Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Collection of data objects and
Attributes
their attributes
An attribute is a property or
Lecture Notes for Chapter 2
characteristic of an object
– Examples: eye color of a
person, temperature, etc.
Introduction to Data Mining
– Attribute is also known as
variable, field, characteristic,
or feature
Objects
by
Tan, Steinbach, Kumar
A collection of attributes
describe an object
– Object is also known as
record, point, case, sample,
entity, or instance
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
1
Attribute values are numbers or symbols assigned
© Tan,Steinbach, Kumar
Tid Refund Marital
Status
Taxable
Income Cheat
1
Yes
Single
125K
No
2
No
Married
100K
No
3
No
Single
70K
No
4
Yes
Married
120K
No
5
No
Divorced 95K
Yes
6
No
Married
No
7
Yes
Divorced 220K
No
8
No
Single
85K
Yes
9
No
Married
75K
No
10
No
Single
90K
Yes
60K
1
0
Introduction to Data Mining
4/18/2004
2
The way you measure an attribute is somewhat may not match
the attributes properties.
to an attribute
A
5
Distinction between attributes and attribute values
1
B
7
2
C
– Same attribute can be mapped to different attribute
values
Example: height can be measured in feet or meters
8
3
D
10
– Different attributes can be mapped to the same set of
values
Example: Attribute values for ID and age are integers
But properties of attribute values can be different
4
E
15
5
– ID has no limit but age has a maximum and minimum value
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
3
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
4
There are different types of attributes
– Nominal
Examples: ID numbers, eye color, zip codes
– Ordinal
Examples: rankings (e.g., taste of potato chips on a scale
The type of an attribute depends on which of the
following properties it possesses:
from 1-10), grades, height in {tall, medium, short}
– Interval
Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
Examples: temperature in Kelvin, length, time, counts
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
5
= ≠
< >
+ */
–
–
–
–
Distinctness:
Order:
Addition:
Multiplication:
–
–
–
–
Nominal attribute: distinctness
Ordinal attribute: distinctness & order
Interval attribute: distinctness, order & addition
Ratio attribute: all 4 properties
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
6
Attribute
Type
Description
Examples
Nominal
The values of a nominal attribute are
just different names, i.e., nominal
attributes provide only enough
information to distinguish one object
from another. (=, ≠)
zip codes, employee
ID numbers, eye color,
sex: {male, female}
mode, entropy,
contingency
correlation, χ2 test
Nominal
Any permutation of values
If all employee ID numbers
were reassigned, would it
make any difference?
Ordinal
The values of an ordinal attribute
provide enough information to order
objects. (<, >)
hardness of minerals,
{good, better, best},
grades, street numbers
median, percentiles,
rank correlation,
run tests, sign tests
Ordinal
An order preserving change of
values, i.e.,
new_value = f(old_value)
where f is a monotonic function.
Interval
For interval attributes, the
differences between values are
meaningful, i.e., a unit of
measurement exists.
(+, - )
calendar dates,
temperature in Celsius
or Fahrenheit
mean, standard
deviation, Pearson's
correlation, t and F
tests
Interval
new_value =a * old_value + b
where a and b are constants
For ratio variables, both differences
and ratios are meaningful. (*, /)
temperature in Kelvin,
monetary quantities,
counts, age, mass,
length, electrical
current
geometric mean,
harmonic mean,
percent variation
An attribute encompassing
the notion of good, better
best can be represented
equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Thus, the Fahrenheit and
Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).
Ratio
Operations
Attribute
Level
Ratio
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection of
documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes
Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.
– Continuous attributes are typically represented as floating-point
variables.
Introduction to Data Mining
4/18/2004
Comments
new_value = a * old_value
Length can be measured in
meters or feet.
Record
Discrete Attribute
© Tan,Steinbach, Kumar
Transformation
9
–
Data Matrix
–
Document Data
Graph
–
Transaction Data
–
World Wide Web
Ordered
–
Molecular Structures
–
Spatial Data
–
Temporal Data
–
Sequential Data
–
Genetic Sequence Data
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
10
Data that consists of a collection of records, each
If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute
of which consists of a fixed set of attributes
Tid Refund Marital
Status
Taxable
Income Cheat
1
Yes
Single
125K
No
2
No
Married
100K
No
3
No
Single
70K
No
4
Yes
Married
120K
No
5
No
Divorced 95K
Yes
6
No
Married
No
7
Yes
Divorced 220K
No
8
No
Single
85K
Yes
9
No
Married
75K
No
10.23
5.27
15.22
2.7
1.2
10
No
Single
90K
Yes
12.65
6.25
16.22
2.2
1.1
60K
Such data set can be represented by an m by n matrix,
where there are m rows, one for each object, and n
columns, one for each attribute
Projection
of x Load
Projection
of y load
Distance
Load
Thickness
1
0
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
11
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
12
Each document becomes a `term' vector,
A special type of record data, where
– each term is a component (attribute) of the vector,
– the value of each component is the number of times
the corresponding term occurs in the document.
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the items.
13
TID
Items
1
2
3
Bread, Coke, Milk
Beer, Bread
Beer, Coke, Diaper, Milk
4
5
Beer, Bread, Diaper, Milk
Coke, Diaper, Milk
© Tan,Steinbach, Kumar
Introduction to Data Mining
Examples: Generic graph and HTML Links
Benzene Molecule: C H
2
1
5
2
6
4/18/2004
14
4/18/2004
16
4/18/2004
18
6
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
<a href="papers/papers.html#aaaa">
Graph Partitioning </a>
<li>
<a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
<li>
<a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
5
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
15
© Tan,Steinbach, Kumar
Introduction to Data Mining
Sequences of transactions
Genomic sequence data
Items/Events
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
An element of
the sequence
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
17
© Tan,Steinbach, Kumar
Introduction to Data Mining
Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean
© Tan,Steinbach, Kumar
Introduction to Data Mining
4/18/2004
19