Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait Translation • from nucleic acid language to amino acid language How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG mRNA 4 AUCG protein AUGCGUGUAAAUGCAUGCGCC ? Met Arg Val Asn Ala Cys Ala 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala The code • Code for ALL life! – strongest support for a common origin for all life • Code is redundant – several codons for each amino acid – 3rd base “wobble” Why is the wobble good? Start codon AUG methionine Stop codons UGA, UAA, UAG How are the codons matched to amino acids? DNA mRNA 3 5 5 3 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 3 UAC tRNA amino acid codon 5 Met GCA Arg CAU Val anti-codon a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait Building a polypeptide • Initiation – brings together mRNA, ribosome subunits, initiator tRNA • Elongation – adding amino acids based on codon sequence • Termination 3 2 1 – end codon Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA 5' mRNA UAC AA U A UGC UG 3' E P A 5' UA C G A C A UG C U GA AU 5' 3' U A C GA C A U G C U G AA U 3' 5' U A C G A CG A A U AUG C U 3' ACC U GG UA A 3' RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA poly-A tail large ribosomal subunit aminoacyl tRNA synthetase 3' polypeptide 5' small ribosomal subunit tRNA E P A ribosome