene. Given the crucial role of the P2Y12 receptor in platelet functions, carriers of the H2 haplotype may have an
increased risk of atherothrombosis and/or a lesser clinical response to drugs inhibiting platelet function. (Circulation.
2003;108:989-995.)
Key Words: platelets 䡲 genetics 䡲 receptors
O
ne of the most important mediators of hemostasis and thrombosis is adenosine diphosphate (ADP).1 The effect of ADP on
platelets is mediated by two P2Y receptors, designated P2Y1 and
P2Y12. Transduction of the ADP signal involves both a transient rise
in Ca2⫹ mediated by the Gq-coupled P2Y1 receptor2 and inhibition
of adenylate cyclase mediated by the Gi-coupled P2Y12 receptor.3,4
Simultaneous activation of the Gq and Gi pathways by ADP is
necessary for normal aggregation.5,6 Activation of the Gq pathway
through P2Y1 leads to platelet shape changes and a rapidly reversible wave of platelet aggregation,2,6 whereas activation of the Gi
pathway through P2Y12 amplifies Gq-mediated responses and alone
may elicit slowly progressive and sustained platelet aggregation.7
The effect of P2Y12 is not limited to inhibition of adenylate cyclase
and a subsequent reduction in intracellular cAMP content. Indeed, it
has been shown that P2Y12 receptor activates glycoprotein (GP)
IIb/IIIa integrin via a phosphoinositide (PI) 3–kinase pathway8
and/or another unidentified G protein.9 P2Y12 thus appears to have
a pivotal role in the irreversible wave of platelet aggregation that
occurs on exposure to ADP.
The importance of P2Y12 is emphasized by the fact that it
is the target of the thienopyridine drugs ticlopidine and
clopidogrel.3 The P2Y12 gene, which encodes the 342–amino
acid receptor, was recently identified.3,4,10 Four patients have
been described whose platelets, when exposed to ADP,
undergo little, if any, aggregation and show a decrease in the
normal adenylate cyclase inhibition of prostaglandin E1
(PGE1)–stimulated platelets.11,12 In 1 patient, this phenotype
was associated with a P2Y12 gene abnormality.3
Considerable interindividual variations in the concentration of ADP required to produce irreversible aggregation
have been reported.13 Because inherited factors have a major
role in platelet aggregation,14 we looked for sequence variations in the P2Y12 gene that might explain the interindividual
variability of platelet aggregation responses to ADP.
Methods
Subjects
Ninety-eight unrelated healthy white male volunteers age 18 to 35
years were recruited and investigated in the Clinical Investigation
Received July 9, 2002; de novo received April 2, 2003; revision received May 30, 2003; accepted June 3, 2003.
From the Service d’Hématologie Biologique A, Hôpital Européen Georges Pompidou and Inserm Unité 428, Faculté des Sciences Pharmaceutiques
et Biologiques, Université Paris V, Paris, France.
The authors have submitted a patent application to Inserm.
Correspondence to Pierre Fontana, Service d’Hématologie Biologique A, Hôpital Européen Georges Pompidou, 20 rue Leblanc, F-75908 Paris cedex
15, France. E-mail [email protected]
© 2003 American Heart Association, Inc.
Circulation is available at http://www.circulationaha.org
DOI: 10.1161/01.CIR.0000085073.69189.88
989
990
Circulation
August 26, 2003
Center of Hôpital Européen Georges Pompidou. The volunteers were
nonsmokers and denied taking any medication for at least 10 days
before blood collection. Exclusion criteria were personal or family
history of excessive bleeding or thrombosis. A physical examination
and routine laboratory tests (including white blood cell, red blood
cell, and platelet counts; mean platelet volume; prothrombin time;
activated partial thromboplastin time; plasma fibrinogen; and
C-reactive protein assays) were performed before inclusion. Blood
obtained from all the volunteers on day 0 (visit 1) and day 7 (visit 2)
was subjected to aggregation tests. A third blood sample was
obtained from a subset of 20 volunteers for platelet cAMP assay and
comparison of maximal aggregation in citrated and in hirudinanticoagulated platelet-rich plasma (PRP). All the subjects gave their
written informed consent, and the local ethics committee approved
the study protocol.
Sample Preparation
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
Venous blood was collected between 8:00 and 10:00 AM, after an
overnight fast, in tubes containing either 0.105 mol/L sodium citrate
(1:9 v/v; BD Vacutainer, Becton Dickinson) or 50 ␮g/mL lepirudin
(Refludan, Hoechst) by using a 19-gauge needle and no tourniquet.
