Download pdf - Nathanael Gray

Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Upregulation of IGF1R by Mutant RAS in Leukemia and
Potentiation of RAS Signaling Inhibitors by Small-Molecule
Inhibition of IGF1R
Ellen Weisberg, Atsushi Nonami, Zhao Chen, et al.
Clin Cancer Res Published OnlineFirst September 3, 2014.
Updated version
Supplementary
Material
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
doi:10.1158/1078-0432.CCR-14-0902
Access the most recent supplemental material at:
http://clincancerres.aacrjournals.org/content/suppl/2014/09/04/1078-0432.CCR-14-0902.DC1
.html
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Clinical
Cancer
Research
Cancer Therapy: Preclinical
Upregulation of IGF1R by Mutant RAS in Leukemia and
Potentiation of RAS Signaling Inhibitors by Small-Molecule
Inhibition of IGF1R
Ellen Weisberg1, Atsushi Nonami1, Zhao Chen1, Erik Nelson1, Yongfei Chen2, Feiyang Liu2, HaeYeon Cho3,
Jianming Zhang3, Martin Sattler1, Constantine Mitsiades1, Kwok-Kin Wong1, Qingsong Liu2,
Nathanael S. Gray3, and James D. Griffin1
Abstract
Purpose: Activating mutations in the RAS oncogene occur frequently in human leukemias. Direct
targeting of RAS has proven to be challenging, although targeting of downstream RAS mediators, such as
MEK, is currently being tested clinically. Given the complexity of RAS signaling, it is likely that combinations
of targeted agents will be more effective than single agents.
Experimental Design: A chemical screen using RAS-dependent leukemia cells was developed to identify
compounds with unanticipated activity in the presence of an MEK inhibitor and led to identification of
inhibitors of IGF1R. Results were validated using cell-based proliferation, apoptosis, cell-cycle, and gene
knockdown assays; immunoprecipitation and immunoblotting; and a noninvasive in vivo bioluminescence
model of acute myeloid leukemia (AML).
Results: Mechanistically, IGF1R protein expression/activity was substantially increased in mutant RASexpressing cells, and suppression of RAS led to decreases in IGF1R. Synergy between MEK and IGF1R
inhibitors correlated with induction of apoptosis, inhibition of cell-cycle progression, and decreased
phospho-S6 and phospho-4E-BP1. In vivo, NSG mice tail veins injected with OCI-AML3-lucþ cells showed
significantly lower tumor burden following 1 week of daily oral administration of 50 mg/kg NVP-AEW541
(IGF1R inhibitor) combined with 25 mg/kg AZD6244 (MEK inhibitor), as compared with mice treated with
either agent alone. Drug combination effects observed in cell-based assays were generalized to additional
mutant RAS-positive neoplasms.
Conclusions: The finding that downstream inhibitors of RAS signaling and IGF1R inhibitors have
synergistic activity warrants further clinical investigation of IGF1R and RAS signaling inhibition as a
potential treatment strategy for RAS-driven malignancies. Clin Cancer Res; 20(21); 1–13. 2014 AACR.
Introduction
RAS genes, which are the most frequent targets of dominant somatic mutations in human malignancies, encode a
family of proteins (H-RAS, N-RAS, K-RAS; reviewed in
1
Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard
Medical School, Boston, Massachusetts. 2High Magnetic Field Laboratory,
Chinese Academy of Sciences, Hefei, Anhui, PR China. 3Department of
Biological Chemistry and Molecular Pharmacology, Harvard Medical
School, Boston, Massachusetts.
Note: Supplementary data for this article are available at Clinical Cancer
Research Online (http://clincancerres.aacrjournals.org/).
E. Weisberg and A. Nonami contributed equally to this article.
Corresponding Authors: Ellen Weisberg, Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline Avenue, Boston, MA
02215, Mailstop: Mayer 540. Phone: 617-632-3575; Fax: 617-632-4388;
E-mail: [email protected]; and James D. Griffin, Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline
Avenue, Boston, MA 02215, Mailstop: Mayer 540. Phone: 617-632-3360;
Fax: 617-632-2260; E-mail: james_griffi[email protected]
doi: 10.1158/1078-0432.CCR-14-0902
2014 American Association for Cancer Research.
ref. 1), and it is estimated that 20% to 25% of patients with
acute myeloid leukemia (AML) have a RAS mutation (2). Of
relevance, transplantation of mice with bone marrow transduced with retroviral vectors encoding oncogenic KRAS or
NRAS has been shown to lead to AML (3–5).
Mediation of the effects of RAS by major signaling
pathways such as PI3K//PTEN/AKT/mTOR and Raf/
MEK/ERK has prompted the development of targeted
inhibitors of these pathways as a strategy to treat mutant
RAS-driven malignancies. Despite its prevalence and significance with respect to transformation, direct molecular
inhibition of mutant forms of RAS has thus far been
difficult due to its biochemistry and structure (6),
although KRAS (G12C) mutant-specific inhibitors, which
depend on mutant cysteine for their selective inactivation
of this mutant, have recently been reported and are in
early stages of development (7, 8). So far, attempts to
block RAS function, including inhibition of kinases associated with downstream effector pathways such as PI3K,
AKT, MEK, and mTOR, have shown fairly modest clinical
efficiency (9, 10).
www.aacrjournals.org
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
OF1
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Weisberg et al.
Translational Relevance
Use of a multitargeted therapy approach for malignancies driven by the highly prevalent RAS oncogene is
warranted in light of the elusiveness of direct RAS inhibition and limited clinical efficacy associated with
targeted inhibition of key mediators of RAS signaling.
A novel chemical screen using highly targeted agents to
identify kinases important for RAS signaling more easily
led to the discovery of synergism between MEK inhibition and inhibition of IGF1R against mutant RAS-positive leukemia. Elevation of functional IGF1R expression
in mutant RAS-expressing leukemia cells further supports the role of this molecule as a viable target and
highlights the potential for therapeutic intervention. A
combinatorial chemical screen that seeks to identify
molecules that synergize with the inhibition of bona
fide RAS effectors may yield drugs with therapeutic
potential and help researchers understand mechanisms
of RAS transformation.
Inhibition of MEK, a prominent downstream effector of
RAS, has been tested in mouse models of AML initiated by
hyperactive RAS, resulting in initial response followed by
relapse despite continued treatment, apparently by outgrowth of pre-existing drug-resistant clones (11). The
development of "first-generation" allosteric MEK inhibitors, such as CI-1040 and PD0325901, was halted
because of toxicity and minimal activity in RAS-mutant
tumors (12).
While newer MEK inhibitors, such as AZD6244 (13),
show less toxicity and more effectiveness against RAS
mutant-positive solid tumors, it is still unclear whether they
are better than standard therapies. For example, a phase II
trial of AZD6244 for patients with advanced AML showed
only transient and modest effectiveness (14). As the limited
efficacy of inhibitors of RAF/MEK/ERK signaling or PI3K/
AKT in mutant RAS-positive cancer is believed to be due to
negative feedback loops and compensatory activation of the
different signaling pathways, the simultaneous testing of
inhibitors of multiple effectors in mutant RAS-positive
cancers is reasonable.
To address this, we designed a chemical screen to identify
agents capable of potentiating the activity of the MEK
inhibitor, AZD6244, against mutant RAS-dependent AML
cells. In addition to the identification of inhibitors of wellknown downstream mediators of RAS signaling, including
inhibitors of mTOR, and PI3K signaling, the chemical
screen also led to the identification of the small-molecule
inhibitor, GSK1904529A, which selectively inhibits IGF1R
with nanomolar potency and which exhibits potent antitumor activity (15). This finding prompted investigation of
underlying mechanism(s) of synergy between IGF1R inhibition and MEK inhibition against mutant RAS-positive
AML, as well as further exploration of IGF1R as a potential
therapeutic target for this disease.
