Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Learning about cell differentiation using blood cells Transcribe the following DNA sequences into RNA. 1. TACAGACAACAACAAAAAGAAAAAGAAGAAAGAAAACAAATT 2. TACAAAGAAAAAGAACAAAGAGAAAAAAAAAAACAAGAAATT 3. TACGAAGAAAGACAACAAAAAAAAAAACAAGAAAGAAGAATT Translate your RNA sequences into protein sequences using the following key. Make a bead chain using the colors from the amino acid key. AUG (start codon): Met-Methionine UUU: Phe-Phenylalanin CUU: Leu-Leuicine GUU: Val-Valine UCU: Ser-Serine UAA (stop codon) The amino acid sequences you created are below, with the protein named. Hemoglobin- Met-Leu-Leu-Ser -Val-Val-Phe-Phe-Phe-Val-Leu-Ser-Ser-UAA Platelet Dervied Growth factor (PDGF)- Met- Ser-Val-Val-Val-Phe-Leu-Phe-Leu-Leu-Ser-Phe-ValUAA Myeloperoxidase (MPO)- Met-Phe-Leu-Phe-Leu-Val-Ser-Leu-Phe-Phe-Phe-Val-Leu-UAA Assign the name of the protein to each amino acid chain you created. Of these three proteins, which do you think is expressed in the platelet cells? White blood cells? Red blood cells? Why?