The first 2 mL of blood was discarded. PRP was obtained by
centrifugation at 150g for 10 minutes at room temperature. Autologous platelet-poor plasma, obtained by further centrifugation at
2300g for 15 minutes, was used to adjust the platelet count of PRP
to 250⫻109/L.
Platelet Aggregation Studies
Aggregation studies were performed within 2 hours after blood
collection. Aggregation was measured at 37°C by using a photometric method on a 4-channel aggregometer (Regulest). A 280-␮L
aliquot of PRP was incubated for 3 minutes at 37°C and was then
stirred at 1100 rpm for 2 minutes before adding 20 ␮L of saline or
ADP (Sigma-Aldrich) at 1, 2, or 5 ␮mol/L (final concentration). The
platelet aggregation response was recorded for 5 minutes.
cAMP Measurement
Platelet cAMP content was measured by incubating 270 ␮L PRP
with 10 ␮L of a solution of the stable prostacyclin analog iloprost (20
␮g/L, final concentration; Ilomédine, Schering-Plough) for 1 minute
with stirring, then adding 20 ␮L of saline or ADP (1, 2, or 5
␮mol/L). The reaction was stopped 3 minutes later by adding 20 ␮L
12% trichloroacetic acid. cAMP was then extracted and measured
with an enzyme immunoassay (Amersham, Pharmacia Biotech)
according to the manufacturer’s instructions, without knowledge of
the subject’s P2Y12 genotype.
Genotyping Studies
Genomic DNA was isolated from peripheral blood mononuclear
cells by using the Qiamp Maxi Kit (Qiagen) according to the
manufacturer’s instructions.
P2Y12 Receptor
We took advantage of the cDNA sequence reported by Hollopeter et
al,3 which is available under GenBank accession number AF313449.
Assuming that P2Y12 gene organization was the same as that of other
seven-transmembrane-domain receptor genes, most of which comprise 2 exons separated by a single intron, we performed a preliminary amplification experiment by using 2 oligonucleotides, designated E and J, as sense and antisense primers; they were located at
the 5⬘ and 3⬘ ends of the reported cDNA (Figure 1). The amplification product was then purified with the Pre-Sequencing Kit (Amersham Pharmacia Biotech). Purification was followed by a cycle
sequencing reaction by using primers E, B, and J. Subsequent
sequencing using several other primers (G, H, K, and L) (Figure 1)
allowed us to determine the nucleotide (nt) sequence of the amplification product. Sequence analysis was performed with an ABI
Prism 3700 (Applera).
Screening of 40 subjects in a population is sufficient to identify
polymorphisms with a frequency of ⱖ5%, with a CI of 95%. Thus,
Figure 1. Location of the primers and polymorphisms in the
P2Y12 gene. A polymerase chain reaction product of ⬇3100 bp
was obtained with primers E and J. This PCR product was then
sequenced by using sense primers E, G, L, C, and M and antisense primers K, H, B, and J. The primer sequences are as follows: B, 5⬘TCATGCCAGACTAGACCGAA3⬘; C, 5⬘ATCGATCGCTACCAGAAGACCACC3⬘; E, 5⬘GGCTGCAATAACTACTACTT3⬘;
G, 5⬘TAAATAGGTGAGGAGATGCTG3⬘; H, 5⬘TGCATTTCTTGTTGGTTACCT3⬘; J, 5⬘GTCGTTTGTTTTGCTGCTAATA3⬘; K, 5⬘CATTGAGAATTTCAGCTCCC3⬘; L, 5⬘ATACTAACTACTACAATGAAGAT3⬘; and M, 5⬘CCTTACACCCTGAGCCAAAC3⬘. ATG and TAA
are start and stop codons, respectively. I-C139T, i-T744C,
i-ins801A, C34T, and G52T are the polymorphisms found in the
study population.
a series of the first 48 consecutive healthy volunteers were screened
for P2Y12 gene polymorphisms by sequencing the 58 nt of exon 1
with primer K; the 947 nt of its 3⬘ flanking region with primers E and
G; the 1274 nt of exon 2 with primers L, C and M; and the 570 nt of
its 5⬘ flanking region with primer H. The primers are described in
Figure 1; the flanking regions of the exons, in Figure 2. The P2Y12
gene was then sequenced in the other 50 subjects by using primers
targeting the identified polymorphisms, ie, primer E for the i-C139T,
primer G for the i-T744C and i-ins801A, and primer L for the C34T
and G52T.