OF2
Clin Cancer Res; 20(21) November 1, 2014
Materials and Methods
LINCS library chemical screen
We designed a chemical screen using the kinase inhibitor–focused library, LINCS, to identify selective kinase
inhibitors capable of synergizing with the MEK inhibitor,
AZD6244, against mutant NRAS-driven cells (see schematic, Supplementary Fig. S1). The LINCS library is available
from Harvard Medical School/NIH LINCS program
(https://lincs.hms.harvard.edu/) and contains 202 known
selective and potent kinase inhibitors.
Cell lines and cell culture
IL3-dependent murine Ba/F3 cells, cultured with 3 ng/mL
of mIL3, were transduced with NRAS G12D or KRAS G12D
containing murine stem cell virus (MSCV) retroviruses
harboring an IRES-GFP. After withdrawal of mIL3, these
cell lines became growth factor–independent.
The human, mutant NRAS-expressing AML line, OCIAML3, and mutant KRAS-expressing AML lines, SKM-1
(KRAS K117N), NOMO-1 (KRAS G13D), and NB4 (KRAS
A18D), were obtained from Dr. Gary Gilliland. The wildtype (wt) RAS-expressing line, HEL, and mutant NRASpositive line, HL60, were purchased from ATCC. Wt RASpositive MOLM14 (16) was provided by Dr. Scott Armstrong and transduced with the FUW-Luc-mCherry-puro
lentivirus (17).
FLT3-ITD-containing MSCV retroviruses were transfected
into the IL3-dependent murine hematopoietic cell line Ba/
F3 as previously described (18). Ba/F3.p210 cells were
obtained by transfecting the IL3-dependent marine
hematopoietic Ba/F3 cell line with a pGD vector containing
p210BCR-ABL (B2A2) cDNA (19–21).
Ba/F3-NRAS-G12D, Ba/F3-KRAS-G12D, HEL, MOLM14,
HL60, NOMO-1, NB4, and SKM-1 cells were cultured with
5% CO2 at 37 C, at a concentration of 2 105 to 5 105 in
RPMI (Mediatech, Inc.) with 10% FBS and supplemented
with 2% L-glutamine and 1% penicillin/streptomycin. OCIAML3 cells were cultured in alpha MEM (Mediatech, Inc.)
with 10% FBS and supplemented with 2% L-glutamine
and 1% penicillin/streptomycin. Parental Ba/F3 cells were
cultured in RPMI with 10% FBS and supplemented with 2%
L-glutamine and 1% penicillin/streptomcyin, as well as 15%
WEHI-conditioned medium (as a source of IL3).
We have authenticated the following cell lines through
cell line short tandem repeat (STR) profiling (DDC Medical,
Fairfield, OH): MOLM14, NOMO-1, HEL, SKM-1, OCIAML3, and NB4. All cell lines matched >80% with lines
listed in the DSMZ Cell Line Bank STR Profile Information.
Chemical compounds and biologic reagents
GSK1904529A, AZD6244, PD0325901, GSK2126458,
GSK1120212, AZD8330, PI-103, and ZSTK474 were purchased from MedChem Express Co. Ltd. NVP-AEW541 was
synthesized by Novartis Pharma AG and was dissolved in
DMSO to obtain a 10 mmol/L stock solution. Serial dilutions were then made to obtain final dilutions for cellular
assays with a final concentration of DMSO not exceeding
0.1%.
Clinical Cancer Research
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
IGF1R: A Novel Target for Mutant RAS-Positive Cancer
Proliferation studies, apoptosis assays, and cell-cycle
analysis
The trypan blue exclusion assay has been previously
described (22) and was used for quantification of cells
before seeding for Cell Titer Glo assays. The Cell Titer Glo
assay (Promega) was used for proliferation studies and
carried out according to manufacturer instructions. Cell
viability is reported as percentage of control (untreated)
cells, and error bars represent the SEM for each data point.
Programmed cell death of inhibitor-treated cells was determined using the Annexin-V-Fluos Staining Kit (Boehringer
Mannheim), as previously described (22). Cell-cycle analysis was carried out via propidium iodide staining and FACS
analysis.
Mononuclear cells
Mononuclear cells were purchased from STEMCELL
Technologies and cultured in the presence of DMEM with
10% FBS and supplemented with 2% L-glutamine and 1%
penicillin/streptomycin.
Antibodies, immunoblotting, and immunoprecipitation
The following antibodies were purchased from Cell Signaling Technology: phospho-4E-BP1 (S65) (rabbit,
#9451), phospho-4E-BP1 (Thr37/46) (236B4) (rabbit mAb
#2855), and total 4E-BP1 (53H11) (rabbit mAb, #9644)
were used at 1:1,000. Phospho-AKT (Ser 473) (D9E) XP(R)
(rabbit mAb, #4060) and total AKT (rabbit, #9272) were
used at 1:1,000. Phospho-p44/42 MAPK (T202/Y204) (rabbit, #9101) and total p44/42 MAPK (Erk1/2) (3A7) (mouse,
#9107) were used at 1:1,000. Phospho-S6 ribosomal protein (S235/236)(D57.2.2E) XP (R) (rabbit mAb, #4858)
was used at 1:1,000. Total S6 ribosomal protein (SG10)
(rabbit mAb, #2217) was used at 1:1,000. Phospho-IGF1Rb
(Y1135/1136/InsRbeta) (19H7) (rabbit mAb, #3024) was
used at 1:1,000 in the presence of 5% BSA. Total IGF1Rb
(D23H3) XP(R) (rabbit mAb, #9750) was used at 1:1,000.
b-Tubulin (rabbit, #2146) was used at 1:1,000. AntiGAPDH (D16H-11) XP (R) (rabbit mAb, #5174) was used
at 1:1,000.
Anti-c-N-ras (Ab-1) (mouse, F155-227) was purchased
from Calbiochem and used at 1:300. Total IGF1Ra (N-20):
SC-712 (rabbit) was purchased from Santa Cruz Biotechnology and used at 1:1,000. Anti-b-actin (A1978, clone AC15) (mouse) was purchased from Sigma-Aldrich and used at
1:1,000. Anti-KRAS (mouse, ab55391) was purchased from
Abcam and used at 1:500.
Protein lysate preparation and immunoblotting were
carried out as previously described (22).
Drug combination studies
For drug combination studies, single agents were added
simultaneously at fixed ratios to cells. Cell viability was
determined using the trypan blue exclusion assay to quantify cells for cell seeding and Cell Titer Glo for proliferation
studies. Cell viability was expressed as the function of
growth affected (FA) drug-treated versus control cells; data
were analyzed by CalcuSyn software (Biosoft), using the
www.aacrjournals.org
Chou–Talalay method (23). The combination index ¼
[D]1/[Dx]1 þ [D]2/[Dx]2, where [D]1 and [D]2 are the concentrations required by each drug in combination to
achieve the same effect as concentrations [Dx]1 and [Dx]2
of each drug alone.
Knockdown of genes by shRNA
pLKO.1puro lentiviral shRNA vector particles against
KRAS and IGF1R were purchased from Sigma-Aldrich. Cells
were incubated with the viral particles in the presence of 8
mg/mL polybrene for 24 hours, and the cells were selected
with 1 to 2 mg/mL puromycin for 72 hours. Following
selection, cells were used for the studies described.
The sequences of shRNA are follows:
GFP: ACAACAGCCACAACGTCTATA
IGF1: CCTTAACTGACATGGGCCTTT
IGF2: GCCGAAGATTTCACAGTCAAA
KRAS3: GCAGACGTATATTGTATCATT
While knockdown of RAS and IGF1R inhibited the
growth of mutant KRAS-expressing cells (data not shown),
as compared with GFP control, it did not inhibit growth to
the extent of prohibiting analysis of proliferation or validation of gene knockdown by Western blot analysis. Knockdown of RAS in HEL cells did not inhibit the growth of these
cells (data not shown).
