* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Manipulating DNA - Biology R: 4(A,C)
Holliday junction wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Promoter (genetics) wikipedia , lookup
DNA barcoding wikipedia , lookup
DNA sequencing wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Gel electrophoresis wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Molecular evolution wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA vaccination wikipedia , lookup
Restriction enzyme wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Molecular cloning wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Manipulating DNA In recent years, new varieties of farm plants and animals have been engineered by manipulating their genetic instructions to produce new characteristics. Have you ever had to cut something very small at a precise spot? How did you determine where and how to cut it? What do you end up with? 1. Look at the series of DNA nucleotides on your sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. How many occurrences of the sequence GTTAAC can you find? 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many times would you cut the DNA? How many fragments have 6, 10, & 15 bases? In the past, variation was limited to the variations already in nature or random variations that resulted from mutations. Now, scientists can change DNA and swap genes from one organism to another, designing new living things. Molecular Biology Tools Remember: Genetic engineering is making changes to DNA The steps include: DNA extraction (removal) Cutting DNA Separating DNA Making copies of DNA DNA Extraction Using a simple chemical procedure, cells are opened and DNA is separated and removed from the other cell parts. Cutting DNA DNA is too large to be analyzed, so it is precisely cut into smaller fragments using restriction enzymes Each restriction enzyme cuts DNA at a specific sequence of nucleotides Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Go to Section: Sticky end Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Go to Section: Sticky end Separating DNA DNA fragments are separated and analyzed using gel electrophoresis. DNA is placed at one end of a gel and an electric current pulls negatively charged DNA molecule toward the positive end of the gel Smaller DNA fragments move faster and farther across the gel Gel electrophoresis is used to compare DNA of different organisms or identifying one particular gene http://www.dnalc.org/ddnalc/resources/electrophoresis.html http://207.207.4.198/pub/flash/4/4.html Figure 13-6 Gel Electrophoresis Section 13-2 Power source DNA plus restriction enzyme Longer fragments Shorter fragments Mixture of DNA fragments Go to Section: Gel DNA Sequencing Now that the DNA is in manageable form, the DNA sequence can be read, studied or changed to study specific genes, compare genes of different organisms, and try to identify the function of different genes. Reading the DNA sequence: Obtain a single stranded piece of an organism’s DNA. As it replicates with bases labeled with color coded fluorescent dyes, the replication stops forming a fragment. After all of the DNA has replicated, tiny labeled fragments are left. The fragments are separated by gel electrophoresis and the pattern of the color coded fragments is read, telling scientists the exact DNA sequence. Figure 13-7 DNA Sequencing Section 13-2 Fluorescent dye Single strand of DNA Strand broken after A Power source Strand broken after C Strand broken after G Strand broken after T Go to Section: Gel Cutting and Pasting Now that the DNA sequence is known, it can be changed. Scientists can take a gene (piece of DNA) from one organism and attach it to the DNA of another organism = Recombinant DNA (combined DNA) Making Copies Scientists need many copies of a gene to study it, so they use a polymerase chain reaction (PCR): Scientists add primers (short complementary pieces of DNA) to both ends of the gene, the double stranded DNA is separated into single strands, then DNA polymerase makes copies of the DNA between the primers, and each copy serves as another template. Figure 13-8 PCR Section 13-2 DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied Go to Section: PCR cycles 1 2 3 4 5 etc. DNA copies 1 2 4 8 16 etc.