GP IIb/IIIa
We used restriction fragment-length polymorphism analysis to detect
the substitution of cytosine for thymidine at position 1565 in exon 2
of the GP IIIa gene, which is responsible for the Pl A2
polymorphism.15
PCR and sequencing results were analyzed without knowledge of
the platelet aggregation results. Genotyping was repeated in ambiguous cases. All 98 subjects were successfully genotyped.
Platelet RNA Extraction and Reverse Transcription
Four milliliters of PRP (109 platelets) was pelleted by centrifugation
for 15 minutes at 2300g. RNA was extracted with the RNeasy kit
(Qiagen) according to the manufacturer’s instructions. Reverse
transcription was performed by using 10 U RNasin ribonuclease
inhibitor (Promega), 100 U Superscript II Rnase H⫺ reverse transcriptase (Invitrogen), and 1.5 mmol/L random hexanucleotides
(Amersham Pharmacia biotech). The cDNA was stored at ⫺20°C.
Statistical Analysis
Data are shown as mean⫾SEM, except for skewed variables, which
are expressed as medians. Individual subjects’ values obtained at
visits 1 and 2 were compared by using a concordance test.16 The ␹2
test was used to compare the observed allele and genotype frequencies with the Hardy-Weinberg equilibrium prediction. Trends across
genotype groups were tested by using the nonparametric KruskallWallis test. Two-way ANOVA was used to compare cAMP values
and maximal aggregation between genotype groups according to
ADP concentrations. The association between the genotype and the
maximal platelet aggregation response to ADP was tested, after
adjustment for other variables, by using multivariate logistic regression models in which maximal aggregation ⬍50% was coded as 0
and maximal aggregation ⱖ50% was coded as 1. Considering the
small number of subjects homozygous for the mutated allele (⬍7),
whatever the polymorphism, these subjects were pooled together
with heterozygotes for regression analysis.
Fontana et al
A Gain-of-Function P2Y12 Haplotype
991
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
Figure 2. Screened P2Y12 nt sequence.
Section 1, Exon 1 and its 3⬘ flanking
region. Nucleotide 1 is the start site of
the intron. Section 2, exon 2 and its 5⬘
flanking region. Nucleotide 1 is the start
site of exon 2. Exon sequences are
capitalized.
Statistical tests were performed by using the STATA 7.0 software
package (Stata Corp), and differences with probability values ⬍0.05
were considered statistically significant.
Results
To assess the variability of ADP-induced platelet aggregation, we tested 2 samples, obtained 1 week apart, from each
of 98 healthy volunteers. Figure 3 compares the maximal
aggregation responses to 2 ␮mol/L ADP in citrated PRP at
the 2 visits. At least 2 phenotypic groups were identified.
Maximal aggregation was ⬍50% at both visits in 47 subjects
(48.0%). Moreover, 43 (91.5%) of the subjects in this
subgroup had aggregation profiles consistent with a reversible primary phase. Conversely, maximal aggregation was
⬎50% at both visits in 29 subjects (29.6%), and 28 (96.5%)
of these subjects had an irreversible second phase of ADPinduced aggregation. As maximal aggregation was stable
between the 2 visits (r2⫽77%, P⬍0.001), we used the mean
value for each subject (referred to below as maximal aggregation) for subsequent analyses.
The existence of these 2 distinct phenotypic groups of
platelet aggregation, together with the stability of ADP
responses over time, pointed to possible genetic control of the
ADP effect on platelet aggregation. Thus, we analyzed the
P2Y12 gene in the study population and found that it contained
at least 2 exons separated by 1 intron ⬇1700 bp in length,
located upstream of the ATG codon (Figure 1). Exon 2
encodes the entire 342-amino-acid protein. Because of a 6-nt
repeat sequence (Table 1), the exact 3⬘ end of exon 1 and 5⬘
start site of exon 2 could not be determined. Table 1 describes
3 possible sequence patterns. We arbitrarily chose pattern 1 to
number the polymorphisms described below.