In vivo model of mutant NRAS-positive leukemia
Cells were transduced with a retrovirus encoding firefly
luciferase (MSCV-Luc) and selected with neomycin to produce OCI-AML3-lucþ cells. Six-week-old female NSG mice
were purchased from Jackson Laboratories. A total of 1.5 106 OCI-AML3-lucþ cells were administered by tail vein
injection. Mice were imaged and total body luminescence
was quantified as previously described (22). One week after
inoculation, treatment cohorts with matched tumor burden
were established. Cohorts of mice were treated with oral
administration of 50 mg/kg NVP-AEW541 per day, 25 mg/
kg AZD6244 per day, or a combination of both. AZD6244
was reconstituted in 0.5% methylcellulose (Fluka) and
0.4% polysorbate (Tween80; Fluka). NVP-AEW541 was
dissolved in 1 part N-methyl-2-pyrrolidone and then diluted with 9 parts PEG300. Tumor burden was assessed by
serial bioluminescence imaging. Spleens were dissected and
measured 1 week following the last imaging point (which
was following 7 days of drug treatment). Major tissues were
preserved in 10% formalin for histopathologic analysis.
Studies were performed with Animal Care and Use Committee protocols at Dana-Farber Cancer Institute (Boston,
MA).
AML patient cells
Mononuclear cells were isolated from samples from
patients with AML identified as harboring mutant NRAS.
Cells were tested in liquid culture (DMEM, supplemented
with 20% FBS) in the presence of different concentrations of
Clin Cancer Res; 20(21) November 1, 2014
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
OF3
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Weisberg et al.
single and combined agents. All blood and bone marrow
samples from patients with AML were obtained under
approval of the Dana-Farber Cancer Institute Institutional
Review Board.
Results
Inhibitors of PI3K and mTOR synergize with AZD6244
We screened the LINCS kinase inhibitor–focused chemical library, which is made up of highly selective smallmolecule inhibitors, in an effort to find compounds that
positively combine with the MEK inhibitor, AZD6244
(24) against mutant NRAS-expressing cells (see schematic, Supplementary Fig. S1). A number of interesting
LINCS library compounds, including selective inhibitors
of MEK and PI3K, were identified in the chemical screen
as showing strong selective single-agent activity against
Ba/F3-NRAS G12D cells and the human mutant NRASexpressing AML cell line, OCI-AML3, with little-to-no
activity against parental Ba/F3 cells (known to be RAS
independent for proliferation; Supplementary Fig. S2).
AZD6244 was observed to synergize with LINCS library
inhibitors of PI3K and mTOR, the targets of which mediate mutant RAS signaling, against mutant NRAS-expressing cells, Ba/F3-NRAS-G12D and OCI-AML3, but not
wt RAS-expressing HEL cells (Fig. 2 and Supplementary
Fig. S3). These results validate the suitability of the design
of the chemical screen to identify inhibitors relevant to
mutant RAS signaling as able to enhance the effects of
AZD6244.
The IGF1R inhibitor GSK1904529A synergizes with
AZD6244 against mutant RAS-expressing cells
Interestingly, the chemical screen led to the identification
of the IGF1R inhibitor, GSK1904529A, as able to selectively
potentiate the effects of AZD6244 against mutant NRAS- or
KRAS-expressing Ba/F3 cells with no apparent combination
effect observed against parental Ba/F3 cells (Fig. 1A–C
and Fig. 2). This suggests that drug effects are targeted to
mutant RAS, as exogenous expression of mutant RAS in
growth factor–dependent Ba/F3 cells confers growth factor
independence and renders cells solely dependent on
mutant NRAS; selective inhibition of mutant RAS in this
system would be expected to cause cells to die in the absence
of growth factor. Target specificity of IGF1R and MEK
inhibition was further investigated by treating Ba/F3NRAS-G12D cells with IGF1R and MEK inhibitors, alone
and combined, in the absence and presence of 15% WEHIconditioned media (used as a source of IL3) in parallel. As
expected, potent suppression of Ba/F3-NRAS-G12D growth
was observed following drug treatment in the absence of
Figure 1. Identification of GlaxoSmithKline (GSK) IGF1R inhibitor GSK1904529A as able to potentiate the effects of MEK inhibition in mutant NRAS- and
KRAS-expressing cells; characterization of IGF1R protein expression in mutant NRAS- and KRAS-expressing cells. A–C, approximately 3-day proliferation
studies performed with GSK1904529A and AZD6244 against Ba/F3-NRAS-G12D cells. AZD6244 þ GSK1904529A studies against Ba/F3 (n ¼ 3),
Ba/F3-NRAS-G12D (n ¼ 6), and Ba/F3-KRAS-G12D cells (n ¼ 2). D and E, IGF1R expression in parental Ba/F3 versus Ba/F3-NRAS-G12D and
Ba/F3-KRAS-G12D cells. F, comparison of IGF1R expression in Ba/F3, Ba/F3.p210, Ba/F3-FLT3-ITD, and mutant RAS-expressing Ba/F3 cells. Shown in
parentheses adjacent to the symbol keys are estimated IC50 values (nmol/L) corresponding to individual drugs or drug combinations.
OF4
Clin Cancer Res; 20(21) November 1, 2014
Clinical Cancer Research
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
IGF1R: A Novel Target for Mutant RAS-Positive Cancer
Figure 2. Combination indices
corresponding to proliferation
studies investigating effects of
MEK inhibition combined with
LINCS chemical library inhibitors
against AML cell lines. Values less
than 0.9 indicate synergy and are in
shades of red. (Darker shades
signify higher synergy). Values
greater than 0.9 do not indicate
synergy and are colored white.
Values less than 1 indicate synergy,
whereas values greater than 1
indicate antagonism. CalcuSyn
combination indices can be
interpreted as follows: CI values
< 0.1 indicate very strong
synergism; values 0.1–0.3 indicate
strong synergism; values 0.3–0.7
indicate synergism; values 0.7–
0.85 indicate moderate synergism;
values 0.85–0.90 indicate slight
synergism; values 0.9–1.1 indicate
nearly additive effects; values
1.10–1.20 indicate slight
antagonism; values 1.20–1.45
indicate moderate antagonism;
values 1.45–3.3 indicate
antagonism; values 3.3–10
indicate strong antagonism; values
>10 indicate very strong
antagonism. Note: For some
experiments, namely those in
which there was no observed
single-agent activity, combination
indices could not be reliably
calculated using the CalcuSyn
software.
15% WEHI; however, partial IL3 rescue was observed for
each single agent and the potency of the combined inhibitors was substantially lower when Ba/F3-NRAS-G12D cells
were cultured in the presence of 15% WEHI (Supplementary Fig. S4). These results suggest that in the Ba/F3 system,
IGF1R inhibition and MEK inhibition selectively block RAS
signaling without nonselectively interfering with IL3-mediated signaling.
Ba/F3-NRAS-G12D cells were observed to overexpress
NRAS as compared with parental Ba/F3 cells; however,
neither single-agent treatment nor drug combination treatment altered mutant RAS expression in mutant RAS-expressing Ba/F3 cells (Supplementary Fig. S5A and S5B). Elevated
levels of IGF1R were also observed in Ba/F3-NRAS-G12D or
Ba/F3-KRAS-G12D cells, as compared with parental Ba/F3
cells (Fig. 1D and E). There was no effect of short-term (1
hour) treatment with AZD6244 or GSK1904529A, alone or
combined, on levels of IGF1R protein or activity in
mutant RAS-expressing Ba/F3 cells (Supplementary Fig.
