Download Transcription Translation Webquest

Name:________________________________________________ Date:______________ Period:______
Transcription and Translation Webquest
Section 1: http://www.mhhe.com/socscience/anthropology/fuentes_lab/03_1/fuentes_3_1.html
1. Write the correct term for each definition.
________________________ a. a string of amino acids that serves as the basis for a protein
________________________ b. molecules that contains an anticodon and carries an amino acid
________________________ c. cell structure in which codon and anticodon match up to assemble a protein
________________________ d. barrier between cell nucleus and cytoplasm
________________________ e. three nucleotide sequence that is the complement of the codon
________________________ f. cell structure that contains genetic material
________________________ g. complex molecule that carries the genetic information
________________________ h. complex molecules that serves as the building block for organic structures
________________________ i. cellular material outside of the nucleus
________________________ j. DNA triplet transcribed onto mRNA
________________________ k. substance that carries genetic code
________________________ l. chemical substance that make up the “rungs” of the DNA molecule’s “ladder”
________________________ m. the type of RNA that receives a code from DNA
Section 2: http://www.glencoe.com/sites/common_assets/science/virtual_labs/LS04/LS04.html
1. Describe the differences between DNA and RNA.
2. What is the function of the mRNA molecule and the tRNA molecule?
Section 3: http://learn.genetics.utah.edu/content/basics/transcribe/
1. DNA Strand:
ATTACGATCTGCACAAGATCCT
2. mRNA Strand:
3. Amino Acid Chain:
4. What is the start codon?
5. What are the stop codons?
Section 4: Review Questions:
1. Where does transcription happened? What is produced?
2. Where does translation happen? What is produced?