We found 4 single-nt polymorphisms (SNPs) and a
single-nt insertion polymorphism (Table 2). Two variations
were located 139 nt and 744 nt after the 5⬘ intron start site,
consisting of a C-to-T (i-C139T) and a T-to-C (i-T744C)
transition, respectively. Another polymorphism consisted of a
single-nt insertion (A) at position 801 of the intron (iins801A). The remaining 2 polymorphisms were found in
exon 2 and consisted of a C-to-T transition (C34T) and a
G-to-T transversion (G52T), respectively, 34 nt and 52 nt
after the 5⬘ start site of exon 2 (Figure 2); neither modified the
encoded amino acid (Asn6 and Gly,12 respectively).
As the i-C139T, i-T744C, i-ins801A, and G52T polymorphisms were in complete linkage disequilibrium in our
population, we designated H1 as the major haplotype (a C in
position 139, a T in position 744, and absence of the
i-ins801A in the intron, as well as a G in position 52 of exon
2) and H2 as the minor haplotype (a T in position 139, a C in
992
Circulation
August 26, 2003
Figure 3. Maximal platelet aggregation
responses to ADP in 98 healthy volunteers. After a 3-minute incubation period,
platelets (250⫻109/L in citrated PRP)
were stimulated with 2 ␮mol/L ADP. The
concordance coefficient between aggregation values recorded at visit 1 and visit
2 (1 week later) was 77% (P⬍0.001).
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
position 744, presence of the i-ins801A in the intron, and a T
in position 52 of exon 2). The respective frequencies of
haplotypes H1 and H2 were 86% and 14%. The allele
frequencies of all the polymorphisms were in HardyWeinberg equilibrium.
The H2 haplotype was associated with higher maximal
aggregation in response to ADP, with median values of
34.7% in subjects carrying none of the H2 alleles (H1/H1,
n⫽74), 67.9% in subjects carrying 1 H2 allele (H1/H2,
n⫽21), and 82.4% in the 3 subjects carrying 2 H2 alleles
(H2/H2; P⫽0.0071) (Figure 4). Two of the subjects who
were homozygous for the H2 haplotype had values of 82%
and 86%, whereas the third subject had a value of only 27%.
Multivariate logistic regression analysis indicated that the OR
of this association (OR, 3.3; 95% CI, 1.1 to 10.4) did not
change substantially after adjustment for age, body mass
index, platelet count, mean platelet volume, white blood cell
count, fibrinogen, prothrombin time, activated partial thromboplastin time, and the PlA1/PlA2 genotype. The C34T polymorphism was not associated with maximal aggregation in
response to ADP.
To investigate the association of the H2 haplotype and a
possible splice variant of the intron located between exon 1
and 2, we amplified and sequenced P2Y12 cDNA obtained by
reverse transcription of platelet mRNA from volunteers with
the H1/H1 (n⫽3), H1/H2 (n⫽3), and H2/H2 (n⫽3) genotypes. Nucleotide sequencing revealed no variations, what-
ever the haplotype. Moreover, the sequence profile was
consistent with amplification of both alleles in H1/H2 subjects, suggesting that both mRNA variants are transcribed
(data not shown).
To further study the association between the H2 haplotype
and ADP-stimulated platelet aggregation, we randomly selected 10 carriers and 10 noncarriers of the H2 haplotype. As
ADP-induced platelet aggregation is considered to be dependent on the extracellular Ca2⫹ concentration,17 we measured
maximal aggregation to 1, 2, and 5 ␮mol/L ADP in medium
containing a low Ca2⫹ concentration (citrate-anticoagulated
PRP) and in medium containing a physiological Ca2⫹ concentration (hirudin-anticoagulated PRP). Carriers of the H2
allele had an increased maximal platelet aggregation to ADP
compared with that of noncarriers in citrated PRP (P⫽0.027)
(Figure 5A). However, in hirudin-anticoagulated PRP, maximal aggregation did not reach significance, although following the same trend (P⫽0.061) (Figure 5B). This is probably
owing either to the small number of subjects in each group,
and/or to the lack of sensitiveness to reveal a difference in this
medium in terms of aggregation.