S5C–S5E). IGF1R protein was observed to be phosphorylated in both parental Ba/F3 cells and Ba/F3-NRASG12D cells, with IGF1R phosphorylation in parental
Ba/F3 cells possibly associated with the IL3 responsiveness of the cells (Supplementary Fig. S5F). In a report by
www.aacrjournals.org
Soon and colleagues (25), IL4 was shown to stimulate
IGF1R phosphorylation to a similar extent to IGF1 in
growth factor–dependent parental 32D cells. The link
between IL3 and IGF1R activity is illustrated in a study
in which IL3 simulated IGF1 in inducing cell-cycle progression of IL3-dependent FDC-PI cells made to conditionally proliferate in response to IGF1R activation (26).
IGF1R and downstream molecules characteristically
transduce antiapoptotic signals; IL3 also induced antiapoptotic pathways in these cells. It is possible, therefore,
that we are observing a similar association between IL3
and IGF1R activity in parental Ba/F3 cells cultured in the
presence of IL3, as these cells are resistant to IGF1R
inhibitor and MEK inhibitor–induced apoptosis.
We observed IGF1R levels in Ba/F3 cells transformed by
FLT3-ITD or BCR-ABL to be similar to those observed in
parental Ba/F3 cells and considerably less than those
observed in Ba/F3-NRAS-G12D and Ba/F3-KRAS-G12D
cells (Fig. 1F). These data suggest that not all oncogenes
that are capable of conferring growth factor independence
in Ba/F3 cells have the same inductive influence on IGF1R
and support the notion that IGF1R overexpression in
mutant RAS-expressing Ba/F3 cells is associated with
mutant RAS expression.
Clin Cancer Res; 20(21) November 1, 2014
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
OF5
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Weisberg et al.
GSK1904529A and AZD6244 synergized against mutant
NRAS-expressing cell lines OCI-AML3 and HL60, as well as
active KRAS-expressing and dependent NOMO-1, NB4, and
SKM-1 cells (Figs. 2 and 3A–E). In contrast, GSK1904529A
and AZD6244 did not positively combine against wt RASexpressing HEL or MOLM14 cells (Fig. 3F and G) or normal
mononuclear cells (Fig. 3H). Importantly, increased apoptosis and cell-cycle arrest and decreased soft agar colony
formation were observed to correlate with combined drug
treatment in mutant RAS-expressing AML cells, however,
not wt RAS-expressing AML cells (Supplementary Fig. S6).
As leukemic cells in patients are exposed to growth
factors, especially in the bone marrow, which could lead
to drug resistance, we tested the ability of IGF1R inhibition
and MEK inhibition to synergize against mutant RAS-positive AML cells in the presence of cytoprotective stromal
conditioned media (SCM) derived from 2 different human
stromal cell lines (HS-5 and HS27a). Despite a 15% to 20%
cytoprotective effect of SCM on drug-treated cells, synergy
was observed between GSK1904529A and AZD6244 that
was similar to that observed between the drugs in the
absence of SCM (i.e., the ED50 for GSK1904529A and
AZD6244 against NOMO-1 in the presence of HS27a SCM
was 0.21917; Supplementary Fig. S7 and data not shown).
Of note, we observed a heightened response of mutant
RAS-expressing HL60 cells to IGF, as compared with wt RAS-
Figure 3. Combined effects of GSK1904529A and AZD6244 against human AML cells harboring wt or mutant RAS. A, approximately 72-hour representative
proliferation study performed with GSK1904529A and AZD6244, against mutant NRAS-expressing OCI-AML3 (n ¼ 3). B, approximately 48-hour proliferation
study performed with GSK1904529A and AZD6244 against mutant NRAS-expressing HL60. C–E, approximately 72-hour representative proliferation
studies performed with GSK1904529A and AZD6244 against NOMO-1 (KRAS G13D) (n ¼ 4), NB4 (KRAS A18D) (n ¼ 2), or SKM-1 (KRAS K117N)
(n ¼ 2) cells. F and G, approximately 72-hour representative proliferation studies performed with GSK1904529A and AZD6244, against wt Ras-expressing Hel
(n ¼ 2) and Molm14 cells. Shown in parentheses adjacent to the symbol keys for all graphs (A–G) are estimated IC50 values (nmol/L) corresponding to
individual drugs or drug combinations. H, shown as a normal control are the effects of 2 days of treatment using GSK1904529A and AZD6244, alone and
combined, against mononuclear cells derived from normal donors cultured in DMEM þ 10% FBS (n ¼ 3). NB4 cells were tested in parallel as a positive
control for drug stock integrity. I, effect of knockdown of KRAS on IGF1R expression in wt and mutant KRAS-expressing AML cells. Hairpins "2" and "3"
were used for knockdown experiments.
OF6
Clin Cancer Res; 20(21) November 1, 2014
Clinical Cancer Research
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
IGF1R: A Novel Target for Mutant RAS-Positive Cancer
expressing HEL cells (Supplementary Fig. S8). As some
mutant RAS-positive cells may respond to IGF existing in
serum, these results suggest that an IGF1R inhibitor may be
more effective than an AKT inhibitor in suppression of
PI3K/AKT signaling in mutant RAS-expressing cells. The
data also support the use of HEL cells as a wt RAS-expressing
control in studies involving IGF1R inhibition.
Ba/F3-KRAS-G12D cells treated overnight with an MEK
inhibitor (AZD6244, 300 nmol/L) or PI3K inhibitors (BEZ235, 1,000 nmol/L; PI-103, 1,000 nmol/L) showed a small
reduction in IGF1R proreceptor and IGF1R b levels (data
not shown). However, KRAS knockdown selectively led to
substantial decreases in IGF1R levels in active KRAS-expressing cell lines, NOMO-1 and NB4 (Fig. 3I). The knockdown
studies revealed these cell lines, as well as the active KRASexpressing line, SKM-1, to be dependent on KRAS as KRAS
knockdown resulted in a loss of cell viability (data not
shown). This is in contrast to wt RAS-expressing HEL cells,
for which KRAS knockdown did not lead to a loss of cell
viability (data not shown).
GSK1904529A synergizes with PI3K inhibitor
ZSTK474 against mutant RAS-expressing cells
To determine whether the positive combination observed
between GSK1904529A and AZD6244 is unique or can be
replicated by combining GSK1904529A with inhibitors of
other downstream mediators of RAS transformation, we
investigated the ability of GSK1904529A to positively combine with an inhibitor of PI3K signaling. The combination
of GSK1904529A and the PI3K inhibitor, ZSTK474 (27),
was antagonistic against parental Ba/F3 cells. However, a
positive drug combination effect was observed against
mutant NRAS- and mutant KRAS-expressing Ba/F3 cells
(Supplementary Fig. S9).
Inhibition of ERK1/ERK2 phosphorylation predicts
responsiveness to GSK1904529A and AZD6244 in
RAS-transformed cells
In an attempt to better understand the mechanism underlying the observed synergy between AZD6244 and
GSK1904529A against RAS-transformed cells, we tested
the single-agent effects of AZD6244 and GSK1904529A
on both ERK1/ERK2 and IGF1R expression/activity.
GSK1904529A was observed to inhibit phosphorylation of
IGF1R in a concentration-dependent manner (Fig. 4A);
however, it showed no inhibitory activity against phosphorylation of ERK1/ERK2 (Fig. 4B). Similarly, AZD6244 did
not inhibit the activity or expression of IGF1R (Fig. 4C and
D); however, it inhibited phosphorylation of ERK1/ERK2 in
a concentration-dependent manner (Fig. 4E). These data
suggest that GSK1904529A and AZD6244 are selective
toward their respective molecular targets; the lack of target
redundancy is supportive of the observed synergy between
the 2 agents in this system.
We investigated whether or not a correlation exists
between the heightened responsiveness of mutant RASexpressing cells to simultaneous IGF1R and MEK inhibition
and the basal expression/activity of integral mediators of the
www.aacrjournals.org
IGF1R or Raf/MEK/ERK signaling pathways. Higher basal
levels of phospho-ERK1/ERK2 were observed in Ba/F3NRAS-G12D and Ba/F3-KRAS-G12D cells, as compared
with parental Ba/F3 cells (Supplementary Fig. S10A). Generally, high levels of phosphorylated Erk/Erk2 were
observed in wt and mutant RAS-expressing human AML
lines (Supplementary Fig. S10B). IGF1R was observed to be
detectable (expressed) and phosphorylated (active) in wt
and mutant RAS-expressing AML lines (Supplementary Fig.
