Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Thank goodness its Friday To be or not to be that is the question Tis better to have loved and lost Knock Knock Whos There Go you new prairie cougars fight Always backing you whatever the score Cause weve got the greatest team Yes we will win again try hard Amazing grace how sweet the sound Take time to smell the roses Houston we have a problem My favorite subject is biology Name Abbrev. Letter alanine Ala A arginine Arg R asparagine Asn N aspartic acid Asp D cysteine Cys C glutamine Gln Q glutamic acid Glu E glycine Gly G histidine His H isoleucine Ile I leucine Leu L lysine Lys K methionine Met M phenylalanine Phe F proline Pro P serine Ser S threonine Thr T tryptophan Trp W tyrosine Tyr Y valine Val V Amino Acid / Start-Stop Codon Codon (Nucleotide Triplet Combinations) Phenylalanine (Phe) (UUU, UUC) Leucine (Leu) (UUA, UUG, CUU,CUC, CUA, CUG) Methionine (Met) / Start Codon (AUG) Valine (Val) (GUU, GUC, GUA, GUG) Serine (Ser) (UCU, UCC, UCA, UCG, AGU, AGC) Proline (Pro) (CCU, CCC, CCA, CCG) Threonine (Thr) (ACU, ACC, ACA, ACG) Alanine (Ala) (GCU, GCC, GCA, GCG) Tyrosine (Tyr) (UAU, UAC) Histidine (His) (CAU, CAC) Glutamine (Gln) (CAA, CAG) Asparagine (Asn) (AAU, AAC) Lysine (Lys) (AAA, AAG) Aspartic Acid (Asp) (AAU, GAU, GAC) Glutamic Acid (Glu) (CAA, GAA, GAG) Cysteine (Cys) (UGU, UGC) Tryptophan (Trp) (UGG) Arginine (Arg) (CGU, CGC, CGA, CGG, AGA, AGG) Serine (Ser) (UCU, UCC, UCA, UCG, AGU, AGC) Glycine (Gly) (GGU, GGC, GGA, GGG) Isoleucine (Ile) (AUU, AUC, AUA) Stop Codon (UAA, UAG, UGA) DNA Codon Chart AUGACUCAUGCUAAUAAAUAAGGUUUUUUCGACAAUGAAUCUUCCUAAAUUACUUC AUAGUUUCGCAUUGAUGCAUACUGA AUGGCAAUGGCCACAAUAAACGGCUAAGGGCGAGCUUGUGAAUAGCACUUCUGGU AAUCCUGGGAAGAAACGUGAACACACGAAUGAAGCUUCUGGAAUGACUAG AUGGGAUUUUAAUAUUUCUGGUAGAACGAAUGGUAACCGCGGGCUAUAAGGAUU GAAUAGUGUUUUUGGGGCGCACGAUCGUAGUUCAUUGGACACACGUAG AUGUACGAAUCGUAGUGGGAAUGAUGGAUAUUGCUAUAAUGGAUCAACUGAGCUG GAGCGAUCAACUAAACGCGGUACUAGCACGCCCGCGACUGA AUGAUGUAUUAGUUCGCUGUAUUCCGGAUAACGGAGUGAAGUUGGUACAUGGAA UGUACAUGAAUAUCAUAAUACAUCUUCUUGUUCGGGUACUAA AUGAUGUACUGAUUUGCCGUGUUUAGAAUUACAGAAUAAACGGAAGCCUGCCAUG AACGCUAGAUAAGUUGAAUGAUCUCAAGUCACGCAUGGUGCAAGUAG