To identify a possible link between the H2 haplotype and
P2Y12 regulation of adenylate cyclase, we determined the
capacity of ADP to inhibit iloprost-stimulated cAMP accu-
TABLE 1. Possible Nucleotide Sequence Patterns Describing
the Exact 3ⴕ End of Exon 1 and the 5ⴕ Start Site of Exon 2
Name of SNP
Pattern
1
2
3
TABLE 2. Description of the Polymorphisms Detected in the
Study Population
Amino Acid
Region
C:86.2%
Allele Frequency
T:13.8%
C:13.8%
䡠䡠䡠
Intron
Exon 1 and 3⬘-Flanking Region
Exon 2 and 5⬘-Flanking Region
i-T744C
䡠䡠䡠
Intron
T:86.2%
䡠 䡠 䡠ACAGTTATCaggtaatgttattt䡠 䡠 䡠
䡠 䡠 䡠ACAGTTATCAGGTAAtgttattt䡠 䡠 䡠
䡠 䡠 䡠tgttctctAGGTAACCAACAAG䡠 䡠 䡠
䡠 䡠 䡠tgttctctaggtaaCCAACAAG䡠 䡠 䡠
i-ins801A
䡠䡠䡠
G/G
Intron
Insertion of an A: 13.8%
G52T
Exon 2
G:86.2%
T:13.8%
C34T
N/N
Exon 2
C:72.5%
T:27.5%
䡠 䡠 䡠ACAGTTATCAGgtaatgttattt䡠 䡠 䡠 䡠 䡠 䡠tgttctctagGTAACCAACAAG䡠 䡠 䡠
The repeat sequence is underlined. We arbitrarily chose pattern 1 for
nucleotide numbering.
i-C139T
The H1/H2 haplotype is defined by the i-C139T, i-T744C, i-ins801A and
G52T polymorphisms.
Fontana et al
A Gain-of-Function P2Y12 Haplotype
993
Figure 4. Maximal aggregation in
response to 2 ␮mol/L ADP according to
the P2Y12 haplotype. The average of the
maximal aggregation values recorded at
visits 1 and 2 in each volunteer was
used for analysis. The median value was
34.7% in subjects carrying no H2 alleles
(H1/H1, n⫽74), 67.9% in subjects carrying 1 H2 allele (H1/H2, n⫽21), and
82.4% in the 3 subjects carrying 2 H2
alleles (H2/H2; P⫽0.0071).
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
mulation in platelets from the same 20 subjects. In citrated
blood, ADP inhibited cAMP formation in platelets from
noncarriers in a concentration-dependent manner, with 13%,
31%, and 37% inhibition at 1, 2, and 5 ␮mol/L ADP,
respectively, compared with 31%, 39%, and 50%, respectively, in carriers of the H2 haplotype (P⫽0.028) (Figure 6A).
Similar results were found when platelets were obtained from
hirudin-anticoagulated PRP (P⫽0.01) (Figure 6B).
Figure 5. Maximal aggregation to 1, 2, and 5 ␮mol/L ADP in 10 carriers (triangles) and 10 noncarriers (circles) of the H2 allele. A, Citrateanticoagulated PRP. B, Hirudin-anticoagulated PRP. Mean⫾SEM.
We identified 3 SNPs and 1 nt insertion in the P2Y12 receptor
gene, which determined 2 haplotypes designated H1 and H2.
The H2 haplotype was associated with increased maximal
platelet aggregation in response to ADP. This was related to
differences in the mechanism regulating cAMP inhibition by
ADP.
It has been shown in a large population study that ADPinduced platelet responses exhibit considerable variability as
regards the ADP concentration required to produce a biphasic
response with ⬎50% aggregation.13 In the present study,
ADP-induced aggregation in the 98 healthy volunteers was
stable between 2 measurements 1-week apart, ie, after renewal of most platelets. These results pointed to genetic
control of ADP-induced platelet aggregation.
To further study the difference in the aggregation response
to ADP between carriers and noncarriers of the H2 haplotype,
we examined adenylate cyclase inhibition of iloproststimulated platelets and found a correlation between the H2
haplotype and the reduction in the intracellular cAMP concentration by ADP.
Data obtained with specific P2Y12 receptor inhibitors such
as the thienopyridines ticlopidine and clopidogrel confirm
that P2Y12 is the only known platelet ADP receptor responsible for adenylate cyclase inhibition and the subsequent
reduction in intracellular cAMP.18 Moreover, selective P2Y1
receptor antagonists have no effect on ADP-induced adenylate cyclase inhibition.2 Thus, the difference in the platelet
cAMP concentration between carriers and noncarriers of the
H2 haplotype after ADP stimulation may be involved in
maximal ADP-induced aggregation observed in these 2
groups of subjects.
One of the 3 H2/H2 subjects had a maximal aggregation
value of only 27% and a reversible aggregation profile. P2Y12
Discussion
994
Circulation
August 26, 2003
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
gene was screened in our study population, an amino acid
substitution affecting the protein structure can be ruled out.