S10C and S10D); however, mutant NRAS-expressing OCIAML3 and mutant KRAS-expressing SKM-1 showed comparatively elevated phospho/total IGF1R ratios in the panel
of AML lines studied (Supplementary Fig. S10C).
We observed significant inhibition of ERK phosphorylation by AZD6244 in mutant NRAS- and mutant KRASexpressing cells, which was sustained in cells treated with
both GSK1904529A and AZD6244 (Supplementary Fig.
S11 and data not shown). When compared with MOLM14
and HEL cells, OCI-AML3 cells treated with the same concentrations of AZD6244 and GSK1904529A showed substantially higher phospho-ERK inhibition by AZD6244
or the drug combination (Supplementary Fig. S11A).
The effects of AZD6244, alone or combined with
GSK1904529A, were similarly more strongly suppressive
of ERK phosphorylation in mutant KRAS-expressing cells
than in wt RAS-expressing HEL cells (Supplementary Fig.
S11B). These results suggest that the inhibition of phosphoERK1/ERK2 is likely required for an MEK inhibitor and
IGF1R inhibitor to positively combine against mutant RASexpressing or wt RAS-dependent AML cells.
The selective IGF1R inhibitor, NVP-AEW541, synergizes
with AZD6244 against mutant RAS-expressing cells
As GSK1904529A is equipotent toward the insulin receptor (IR) and IGF1R receptor, and NVP-AEW541 (Novartis
Pharma AG) shows far greater (100-fold) selectivity toward
IGF1R over IR, we were interested in testing the ability of the
more selective IGF1R inhibitor to synergize with AZD6244
against mutant RAS-expressing cells. Whereas the combination of NVP-AEW541 and AZD6244 against parental Ba/
F3 cells was antagonistic, this combination showed synergy
against Ba/F3-NRAS-G12D and Ba/F3-KRAS-G12D cells
(Figs. 2 and 5A–C and Supplementary Fig. S4). NVPAEW541, similar to GSK1904529A, inhibited the phosphorylation of IGF1R in a concentration-dependent
manner; however, it did not inhibit phosphorylation of
ERK1/ERK2 (Supplementary Fig. S12).
Ribosomal protein S6 and 4E-BP1 as mediators of
synergy between IGF1R inhibition and MEK inhibition
in mutant RAS-expressing cells
We did not observe enhanced inhibition of ERK1/ERK2
or AKT phosphorylation in mutant RAS-expressing cells
treated with the combination of MEK and IGF1R inhibitors,
as compared with either agent alone (Supplementary Fig.
S13). Inhibition of phosphorylation of AKT, however, is
clearly shown by both IGF1R inhibitors, NVP-AEW541 and
GSK1904529A, which is expected as AKT is downstream of
Clin Cancer Res; 20(21) November 1, 2014
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
OF7
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Weisberg et al.
Figure 4. Effects of GSK1904529A and AZD6244 as single agents, respectively, on mediators of IGF1R and ERK1/ERK2 signaling pathways. A and B, effect of
GSK1904529A on phosphorylation of IGF1R (A) and ERK1/ERK2 (B). C–E, effect of AZD6244 on phosphorylation of IGF1R (C), IGF1R protein expression levels
(D), and phosphorylation of ERK1/ERK2 (E).
IGF1R. The lack of enhanced inhibition of phospho-AKT by
the drug combination is also not surprising, as AZD6244
selectively acts on the MAPK signaling pathway. The lack of
elevated inhibition of phosphorylation of ERK1/ERK2 suggests that this factor may not contribute significantly to the
observed synergy between IGF1R and MEK inhibition.
As these results are consistent with each inhibitor selectively targeting its own independent signaling pathway, we
decided to investigate drug combination effects on signaling
mediators downstream of IGF1R and RAS that are influenced by both the PI3K//PTEN/AKT/mTOR and Raf/MEK/
ERK signaling. We identified ribosomal protein S6 and 4EBP1 as potential mediators of IGF1R and MEK inhibitor
synergy, with the phosphorylation of ribosomal protein S6
and 4E-BP1 at Thr37/46 more greatly suppressed by the
combination of IGF1R and MEK inhibition in mutant RAStransformed cells (Fig. 5D–G). In contrast, we observed
no enhanced inhibition of phosphorylation of 4E-BP1 at
OF8
Clin Cancer Res; 20(21) November 1, 2014
Serine 65 by the drug combination (Supplementary Fig.
S14), suggesting that this phosphorylation site may not
significantly contribute to the observed synergy between
IGF1R and MEK inhibition. The enhanced suppression of
S6 and 4E-BP1 (Thr 37/46) phosphorylation may thus add
to the individual or parallel effects of both inhibitors in
mediating growth inhibition.
Effects of IGF1R knockdown in mutant RAS-expressing
cells
Knockdown of IGF1R in the mutant KRAS-expressing cell
line, NB4, led to a decrease in cell growth (Supplementary
Fig. S15A and S15E), suggesting that IGF1R is important for
the viability of these cells. Single-agent and drug combination effects were modestly augmented in IGF1R knockdown
cells as compared with control cells (Supplementary Fig.
S15B). In contrast, IGF1R knockdown in wt RAS-expressing
HEL cells had less of an inhibitory effect on cell growth and
Clinical Cancer Research
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
IGF1R: A Novel Target for Mutant RAS-Positive Cancer
Figure 5. Combined effects of Novartis IGF1R inhibitor, NVP-AEW541, and AZD6244 on mutant RAS-expressing cells; identification of S6 and 4E-BP1
as potential mediators of synergy between inhibitors of IGF1R and MEK in mutant RAS-expressing cells. A–C, approximately 72-hour proliferation
studies performed with NVP-AEW541 and AZD6244, alone or combined, against parental Ba/F3 and Ba/F3-NRAS-G12D or Ba/F3-KRAS-G12D cells. Shown
in parentheses adjacent to symbol keys are estimated IC50 values (nmol/L) corresponding to individual drugs or drug combinations. D, effects of
IGF1R inhibition or MEK inhibition, alone or combined, on phospho-S6 expression in Ba/F3-KRAS-G12D cells. E, effects of IGF1R inhibition or MEK inhibition,
alone or combined, on phospho-S6 expression in active KRAS-expressing human AML lines, Nomo-1 and NB4. F, effects of IGF1R inhibition, alone or
combined, on phospho-S6 expression in Ba/F3-NRAS-G12D cells. G, effects of IGF1R inhibition, alone or combined, on phospho-4E-BP1 (Thr 37/46)
in Ba/F3-NRAS-G12D cells.
did not affect drug sensitivity of the cells (Supplementary
Fig. S15C, S15D, and S15F). Interestingly, there was no
apparent decrease in the phosphorylation of AKT or downstream signaling mediators, 4E-BP1 or S6, in IGF1R knockdown cells (data not shown). One possibility for this is that
the more transient timing of inhibition of IGF1R and MEK
through pharmacologic inhibition (2–3 days) as compared
with that of IGF1R gene knockdown (over a week) may
make the latter more subject to compensatory feedback
loops characteristic of IGF1R signaling.
