Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
S1. Loci derived from chicken Z chromosome-linked genes. Cytogenetic Accession Gene position No. Aldolase B, Fructose biphosphate (ALDOB) p1.2 M10946 Reference . Locus CHDZ15 CHDZ18 CHDZ20 CHDZ24 Primer locations Exon 4 Exon 5 Exon 6 Exon 7 Exon 7 Exon 8 Exon 12 Exon 13 Exon 15 Exon 16 Exon 15 Exon 16 Exon 18 Exon 19 Exon 20 Exon 21 Exon 24 Exon 25 [1] ALDOB4 ALDOB6 ALDOB7 GHR-5.1 Intron 5b GHR-5.2 Intron 5 BRM-12 Brahma protein (BRM) p.1.2 X91638 [2] BRM-15 Chromo-helicaseDNA-binding on the Z chromosome protein (CHDZ) Growth hormone receptor (GHR) q1.6-2.1 p2.2 AF004397 D13154 [3] [4] GHR-exon9 Exon 9 Protein kinase C inhibitor (PKCI) q1.1 AB026676 [5] PKCI-2 Exon 1 Intron 2 Prolactin receptor (PRLR) p2.2 AJ011128 [6] PRLRUN UN Patched (PTCH) q1.2-1.6 U40074 [7] PTCH-6 Spindlin (SPINZ) q1.1 AB047853 [8] SPINZ-2 [9] VLDLR7 VLDLR8 Very low density lipoprotein/ Vitellogenin receptor (VLDLR) p1.3 X80207 Exon 6 Exon 7 Exon 2 Exon 3 Exon 7 Exon 8 Exon 8 Exon 9 Primer sequences (5´-3´) F:GGCAGGAACAAATGGAGAAACT R:GCCAGAACCTGAAAACAGGAG F:AGACCATGATCTCCAGCGCT R:CCTTCCAGGTAGACATGATG F:GTTCCTGGTGATTCCTGATTC R:CAGATTCCTGCAAGAAAGAGG F:CCCTATCTCATCATTGTTCC R:CACAGAAGGAGCCCATTTGT F:AGCACCTTTGAACAGTGGTT R:TACTTTATGGAGACGACGGA F:TAGAGAGATTGAGAACTACAGT R:GACATCCTGGCAGAGTATCT F:TACATACAGGCTCTACTCCT R:CCCCTTCAGGTTCTTTAAAA F:GAAGAGAGCTGAAACTCGG R:TCATCTTCATCCATATTGG F:CATTCACCTGCACTCCTGAG R:GGCCTTTAAAGGACARTTCA F:GCTTCCATTATGTATCTTACC R:TTTGGCTTCTAGAGTTTTGCA F:ATGTTATTGCTTGTTCAGAGTG R:GAGTATTTGGAATAAAACAGCC F:TGTTGTACTTTCTCCAGGGC R:TCTGCCTCACAGAAATAGGTG F:GATATCTCACCCCAAGCTCCAAC R:CCCACTACTTCAGACAACATA F:GGAAAAGATAAGCGAGATGGAG R:CTTCTCAGCTTGACTGTCCTG F:CCATTTTCTTCCAAGCAATA R:TTTCTTGACAGTCCATAGCA F:TATGGACTAGAACTGCACAAAG R:AGACCATCCCCCTCCATTCATC F:CAGAAGTGGAGAATGCATAG R:ACAGTCACATTCATAGCCAA F:GTTATTGGCTATGAATGTGA R:GTTGATACAGATTTGGCTAC PCR conditionsa 58-35 56-37 61-40 55-35 60-35 50-35 60-5+ 55-27 58-5+ 50-30 50-35 58-35 58-35 52-39 47-35 58-39 53-40 51-40 60-35 57-35 VLDLR9 Exon 9 Exon 10 Exon 12 VLDLR-12 Exon 13 1. 2. 3. 4. 5. 6. 7. 8. 9. a F:AAGTGTGAATGTAGCCGTGG R:TCGGTTGGTGAAAATCAGAC F:GTTCCTTCCTCATCCTCTTG R:ATAGACTGCCTCGTTCTCTC 62-35 55-35 Burgess, D.G. and E.E. Penhoet, Characterization of the chicken aldolase B gene. Journal of Biological Chemistry, 1985. 260(8): p. 4604-14. Goodwin, G.H., Isolation of cDNAs encoding chicken homologues of the yeast SNF2 and Drosophila Brahma proteins. Gene, 1997. 184(1): p. 27-32. Griffiths, R. and R.M. Korn, A CHD1 gene is Z chromosome linked in the chicken Gallus domesticus. Gene, 1997. 197(1-2): p. 225-229. Tanaka, M., et al., Double antenna structure of chicken prolactin receptor deduced from the Cdna sequence. Biochemical and Biophysical Research Communications, 1992. 188(2): p. 490-496. Hori, T., et al., Wpkci, encoding an altered form of PKCI, is conserved widely on the avian W chromosome and expressed in early female embryos: Implication of its role in female sex determination. Molecular Biology of the Cell, 2000. 11(10): p. 3645-3660. Dunn, I.C., et al., Genetic mapping of the chicken prolactin receptor gene: a candidate gene for the control of broodiness. British Poultry Science, 1998. 39: p. S23-S24. Marigo, V., et al., Conservation in hedgehog signaling: Induction of a chicken patched homolog by Sonic hedgehog in the developing limb. Development, 1996. 122(4): p. 1225-1233. Itoh, Y., et al., Chicken spindling genes on W and Z chromosomes: transcriptional expression of both genes and dynamic behavior of spindlin in interphase and mitotic cells. Chromosome Research, 2001. 9(4): p. 283-299. Bujo, H., et al., Chicken oocyte growth is mediated by an 8 ligand-binding repeat member of the Ldl receptor family. Embo Journal, 1994. 13(21): p. 5165-5175. PCR conditions: Annealing temperature-number of cycles. All PCR reactions followed this three step format: (1:) 95 for 15 min/ 1 cycle; (2:) (94 for 30 sec, annealing temp for 30 sec, 72 for 1 min) number of cycles; (3:) 72 for 10 min/one cycle. For some loci step two were run two times with different annealing temperatures and number of cycles. b Primers designed in introns are flycatcher specific.