Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
MOLECULAR BIOLOGY Human Genome Project Mark P. Sawicki, MD, Ghassan Samara, MD, Michael Hurwitz, MD, Edward Passaro, Jr., MD, LosAngeles,California The Human Genome Project is an international effort to clone and sequence the entire human genome. This audacious undertaking, estimated to cost 2 0 0 million dollars per year and require 15 Years to complete, promises to be one of the most revolutionary and captivating scientific endeavors ever conceived by mankind. By knowing the sequence of the estimated 3 billion base pairs of the haploid human genome and its more than 3 0 , 0 0 0 genes, many questions will be answered. Moreover, our ability to intervene at the genetic level will be possible. This review outlines the scientific goals and methods of this project and discusses some of its ethical, legal, and social ramifications. From the Department of Surgery, UCLA School of Medicine; Surgical Service, Veterans Administration Medical Center West Los Angeles (MPS, GS, EP), and the Department of Surgery, Harbor-UCLA Medical Center (MH), Los Angeles, California. Requests for reprints should be addressed to Mark P. Sawicki, MD, Surgical Service (W112), Veterans Administration Medical Center West Los Angeles, Wilshire and Sawtelle Boulevards, Los Angeles, California 90073. Manuscript submitted July 28, 1992, and accepted in revised form September 23 , 1992. 258 nce the prenatal diagnosis of cystic fibrosis is O made, the family is offered carrier screening and counseling, with the option of terminating the pregnancy. Carrying the fetus to term is not unrealistic. Improved management of airway secretions with human recombinant DNaseI and the potential for the development of gene therapy in the foreseeable future offer a more optimistic outlook for patients with cystic fibrosis. INTRODUCTION When Watson and Crick published their analysis of the DNA double helix in 1953, they set in motion a revolution in biology that has now culminated in one of the most audacious undertakings of mankind: the Human Genome Project. The principal goal of this project is to Sequence the entire human genome. We must first ask ourselves why we should engage in such an endeavor and what it will take to complete it. These questions have plagued leading DNA researchers since the Project's inception. We have only to consider the wide range of important questions that can be answered by knowing the identity of all of the estimated 30,000 to 100,000 genes in the human genome to begin to fathom the significance of this enterprise. Even though the project is within our grasp and there are sufficient scientific reasons to proceed, does that still mean we should follow through and complete it? Some have staunchly protested and argued that we are heading toward an age of eugenics. Others have argued that the estimated 200 million dollars per year could be better spent on other scientific and social agendas. By and large, however, public perception is changing, and with strong legislative support, the momentum is in favor of completing the Project's goals. We are now faced with the challenge of deliberately proceeding with the arduous task of sequencing the genome with the caveat that there will be a forum to deal with the social, ethical, and legal issues that will undoubtedly continue to arise as we carry on. CLINICAL RELEVANCE The implications of this project are staggering: approximately 3 • 109 nucleotides will be sequenced, and more than 30,000 genes will be identified. Although it has chiefly captured the enthusiasm of molecular biologists and geneticists, the Human Genome Project will impact upon all areas of clinical medicine and fields of biology. Immediately apparent is its use as an aid in the diagnosis of genetic diseases. It will also provide the tools necessary for gene therapy including new technologies as well as identification of disease genes. These diseases include not only those that are thought to be monogenetic, such as malignant hypertherrnia, but also those that are multifactorial, such as atherosclerosis. No doubtour understanding of carcinogenesis will be vastly improved. Even more THE AMERICAN JOURNAL OF SURGERY VOLUME 165 FEBRUARY 1993 HUMAN GENOME PROJECT exciting is the potential to affect the prognosis of patients with these diseases through gene therapy. Furthermore, we can begin to dissect the function of the genome and gain an understanding of its evolution by comparing the genomes of model organisms with the human genome. These achievements alone justify the expense and time commitment of the Human Genome Project. With the development of new technologies and knowledge of the human genome, our ability to detect the more than 4,000 known genetic diseases will escalate. It is estimated that the overall population frequency of monogenie disorders is 10 per 1,000 livebirths. Currently, prenatal diagnosis and carrier detection for monogenic diseases, including cystic fibrosis, Duchenne's muscular dystrophy, and hemoglobinopathies, are