In vivo efficacy of IGF1R inhibition and MEK inhibition
in a mutant NRAS-positive leukemia mouse model
We used a mouse model of mutant NRAS-positive leukemia to examine the in vivo effects of IGF1R inhibition
combined with MEK inhibition. The combination of NVP-
www.aacrjournals.org
AEW541 and AZD6244 was observed to be significantly
more effective in suppressing leukemia burden in mice tail
vein injected with OCI-AML3-lucþ cells, as compared with
either agent alone following 1 week of drug administration
(Fig. 6), and mouse spleen sizes, measured 1 week later,
were observed to be smallest in drug combination–treated
mice (Supplementary Fig. S16). It should be noted, however, that while a difference in engraftment was observed on
day 7 following drug treatment between single-agent–treated and combination-treated mice, there was continued
growth of leukemic cells in drug-treated groups.
Efficacy of IGF1R inhibition and MEK inhibition
against mutant NRAS-positive primary AML cells
We also tested the combined IGF1R and MEK inhibition
in 3 mutant NRAS-expressing primary AML patient cells,
Clin Cancer Res; 20(21) November 1, 2014
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
OF9
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Weisberg et al.
Baseline images
#3A
#4A
#3B #4B
#3C #4C
7 days treatment (every day)
Bioluminescence
(p/sec/cm2/sr)
AZD6244
(25 mg/kg)
#3A #4A
NVP-AEW541
(50 mg/kg)
#3B #4B
AZD6244 (25 mg/kg)+
NVP-AEW541 (50 mg/kg)
#3C #4C
P < 0.031
4E+09
3.5E+09
3E+09
2.5E+09
P < 0.013
Figure 6. Combined effects of
IGF1R and MEK inhibition in an
in vivo model of mutant NRASpositive leukemia. In vivo effects of
NVP-AEW541 and AZD6244, alone
and combined, in a xenograft
model of mutant NRAS-positive
AML. Representative mouse
images are shown comparing
baseline images before drug
treatment and following 7 days of
treatment with NVP-AEW541
(50 mg/kg once per day), AZD6244
(25 mg/kg once per day), or a
combination of the 2 agents.
Corresponding bioluminescence
values for NVP-AEW541–treated
mice (n ¼ 3), AZD6244-treated
mice (n ¼ 4), and combinationtreated mice (n ¼ 4) are shown as a
bar graph. P values indicating
statistical significance are shown
and were derived by the Student
t test. Significance was defined as
P < 0.05.
2E+09
Baseline
Baseline
1.5E+09
DrugTreatment
treatment
(7 days)
Drug
(7 Days)
1E+09
500,000,000
0
NVP-AEW541
AZD6244
AZD6244+NVP-AEW541
using the same drug concentrations used for cell line–based
studies (0, 75, 150, 300 nmol/L), and observed more cell
death with the combination than either agent alone (Supplementary Fig. S17). Importantly, for patient sample AML3
(NRAS-G13V, with 92% bone marrow blasts), combination
indices suggested nearly additive–synergistic effects for the
combination of NVP-AEW541 and AZD6244: ED25
(0.98304, nearly additive); ED50 (0.21557, synergy);
ED75 (0.14790, synergy); ED90 (0.26906, synergy). These
data support the potential clinical utility of this drug combination for mutant NRAS-positive AML.
Discussion
In hematologic malignancies, NRAS and KRAS are each
frequently mutated. In AML, NRAS codon 12, 13, or 61
mutations have been reported in 10% to 11% of cases,
whereas KRAS mutations have been reported in 5% of cases
(28, 29). Direct inhibition of mutant RAS with small
molecules has proven difficult, and the effects of targeting
downstream RAS effectors have been difficult to predict.
This justifies targeting multiple downstream effectors of
OF10
Clin Cancer Res; 20(21) November 1, 2014
RAS or RAS-associated factors as a strategy designed to
increase clinical efficacy and circumvent drug resistance in
mutant RAS-positive malignancies.
As there is a high degree of uncertainty with respect to the
exact contribution of RAS effectors to growth and survival of
leukemia, screening of targeted small-molecule inhibitors
can yield significant mechanistic and clinical insights. Seeing that only limited efficacy has been achieved with targeting downstream effectors of mutant RAS, such as MEK, we
used a chemical screen approach, using the LINCS chemical
library composed of highly selective kinase inhibitors, to
identify agents able to effectively enhance MEK inhibition
in mutant NRAS-expressing cells. LINCS library compounds
were anticipated to be useful, because of their limited
spectrum of kinase targets, to more easily identify kinase
mediators of RAS signaling that could be exploited for the
purpose of drug development. Consistent with what has
been reported in the literature, we identified through this
screen several inhibitors of mTOR and PI3K/AKT signaling,
which function downstream of RAS, as able to potentiate
the effects of the MEK inhibitor, AZD6244.
Clinical Cancer Research
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
IGF1R: A Novel Target for Mutant RAS-Positive Cancer
Importantly, however, we also identified the IGF1R/IR
inhibitor, GSK1904529A, as able to potentiate the effects of
AZD6244 against mutant RAS-expressing AML cells. While
it has been proposed that dual inhibition of IGF1R and IR
may result in greater therapeutic efficacy and overriding
resistance to anti- IGF1R therapies (30–32), this dual inhibition may also lead to clinical limitations resulting from
adverse effects/off-target toxicity. Importantly, potentiation
of AZD6244 by an IGF1R inhibitor, NVP-AEW541, which
shows 100-fold higher selectivity for IGF1R over IR, was also
observed in our studies. This suggests that synergy with an
MEK inhibitor can be achieved with either an IGF1R/IR
inhibitor or a more targeted IGF1R inhibitor.
Potential clinical relevance of our findings is supported
by the high degree of clinical investigation currently
underway, namely, the preclinical or clinical development of approximately 30 IGF1R targeting agents and
the close to 60 clinical trials evaluating such agents alone
or in combination with other inhibitors (reviewed in
ref. 33). The 2 primary approaches to inhibiting IGF1R
are through small-molecule inhibition or antibodies, and
at the present time, it is unclear which is likely to be more
effective in patients (reviewed in ref. 33). While early
clinical studies support the notion of IGF1R as being a
viable therapeutic target for certain cancers, variability in
patient responsiveness and toxicity associated with certain drug combinations warrant identification of predictive biomarkers to identify probable clinical responders
and highlight a need for rational development of novel
drug combination strategies focused on IGF1R-mediated
signaling inhibition in combination with other targeted
therapies. In response, we have identified mutant RASexpressing leukemia as a promising disease target for
therapy dependent on IGF1R inhibition coupled with
targeted inhibition of mutant RAS signaling.
Several studies have implicated a functional association
between RAS transformation and IGF1R. In an inducible
NRAS (Q61K)-driven genetically engineered mouse model of melanoma, 4 days of genetic extinction of NRAS
(Q61K) expression led to a substantial downregulation of
IGF1Rb expression, according to reverse-phase protein
array profiling (34). In addition, mouse embryo fibroblasts devoid of IGF1R cannot be transformed by Ha-RAS
(35, 36). In addition to demonstrating synergy between
selective IGF1R inhibition and targeted inhibition of
downstream RAS signaling pathways, we present here
the novel positive correlation between mutant RAS
expression and IGF1R protein expression in mutant
RAS-transformed hematopoietic cells. It is possible that
the increased IGF1R levels observed in mutant RASexpressing cells may be a hallmark prosurvival characteristic of RAS transformation that enables cells to thrive and
disease to progress.
The combination of IGF1R inhibitors with inhibitors of
RAS signaling, including BRAF or MEK, has been suggested
for breast cancer in response to reports of MEK inhibitor
induction of PI3K pathway signaling (37, 38), as well as
KRAS-mutant colorectal cancer (39) and lung cancer (40,
www.aacrjournals.org
41). Similarly, the combination of IGF1R inhibitors with
inhibitors of AKT or mTOR has been proposed for solid
tumors, including breast and prostate cancer, as a strategy to
override drug resistance due to negative feedback loops
associated with mTOR inhibition (42).