Moreover, cDNA analysis of both haplotypes showed normal
sequences at the exon 1– exon 2 junction, ruling out a splice
variant. Thus, an increase in the number of receptors on the
platelet surface is most likely to explain the association
between the H2 haplotype and platelet responsiveness to
ADP. Indeed, the H2 haplotype could be linked to a sequence
variation in the promoter region that could increase transcription efficiency.
Considerable evidence suggests that the P2Y12 receptor
plays a central role in the formation of hemostatic plugs and
in the occurrence of arterial thrombosis.19 –21 Our identification of a P2Y12 receptor haplotype that is strongly associated
with increased ADP-induced platelet aggregation may have
important clinical implications, particularly in screening for
subjects at risk of atherothrombosis. Because thienopyridines
only provide partial P2Y12 blockade,22 and aspirin does not
inhibit P2Y12-mediated amplification of platelet responses,1
carriers of the H2 allele may have less protection of these
platelet inhibitors.
Acknowledgments
We thank Alvine Bissery for her help with the statistical analysis, as
well as the nursing staff of the Clinical Investigation Center
9201-Inserm AP-HP of Hôpital Européen Georges Pompidou. We
also thank Philippe Coudol from the Genetics Department of Hôpital
Européen Georges Pompidou for his help with sequencing. P.
Fontana was supported by grants from the Swiss National Fund for
Scientific Research (81LA-63350), the Holderbank, and the University of Lausanne, Switzerland. This work was partially funded by a
grant from Programme Hospitalier de Recherche Clinique (Ministère
chargé de la Santé, PHRC AOR01023, sponsor: Inserm) and the
Association Claude Bernard.
Figure 6. Inhibition of iloprost-induced cAMP formation by ADP
in carriers (triangles) and noncarriers (circles) of the H2 haplotype. A, Citrate-anticoagulated PRP. B, Hirudin-anticoagulated
PRP. Iloprost (20 ␮g/␮L final concentration) was added to
citrated PRP 1 minute after incubation at 37°C. Saline (control)
or ADP at 1, 2, or 5 ␮mol/L was added 1 minute later. The reaction was stopped 3 minutes later, and the cAMP concentration
was determined by using a commercial assay kit. Mean⫾SEM.
gene sequence and platelet function of this subject were
studied a third time, 11 months after visit 2. Similarly to visits
1 and 2, platelet aggregation to 2 ␮mol/L ADP was 37%, with
a reversible aggregation profile. However, bleeding time was
normal (7 minutes), as was platelet response to arachidonic
acid and collagen. These data argue for a selective impairment of the ADP pathway. However, the capacity of ADP to
inhibit iloprost-stimulated cAMP accumulation in platelets
was found in the same range of the one showed by carriers of
the H2 allele. Moreover, sequencing of exon 1 and exon 2 of
P2Y12 gene in this subject ruled out a loss of function
mutation. Possible explanations of the poor ADP response in
this H2/H2 subject include a defect in the P2Y1 receptor,
which is necessary for full ADP responsiveness,5 and a defect
in the GP IIb/IIIa activation cascade mediated by ADP.8
The molecular mechanism by which the H2 haplotype
increases platelet aggregation in response to ADP remains to
be determined. As the complete coding sequence of the P2Y12
References
1. Storey RF, Sanderson HM, White AE, et al. The central role of the P(2T)
receptor in amplification of human platelet activation, aggregation,
secretion and procoagulant activity. Br J Haematol. 2000;110:925–934.
2. Jin J, Daniel JL, Kunapuli SP. Molecular basis for ADP-induced platelet
activation. II: the P2Y1 receptor mediates ADP-induced intracellular
calcium mobilization and shape change in platelets. J Biol Chem. 1998;
273:2030 –2034.
3. Hollopeter G, Jantzen HM, Vincent D, et al. Identification of the platelet
ADP receptor targeted by antithrombotic drugs. Nature. 2001;409:
202–207.
4. Foster CJ, Prosser DM, Agans JM, et al. Molecular identification and
characterization of the platelet ADP receptor targeted by thienopyridine
antithrombotic drugs. J Clin Invest. 2001;107:1591–1598.
5. Jin J, Kunapuli SP. Coactivation of 2 different G protein– coupled
receptors is essential for ADP-induced platelet aggregation. Proc Natl
Acad Sci U S A. 1998;95:8070 – 8074.