possible with the existing DNA technologies. A number of these diseases, such as familial malignant hyperthermia (MH), although uncommon, may be important for the practicing surgeon. Considering the potentially catastrophic consequences of MH, it is likely that routine or selective preoperative screening will be instituted. Genetic testing for multifactorial diseases such as atherosclerosis may also be important for the surgeon. For example, some patients with abdominal aortic aneurysms may be genetically predisposed to rapid progression or early rupture. Such patients, who may be identified through DNA testing, may require earlier operation. By far the most important immediate application of these technologies for the surgeon will be the development of more reliable cancer screening and prognostic DNA markers. Already some advances have been made in prognostic markers. For example, amplification of the proto-oncogene her-2-neu (erbB-2) in breast cancer is associated with a worse prognosis. It remains to be seen how these data will affect the way such patients are treated. However, one important application may be in stratification of patients with node-negative tumors into high- and low-risk populations based upon the presence or absence of amplification. High-risk patients may require additional surgery or adjuvant therapy. Cancer screening will also become more sophisticated. For example, we currently perform testing for occult blood and endoscopy to identify patients with colon cancer. Recently, it has been demonstrated that feces may be analyzed using the polymerase chain reaction to identify mutations within cells shed from a colon tumor. It is not inconceivable that such testing may be done with over-the-counter products similar to home pregnancy tests. With earlier diagnosis, more patients may be cured with less extensive surgery. These goals, which are both readily apparent and reasonable to attain, do not really stretch our imagination. The far-reaching ideas are more exciting. The current situation is comparable to Galileo conceiving a trip to the moon. What may seem impossible now may be commonplace in the future. It is very likely that our ability to manipulate DNA will steadily increase such that manipulation of the human genome will not only be technicaUy feasible, but there will be a demand to do just that. Treatment of genetic diseases and tumors with gene therapy will be common. Creation of life de novo in the test TABLE I Genome Size Organism Total Size Human genome Fruit fly genome Nematode genome Yeast genome Escherichia coil genome 3,000,000,000 bp t 60,000,000 bp 100,000,000 bp 15,000,000 bp 5,000,000 bp tube, although it may seem outrageous now, will probably become one of the main areas of focus. It is these latter points that both excite and frighten us. After the Holocaust, there has been heightened sensitivity to any notion that approaches eugenics. Although eugenics is not the goal of the Human Genome Project, at times we cannot help but fear the unknown. Similarly, it is not inconceivable that a person's genetic predisposition to all types of monogenic and multifactorial disease can be determined with a single blood sample. If such information were available, how would we deal with it? Current practices of prenatal care include options for abortion based upon the condition of the fetus. Armed with genomic information, exactly how far might this be carried? Furthermore, what effect might this information have on the availability and cost of health insurance? Certainly "pre-existing" medical illness can increase the cost of a person's insurance. With the precise information that can be obtained by knowing a person's risk for diseases such as atherosclerosis, cancer, and diabetes, it is possible that one's health care cost may be significantly affected. For these reasons and other related issues, considerable emphasis will be placed upon discussion of the ethical, social, and legal issues of the Human Genome Project. COMPLEXITY OF THE HUMAN GENOME PROJECT The ultimate goal of the project is to determine the complete nucleotide sequence of the human genome. Although this is the primary goal, the agenda is actually much broader in scope and includes sequencing the genomes of several model organisms (Table I). At first glance, the reasons for sequencing these other genomes may not be apparent. There are, however, very cogent arguments to do parallel studies of these model organisms. First, it is likely that the study of these model organisms will provide the necessary technologic advances needed to efficiently sequence the much larger human genome. Second, the model organisms provide an experimental advantage that cannot and should not be pursued in humans. Third, by studying all of these organisms, we can better understand the function of DNA and its evolution. Perhaps it is not too surprising that, in the course of cloning and characterizing more than 1,800 human genes to date, many of these genes were found to have been conserved in