Previous reports have implicated IGF1R as a potentially
important target in AML due to high IGF1R expression
(30, 43, 44) and enhancement of AML cell survival and
proliferation by IGF1R signaling (45). Of relevance, targeted small-molecule inhibition of IGF1R, such as by
NVP-AEW541 or NVP-ADW742, or dual inhibition of
IGF1R/IR receptor, such as by BMS-536924, leads to
induction of apoptosis in AML cells (30, 42, 45, 46).
mTOR inhibition causes induction of PI3K/AKT signaling
through increased IGF1R signaling, and combined mTOR
and PI3K/AKT inhibition leads to additive antiproliferative effects in AML (47). Furthermore, antibody targeting
of IGF1R in combination with inhibitors of Raf/MEK/ERK
or PI3K/AKT/mTOR signaling has been shown to be
synergistic against hematopoietic cells engineered to
express IGF1R (48).
Our findings are consistent with these studies and demonstrate a correlation between mutant RAS protein expression and IGF1R protein expression in mutant RAS-expressing AML. The present study is also the first to highlight—in
mutant RAS-positive AML—the potential therapeutic benefit of dual suppression of IGF1R and RAS signaling. This
novel combination strategy warrants further investigation
as a therapeutic approach that could bypass some mechanisms of drug resistance associated with MEK inhibition and
that therefore may be of potential clinical benefit in mutant
RAS-driven leukemia.
Disclosure of Potential Conflicts of Interest
J.D. Griffin reports receiving a commercial research grant from Novartis.
No potential conflicts of interest were disclosed by the other authors.
Authors' Contributions
Conception and design: E. Weisberg, A. Nonami, Z. Chen, M. Sattler,
C. Mitsiades, Q. Liu, N.S. Gray, J.D. Griffin
Development of methodology: E. Weisberg, A. Nonami, E. Nelson,
J. Zhang, K.-K. Wong
Acquisition of data (provided animals, acquired and managed patients,
provided facilities, etc.): E. Weisberg, A. Nonami, Z. Chen, Y. Chen,
H. Cho, J. Zhang
Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): E. Weisberg, A. Nonami, Z. Chen,
Y. Chen, F. Liu, J. Zhang, M. Sattler, C. Mitsiades, J.D. Griffin
Writing, review, and/or revision of the manuscript: E. Weisberg,
A. Nonami, M. Sattler, C. Mitsiades, K.-K. Wong, Q. Liu, N.S. Gray
Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): E. Weisberg, K.-K. Wong
Study supervision: E. Weisberg, Q. Liu, J.D. Griffin
Grant Support
N.S. Gray is supported by NIH LINCS grant HG006097.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate
this fact.
Received April 11, 2014; revised August 1, 2014; accepted August 6, 2014;
published OnlineFirst September 3, 2014.
Clin Cancer Res; 20(21) November 1, 2014
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
OF11
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
Weisberg et al.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
OF12
Ward AF, Braun BS, Shannon KM. Targeting oncogenic RAS signaling
in hematologic malignancies. Blood 2012;120:3397–406.
Tyner JW, Erickson H, Deininger MWV, Willis SG, Eide CA, Levine RL,
et al. High-throughput sequencing screen reveals novel, transforming
RAS mutations in myeloid leukemia patients. Blood 2009;113:
1749–55.
MacKenzie KL, Dobnikov A, Millington M, Shounan Y, Symonds G.
Mutant N-ras induces myeloproliferative disorders and apoptosis in
bone marrow repopulated mice. Blood 1999;93:2043–56.
Parikh C, Subrabmanyam R, Ren R. Oncogenic NRAS rapidly and
efficiently induces CMML- and AML-like diseases in mice. Blood
2006;108:2349–57.
Parikh C, Subrahmanyam R, Ren R. Oncogenic NRAS, KRAS, and
HRAS exhibit different leukemogenic potentials in mice. Cancer Res
2007;67:7139–46.
Baines AT, Xu D, Der CJ. Inhibition of RAS for cancer treatment: the
search continues. Future Med Chem 2011;3:1787–808.
Ostrem JM, Peters U, Sos ML, Wells JA, Shokat KM. K-RAS (G12C)
inhibitors allosterically control GTP affinity and effector interactions.
Nature 2013;503:548–51.
Lim SM, Westover KD, Ficarro SB, Harrison RA, Choi HG, Pacold ME,
et al. Therapeutic targeting of oncogenic K-RAS by a covalent catalytic
site inhibitor. Angew Chem Int Ed Engl 2014;53:199–204.
Karp JE, Lancet JE, Kaufmann SH, End DW, Wright JJ, Bol K, et al.
Clinical and biologic activity of the farnesyltransferase inhibitor
R115777 in adults with refractory and relapsed acute leukemias: a
phase I clinical-laboratory correlative trial. Blood 2001;97:3361–9.
Downward J. Targeting RAS signaling pathways in cancer therapy. Nat
Rev Cancer 2003;3:11–22.
Lauchle JO, Kim D, Le DT, Akagi K, Crone M, Krisman K, et al.
Response and resistance to MEK inhibition in leukemias initiated by
hyperactive RAS. Nature 2009;461:411–4.
Solit DB, Garraway LA, Pratilas CA, Sawai A, Getz G, Basso A, et al.
BRAF mutation predicts sensitivity to MEK inhibition. Nature
2006;439:358–62.
Yeh TC, Marsh V, Bernat BA, Ballard J, Colwell H, Evans RJ, et al.
Biological characterization of ARRY-142886 (AZD6244), a potent,
highly selective mitogen-activated protein kinase kinase 1/2 inhibitor.
Clin Cancer Res 2007;13:1576–83.
Jain N, Curran E, Lyengar NM, Diaz-Flores E, Kunnavakkam R, Popplewell L, et al. Phase II study of the oral MEK inhibitor selumetinib in
advanced acute myelogenous leukemia: a University of Chicago
Phase II Consortium Trial. Clin Cancer Res 2014;20:490–8.
Sabbatini P, Rowand JL, Groy A, Korenchuk S, Liu Q, Atkins C, et al.
Antitumor activity of GSK1904529A, a small-molecule inhibitor of the
insulin-like growth factor-1 receptor tyrosine kinase. Clin Cancer Res
2009;15:3058–67.
Matsuo Y, MacLeod RA, Uphoff CC, Drexler HG, Nishizaki C,
Katayama Y, et al. Two acute monocytic leukemia (AML-M5a) cell
lines (MOLM13 and MOLM14) with interclonal phenotypic heterogeneity showing MLL-AF9 fusion resulting from an occult chromosome
insertion, ins(11;9)(q23;p22p23). Leukemia 1997;11:1469–77.
Kimbrel EA, Davis TN, Bradner JE, Kung AL. In vivo pharmacodynamic
imaging of proteosome inhibition. Mol Imaging 2009;8:140–7.
Kelly LM, Liu Q, Kutok JL, Williams IR, Boulton CL, Gilliland DG. FLT3
internal tandem duplication mutations associated with human acute
myeloid leukemias induce myeloproliferative disease in a murine bone
marrow transplant model. Blood 2002;99:310–8.
Daley GQ, Baltimore D. Transformation of an interleukin 3-dependent
hematopoietic cell line by the chronic myeloid leukemia-specific p210
BCR-ABL protein. Proc Natl Acad Sci U S A 1988;85:9312–6.
Okuda K, Golub TR, Gilliland DG, Griffin JD. p210BCR-ABL, p190BCRABL, and TEL/ABL activate similar signal transduction pathways in
hematopoietic cell lines. Oncogene 1996;13:1147–52.
Sattler M, Salgia R, Okuda K, Uemura N, Durstin MA, Pisick E, et al. The
proto-oncogene product p120CBL and the adaptor proteins CRKL
and c-CRK link c-ABL, p190BCR-ABL and p210BCR-ABL to the
phosphatidylinositol-30 kinase pathway. Oncogene 1996;12:839–46.