6. Hechler B, Leon C, Vial C, et al. The P2Y1 receptor is necessary for
adenosine 5⬘-diphosphate-induced platelet aggregation. Blood. 1998;92:
152–159.
7. Hechler B, Eckly A, Ohlmann P, et al. The P2Y1 receptor, necessary but
not sufficient to support full ADP-induced platelet aggregation, is not the
target of the drug clopidogrel. Br J Haematol. 1998;103:858 – 866.
8. Kauffenstein G, Bergmeier W, Eckly A, et al. The P2Y12 receptor induces
platelet aggregation through weak activation of the ␣IIb␤3 integrin: a
phosphoinositide 3-kinase– dependent mechanism. FEBS Lett. 2001;505:
281–290.
9. Daniel JL, Dangelmaier C, Jin J, et al. Role of intracellular signaling
events in ADP-induced platelet aggregation. Thromb Haemost. 1999;82:
1322–1326.
10. Zhang FL, Luo L, Gustafson E, et al. ADP is the cognate ligand for the
orphan G protein– coupled receptor SP1999. J Biol Chem. 2001;276:
8608 – 8615.
Fontana et al
11. Nurden P, Savi P, Heilmann E, et al. An inherited bleeding disorder
linked to a defective interaction between ADP and its receptor on platelets: its influence on glycoprotein IIb-IIIa complex function. J Clin Invest.
1995;95:1612–1622.
12. Cattaneo M, Lecchi A, Randi AM, et al. Identification of a new congenital defect of platelet function characterized by severe impairment of
platelet responses to adenosine diphosphate. Blood. 1992;80:2787–2796.
13. Feng D, Lindpaintner K, Larson MG, et al. Increased platelet aggregability associated with platelet GP IIIa PlA2 polymorphism: the Framingham Offspring Study. Arterioscler Thromb Vasc Biol. 1999;19:
1142–1147.
14. O’Donnell CJ, Larson MG, Feng D, et al. Genetic and environmental
contributions to platelet aggregation: the Framingham heart study. Circulation. 2001;103:3051–3056.
15. Lasne D, Krenn M, Pingault V, et al. Interdonor variability of platelet
response to thrombin receptor activation: influence of PlA2 polymorphism.
Br J Haematol. 1997;99:801– 807.
16. Lin LI. A concordance correlation coefficient to evaluate reproducibility.
Biometrics. 1989;45:255–268.
A Gain-of-Function P2Y12 Haplotype
995
17. Packham MA, Kinlough-Rathbone RL, Mustard JF. Thromboxane A2
causes feedback amplification involving extensive thromboxane A2 formation on close contact of human platelets in media with a low concentration of ionized calcium. Blood. 1987;70:647– 651.
18. Geiger J, Brich J, Honig-Liedl P, et al. Specific impairment of human
platelet P2Y(AC) ADP receptor-mediated signaling by the antiplatelet
drug clopidogrel. Arterioscler Thromb Vasc Biol. 1999;19:2007–2011.
19. Mills DC. ADP receptors on platelets. Thromb Haemost. 1996;76:
835– 856.
20. Cattaneo M, Gachet C. ADP receptors and clinical bleeding disorders.
Arterioscler Thromb Vasc Biol. 1999;19:2281–2285.
21. A randomised, blinded, trial of clopidogrel versus aspirin in patients at
risk of ischaemic events (CAPRIE): CAPRIE Steering Committee.
Lancet. 1996;348:1329 –1339.
22. Storey RF, Wilcox RG, Heptinstall S. Comparison of the pharmacodynamic effects of the platelet ADP receptor antagonists clopidogrel and
AR-C69931MX in patients with ischaemic heart disease. Platelets. 2002;
13:407– 413.
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
Adenosine Diphosphate−Induced Platelet Aggregation Is Associated With P2Y12 Gene
Sequence Variations in Healthy Subjects
Pierre Fontana, Annabelle Dupont, Sophie Gandrille, Christilla Bachelot-Loza, Jean-Luc Reny,
Martine Aiach and Pascale Gaussem
Downloaded from http://circ.ahajournals.org/ by guest on April 29, 2017
Circulation. 2003;108:989-995; originally published online August 11, 2003;
doi: 10.1161/01.CIR.0000085073.69189.88
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2003 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circ.ahajournals.org/content/108/8/989
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:
http://circ.ahajournals.org//subscriptions/