other distantly related organisms such as yeast. Thus, if these genomes are studied in parallel, we can gain tremendous insight into the detailed func- THE AMERICAN JOURNAL OF SURGERY VOLUME 165 FEBRUARY 1993 259 SAWICKI ET AL T A B L E II Cloning Vectors Vector Cloning Capacity Yeast artificial chromosome (YAC) Cosmid Bacteriophage Plasmid 1,000,000 bp 40,000 bp 25,000 bp 10,000 bp tion of these genes as well as insight into their evolution from single-celled organisms. The relative sizes of these genomes vary significantly (Table I). Of the organisms to be studied, the human genome is the largest and most complex. Most human cells are diploid, containing 22 pairs of autosomal chromosomes and 2 sex chromosomes (XY or XX). The human genome consists of all of the chromosomal DNA located within the nucleus as well as the mitochondrial DNA. Human mitochondrial DNA is a closed circular duplex containing 16,569 bp, and the entire sequence has been determined. Several diseases have been attributed to mutations in these genes. The primary focus of the Human Genome Project, therefore, is to determine the sequence of all of the DNA contained within the chromosomes, only a fraction of which has been determined to date. It is estimated that there are approximately 3 • 109 nucleotide bases in the haploid human genome. Given its enormous size, the sequence of the haploid human genome cannot be readily determined within the proposed time frame of 15 years using existing techniques. Consequently, one of the goals of the project is to develop newer technologies for rapid automated cloning and sequencing of DNA. As a result, this is an international effort with a wide variety of scientific disciplines working together, including computer analysts, physicists, engineers, and molecular biologists, to accomplish this task. Moreover, industry has been encouraged to participate and is anticipated to play a significant role in the completion of the project. Once the DNA sequence is determined, it is still a formidable task to catalogue and analyze all of the data. Thus, another goal is to develop new areas of genome informatics. It is not inconceivable that many important predictions and hypotheses will not come directly from the laboratory bench, but rather from supercomputers sifting through the genome sequence. CLONING BASICS The first step toward mapping the human genome is to break down the DNA into fragments small enough to propagate and characterize. Practically, this is achieved by making a genomic library from human DNA. This type of library can be made by fragmenting large pieces of human DNA with a restriction enzyme and cloning these fragments randomly into a suitable vector. Theoretically, once a sufficiently large library is made, any given segment of genomic DNA should be present in one of the cloned fragments. 260 THE AMERICAN JOURNAL OF SURGERY Extraordinary technologic advances have been made in our ability to clone DNA for the construction of libraries, particularly in our ability to handle large fragments. A human genomic library can be constructed using any of the commonly used cloning vectors: plasmids, bacteriophages, cosmids, or yeast artificial chromosomes (YACs). The principal difference between these various vectors is the size of the D N A fragment that may be cloned into them (Table H). Ideally, it would be useful to work initially with large fragments (several hundred kilobases each) that can be cloned into YACs. However, because there are many technical problems in using these vectors, most of the cloning to date has used cosmids or a mixture of YACs and cosmids. Each cosmid clone, much smaller than the average YAC, contains approximately 40 kb of human DNA. Sequencing the human genome is divided into efforts to sequence each individual chromosome. Therefore, many of the genomic libraries are made from DNA isolated from single chromosomes, rather than from total genomic DNA. This is frequently accomplished by using flow cytometry to sort the chromosomes and then constructing a library from the enriched chromosomal DNA. After the genomic libraries are made from each chromosome, the fragments must be ordered by their original position on the chromosome. This is like putting together a large jigsaw puzzle. In general, this process is called mapping. There are several types including cytogenetic, physical, and genetic maps. It is likely that the final map for each chromosome will consist of a mixture of overlapping YAC, cosmid, and bacteriophage clones that span the entire length of the chromosome and represent its entire sequence. Initially, framework maps will be developed with closely spaced DNA markers for each chromosome, Subsequently, the gaps between these framework markers will be filled. The final goal will be to have DNA clones that when laid end-to-end stretch from one telomere to the other. These DNA clones may then be sequenced so that the DNA sequence is determined for the entire length of the chromosome. CHROMOSOME MAPS Chromosome maps indicate