Clin Cancer Res; 20(21) November 1, 2014
22. Weisberg E, Manley PW, Breitenstein W, Bruggen J, Cown-Jacob SW,
Ray A, et al. Characterization of AMN107, a selective inhibitor of native
and mutant Bcr-Abl. Cancer Cell 2005;7:129–41.
23. Chou TC, Talalay P. Quantitative analysis of dose-effect relationships:
the combined effects of multiple drugs or enzyme inhibitors. Adv
Enzyme Regul 1984;22:27–55.
24. Davies BD, Logie A, McKay JS, Martin P, Steele S, Jenkins R, et al.
AZD6244 (ARRY 142886) a potent inhibitor of mitogen-activated
protein kinase/extracellular signal-related kinase kinase 1/2 kinases:
mechanism of action in vivo, pharmacokinetic/pharmacodynamic
relationship and potential for combination in preclinical models. Mol
Cancer Ther 2007;6:2209–19.
25. Soon L, Flechner L, Gutkind JS, Wang L-H, Baserga R, Pierce JH.
Insulin-like growth factor 1 synergizes with interleukin 4 for hematopoietic cell proliferation independent of insulin receptor substrate
expression. Mol Cell Biol 1999;19:3816–28.
26. Shelton JG, Steelman LS, White ER, McCubrey JA. Synergy between
PI3K/Akt and Raf/MEK/ERK pathways in IGF1R mediated cell cycle
progression and prevention of apoptosis in hematopoietic cells. Cell
Cycle 2004;3:372–9.
27. Yaguchi S, Fukui Y, Koshimizu I, Yoshimi H, Matsuno T, Gouda H, et al.
Antitumor activity of ZSTK474, a new phosphatidylinositol 3-kinase
inhibitor. J Natl Cancer Inst 2006;98:545–56.
28. Bowen DT, Frew ME, Hills R, Gale RE, Wheatley K, Groves MJ, et al.
RAS mutation in acute myeloid leukemia is associated with distinct
cytogenetic subgroups but does not influence outcome in patients
younger than 60 years. Blood 2005;106:2113–9.
29. Bacher U, Hafterlach T, Schoch C, Kern W, Schnittger S. Implications
of NRAS mutations in AML: a study of 2502 patients. Blood
2006;107:3847–53.
30. Wahner Hendrickson AE, Haluska P, Schneider PA, Loegering DA,
Peterson KL, Attar R, et al. Expression of insulin receptor isoform A and
insulin-like growth factor-1 receptor in human acute myelogenous
leukemia: effect of the dual-receptor inhibitor BMS-536924 in vitro.
Cancer Res 2009;69:7635–43.
31. Chapuis N, Lacombe C, Tamburini J, Bouscary D, Mayeux P. Insulin
receptor A and IGF-1R in AML- Letter. Cancer Res 2010;70:7010.
32. Ulanet DB, Ludwig DL, Kahn CR, Hanahan D. Insulin receptor functionally enhances multistage tumor progression and conveys intrinsic
resistance to IGF-1R targeted therapy. Proc Natl Acad Sci U S A
2010;107:10791–8.
33. Zha J, Lackner MR. Targeting the insulin-like growth factor receptor1R pathway for cancer therapy. Clin Cancer Res 2010;16:2512–7.
34. Kwong LN, Costello JC, Liu H, Jiang S, Helms TL, Langsdorf AE, et al.
Oncogenic NRAS signaling differentially regulates survival and proliferation in melanoma. Nat Med 2012;18:1503–10.
35. Gatzka M, Prisco M, Baserga R. Stabilization of the RAS oncoprotein
by the insulin-like growth factor 1 receptor during anchorage-independent growth. Cancer Res 2000;60:4222–30.
36. Chang TY, Tsai WJ, Chou CK, Chow NH, Leu TH, Liu HS. Identifying
the factors and signal pathways necessary for anchorage-independent growth of Ha-ras oncogene-transformed NIH/3T3 cells. Life Sci
2003;73:1265–74.
37. Hoeflich KP, O'Brien C, Boyd Z, Cavet G, Guerrero S, Jung K, et al. In
vivo antitumor activity of MEK and phosphatidylinositol 3-kinase
inhibitors in basal-like breast cancer models. Clin Cancer Res
2009;15:4649–64.
38. Mirzoeva OK, Das D, Heiser LM, Bhattacharya S, Siwak D, Gendelman
R, et al. Basal subtype and MAPK/ERK kinase (MEK)-phosphoinositide
3-kinase feedback signaling determine susceptibility of breast cancer
cells to MEK inhibition. Cancer Res 2009;69:565–72.
39. Ebi H, Corcoran RB, Singh A, Chen Z, Song Y, Lifshits E, et al. Receptor
tyrosine kinases exert dominant control over PI3K signaling in human
KRAS mutant colorectal cancers. J Clin Invest 2011;121:4311–21.
40. Engelman JA, Chen L, Tan X, Crosby K, Guimaraes AR, Upadhyay R,
et al. Effective use of PI3K and MEK inhibitors to treat mutant KRAS
G12D and PIK3CA H1047 murine lung cancers. Nat Med 2008;14:
1351–6.
Clinical Cancer Research
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
Published OnlineFirst September 3, 2014; DOI: 10.1158/1078-0432.CCR-14-0902
IGF1R: A Novel Target for Mutant RAS-Positive Cancer
41. Molina-Arcas M, Hancock DC, Sheridan C, Kumar MS, Downward J.
Coordinate direct input of both KRAS and IGF1 receptor to activation of
PI3 kinase in KRAS-mutant lung cancer. Cancer Discov 2013;3:548–63.
42. O'Reilly KE, Rojo F, She QB, Solit D, Mills GB, Smith D, et al. mTOR
inhibition induces upstream receptor tyrosine kinase signaling and
activates AKT. Cancer Res 2006;66:1500–8.
43. He Y, Zhang J, Zheng J, Du W, Xiao H, Liu W, et al. The insulin-like
growth factor-1 receptor kinase inhibitor, NVP-AD2742, suppresses
survival and resistance to chemotherapy in acute myeloid leukemia
cells. Oncol Res 2010;19:35–43.
44. Qi H, Xiao L, Lingyun W, Ying T, Yi-Zhi L, Shao-Xu Y, et al. Expression of
type 1 insulin-like growth factor receptor in marrow nucleated cells in
malignant hematological disorders: correlation with apoptosis. Ann
Hematol 2006;85:95–101.
45. Doepfner KT, Spertini O, Arcaro A. Autocrine insulin-like growth factor1 signaling promotes growth and survival of human acute myeloid
www.aacrjournals.org
leukemia cells via the phosphoinositide 3-kinase/AKT pathway.
Leukemia 2007;21:1921–30.
46. Tazzari PL, Tabellini G, Bortul R, Papa V, Evangelisti C, Grafone T, et al.
The insulin-like growth factor-1 receptor kinase inhibitor NVP-AEW541
induces apoptosis in acute myeloid leukemia cells exhibiting autocrine
insulin-like growth factor-1 secretion. Leukemia 2007;21:886–96.
47. Tamburini J, Chapuis N, Bardet V, Park S, Sujobert P, Willems L, et al.
Mammalian target of rapamycin (mTOR) inhibition activates phosphatidylinositol 3-kinase/AKT by up-regulating insulin-like growth factor-1
receptor signaling in acute myeloid leukemia: rationale for therapeutic
inhibition of both pathways. Blood 2008;111:379–82.
48. Bertrand FE, Steelman LS, Chappell WH, Abrams SL, Shelton JG,
White ER, et al. Synergy between an IGF-1R antibody and Raf/MEK/
ERK and PI3K/Akt/mTOR pathway inhibitors in suppressing IGF1R-mediated growth in hematopoietic cells. Leukemia 2006;20:
1254–60.
Clin Cancer Res; 20(21) November 1, 2014
Downloaded from clincancerres.aacrjournals.org on October 28, 2014. © 2014 American Association for
Cancer Research.
OF13