where a DNA sequence or probe lies relative to bands on the stained chromosome. When stained with specific dyes such as Giemsa (G banded) and examined under the microscope, each metaphase human chromosome has a specific band pattern that may be used to identify it. Figure 1 is a schematic representation of chromosome 11, which has been stained with the G-banded technique. DNA sequences may be mapped to a specific region of the chromosome by using fluorescent in situ hybridization (FISH). By labeling a DNA fragment such as a cosmid with a fluorescent dye and hybridizing it to metaphase chromosomes on a microscope slide and then looking at the chromosomes under a fluorescent microscope, it is possible to identify which chromosome the DNA fragment came from. Furthermore, it is possible to localize or map the sequence to the specific band. By using dyes with different colors, it is also possible to VOLUME 165 FEBRUARY 1993 HUMAN Figure 1. Various types of maps that are being used for the Human Genome Project and the approximateordar of organization. At the top of the diagram is a chromosome map. It is G-banded with distinctive alternating light and dark bends that can be seen under the microscope. Two DNA probes designated X and Y have been mapped by fluorescent in situ hybridization to the proximal long arm of the chromosome. They are separated from each other by approximately 11 cM on the linkage map. In addition, two other DNA probes, A and B, have been mapped between X and Y using linkage analysis. A restriction map reveals the location of various restriction sites between A and B (arrows). Overlapping yeast artificial chromosomas (YACs) and cosmids (contigs) that span a portion of the interval betwean A and B have been isolated using chromosome walking techniques. The physical distance of this region could be estimated by adding up the net length of the YACs. A partial DNA sequence from one of the cosmids is shown at the bottom. X ~ 4~ m 4- GENOMEPROJECT Y CHROMOSOME MAP LINKAGE MAP c ,~ iiii 4- 4. 4- 4- ,'---4 RESTRICTION MAP OVERLAPPING YACs OVERLAPPING COSMIDS DNA SEQUENCE TATAACTGCGTGGACTCGCCCTCTCACACACATGGTGTGTGTCTAATGCTATI'TCGA map more than one probe on a single chromosome and determine where one DNA sequence lies relative to another. Although very useful, the current resolution of this technique is low. The chromosome bands range in size from 1 to 5 Mb. Thus, it is possible to map DNA sequences that are, on the average, more than 1 Mb apart. More recently, techniques have been developed using interphase nuclei rather than metaphase spreads. This significantly increases the resolution of FISH to distinguish sequences that are separated by as little as 100,000 bp (0.1 Mb). PHYSICAL MAPS Although chromosome maps provide very useful information about the approximate location of a DNA sequence on a specific chromosome, the resolution is far from sufficient to assemble all of the DNA fragments from the chromosome-specific library. These large gaps can be bridged by completion of complex physical maps, which are based upon restriction mapping and overlapping DNA fragments called contigs. Basically, the physical map (Figure 1) is a guide to the distance between DNA sequences based upon the number of nucleotides that separate them. Sequences separated by distances as large as several hundred kilobases may be readily linked together. The general strategy is to identify relatively closely spaced (less than 1 Mb) sequences within a region of interest on the chromosome and then to identify other clones that fill the gaps. When first mapping a specific region, identifying clones that map to the region of interest is somewhat arbitrary. Efforts to date have focused on randomly isolating DNA sequences from a genomic library and mapping them to the chromosome using techniques such as FISH. For any given chromosome, hundreds to thousands of clones will need to be mapped by this approach. Once this is done, any given chromosomal band region will have many DNA clones mapped to it. Unfortunately, they will traverse a very large distance, at least a megabase, and their order will not be known. They must then be ordered, and the gaps between them must be filled with other clones using "chromosome walking" and other techniques. Only then may the sequence for the entire region be determined. Chromosome walking refers to the method of isolating neighboring overlapping clones to form a contig. For example, in isolating the cystic fibrosis gene, it was first discovered that the disease gene was located between known DNA sequences on 7q31 called "met" (an oncegene) and D7S8 (an anonymous DNA segment). It was estimated that the distance between these two markers was approximately 1.5 Mb. In searching for the cystic fibrosis gene, one of the techniques used to fill this large gap was chromosome walking. By using DNA sequences that map to this interval to screen a genomic library, neighboring overlapping clones were isolated. The overlapping but not identical clones represent a contiguous stretch of DNA. As mentioned previously, such arrays of clones are called contigs. Overlap between the newly iso- THE AMERICAN JOURNAL OF SURGERY VOLUME165 FEBRUARY1993 261 SAWICKI ET AL lated clones was confirmed by restriction mapping each of them. Restriction mapping is simply determining the location of restriction enzyme sites in a cloned piece of DNA. In this instance, if two cloned pieces of DNA have overlapping patterns of restriction maps, then they can be arranged into a contig. man genome, 3 X 109 bp, this is a formidable task. Recent automated technologies have been developed that allow a single laboratory with three automatic sequencers to sequence 100 kb/d. Even at this high rate, it would take 10 years to complete the sequencing. It is likely that even more powerful techniques will be developed for this work. LINKAGE MAPPING Linkage maps can be used to determine the location, relative order, and distance between DNA sequences on a chromosome (Figure 1). They are useful to map disease genes such as cystic fibrosis and are helpful as adjuncts to the development of physical maps. They are derived from studying the inheritance of polymorphic DNA sequences in large families. This concept is often difficult to grasp. Basically, these maps are based upon the concept of linked genes. When two genes are on different chromosomes and their inheritance is studied in a pedigree, the genes will segregate independent of each other (recombination fraction -- 0.50). This occurs since, during meiosis, the chromosomes are inherited independently. If, however, the two genes are located on the same chromosome, they will tend to be inherited together (recombination fraction less than 0.50). When this occurs, they are said to be linked. This is not always the case, however. Occasionally, there may be recombination between them during meiosis, and they may not be inherited together. Generally, the closer two genes are on the chromosome, the less likely they will undergo recombination. That is to say, tightly linked genes have a lower frequency of recombination. By determining the frequency of recombination between two genes, their proximity can be estimated. Thus, as an approximation, two genes with a high frequency of recombination between them are usually further apart than two genes with a low frequency of recombination. This may be intuitively obvious because the larger the distance between two genes on the same chromosome, the higher the chance that a crossover may occur between them during meiosis. On the linkage map, their separation is described in terms of recombination frequency (centimorgans [cM]), rather than nucleotides as with physical maps. One centimorgan is defined as the probability of I% that a recombination event will take place between two genes during a single meiosis. On average, 1 cM is approximately equivalent to 1 Mb of physical distance. It is important to realize that there is tremendous variation in recombination frequencies throughout the genome; this approximation may vary as much as fivefold. This is important because the data from the linkage maps cannot be readily translated into physical distances. On the other hand, if several genes in a specific chromosomal region are analyzed at one time, their relative order may be reliably determined. This is very useful when first trying to construct a physical map for a region. CONCLUSIONS Sequencing the human genome is one of the most audacious scientific enterprises ever conceived. Its impact on modern medicine staggers our imagination. New technologies will be developed that will affect every discipline. The knowledge gained will improve disease diagnosis and provide the tools necessary for the development of gene therapy. Undoubtedly, our ability to manipulate the human genome will progress and lead to new areas of genome research. With these advances, the Human Genome Project promises to capture and hold our imagination for generations to come. SEQUENCING As physical maps are developed and contigs of large genomic regions are completed, sequencing on a larger scale will begin. Considering the size of the haploid hu262 REFERENCES 1. Watson JD. The Human Genome Project: past, present, and future. Science 1990; 248: 44-9. 2. Green ED, WatersonRH. The Human GenomeProject: prospects and implicationsfor clinical medicine. JAMA 1991; 266: 1966-75. 3. Yager TD, Nickerson DA, Hood LE. The Human Genome Project:creatingan infrastructurefor biologyand medicine.Trends Biochem Sci 1991; 16: 454. GLOSSARY Allele: One member of a pair of genes for a given trait. Each member is of maternal or paternal origin. Amplify: To increase the quantity of a specific gene by a variety of techniques. Aneuploid: A cell containing extra chromosomes. B a n d : A pattern of light and dark regions by Giemsa staining that can serve as landmarks on chromosomes. Base pairing: The pairing of specific nitrogenous bases between complementary strands of DNA. For example, adenine is always paired with thymine and guanine with cytosine. eDNA (complementary DNA): Single- or doublestranded DNA made from an RNA template using the enzyme reverse transcriptase. Centimorgan (eM) : A measure of the statistical probability of recombination between alleles. One cM represents a 1% chance of recombination per meiotic event. Centromere: The constricted region of a chromosome separating the short and long arms from one another. Chromosome: A single, linear, highly condensed DNA molecule. Clone (noun): One of a collection of cells or vectors containing identical genetic material. C l o n e (verb): The act of duplicating genetic material within a vector. THE AMERICAN JOURNAL OF SURGERY VOLUME165 FEBRUARY1993 HUMANGENOMEPROJECT Codon: A group of three consecutive nucleotides within messenger RNA (mRNA) that encodes one of 20 amino acids or encodes a message to stop translation (see Translation). Cosmid: A vector that incorporates components of plasraids and phage to carry larger clones (up to 40 kilobases). Diploid: Cells containing copies of both the maternal and paternal chromosomes. DNA (deoxyribonucleic acid): The molecule responsible for storing and transmitting genetic information; composed of two strands of nucleotides twisted around each other in the shape of a double helix. Double helix: The twisted double-strand shape assumed by DNA. Exon: A contiguous segment of genomie DNA that is translated into polypeptide (see Intron). Familial: An inherited trait. Flow eytometry: Method used to measure nuclear DNA quantity in order to determine ploidy status. Gene: A segment of DNA within a chromosome encoding a single protein. Genome: The entire complement of genetic material in the form of DNA for a given organism. Genetic map: The ordering of genes by the statistical determination of recombination events between them. Genes separated by greater distances are more likely to recombine. Heterozygons: An individual containing dissimilar alleles for a given gene or locus. Homozygous: An individual containing identical alleles for a given gene or locus. Hybridization: The alignment of complementary strands of DNA (or RNA) via base pairing, widely used to identify portions of DNA on a Southern (or Northern) blot, using labeled probes. Intron: A noncoding sequence of DNA within the gene (see Exon). Karyotype: The physical appearance of the full complement of stained chromosomes for an individual. Locus: A site on a segment of DNA. Long arm (g) : One of the two prominent segments of a chromosome; the short or "p" arm is the other. The arms of a given chromosome join at its centromere. Library: A collection of recombinant genes cloned into a vector. Linkage: A measure of proximity between two alleles determined by recombination events. If they are not linked, they are on separate chromosomes; if loosely linked, they are distant to each other on the same chromosome. The closer they are to one another, the more tightly they are linked. mRNA (messenger RNA): The single-stranded edited copy of a gene ultimately translated into protein. Northern blot: The transfer of size-separated RNA fragments to a synthetic membrane for further studies. Nueleotide: One of the four building blocks of DNA (dATP, dGTP, dCTP, or dTTP) or RNA (ATP, CTP, GTP, or ATP) that are combined to form the nucleic acids. Oneogene: A cancer-inducing gene. Phage: A virus that infects a bacterial host, used in the laboratory as a cloning vector. Physical map: Analysis of the distance, in base pairs, between loci. Plasmid: Circularized DNA fragment, distinct from genomic DNA, found within bacteria, used as a cloning vector or to alter characteristics of the bacteria. Polymerase chain reaction (PCR): An efficient, simple, and rapid technique to multiply a length of DNA in a test tube. Promoter site: Region of a DNA molecule found in front of a gene that controls the expression of the gene. Proto-oncogene: Normal gene that may become an oncogene; also called cellular oncogene. Recombinant DNA: The combination of foreign DNA inserts with vector DNA (e.g., plasmid, phage, or cosmid) to produce a clone within a host. Recombination: The rearrangement of DNA by breaking and re-ligations of the DNA strands; also called crossovers. Replieon- A sequence in the DNA that initiates replication. Restriction mapping: The creation of a physical map by ordering enzymatically cut DNA fragments. Restriction endonuclease: Enzyme, isolated from bacteria, that recognizes specific base-pair sequences to cut DNA. The sites vary from frequent to rare cutting, depending upon the length of the restriction site. Restriction fragment length polymorphism (RFLP) : Variation in the distance between restriction enzyme cleavage sites that exist within a population producing unique DNA fingerprint patterns. RNA (ribonucleic acid): Single-strand nucleic acid found mainly in the nucleolus and ribosomes; contains ribose sugar and uracil, whereas DNA contains thymine. Short arm (p) : One of the two prominent segments of a chromosome; the long or "q" arm is the other. The arms of a given chromosome join at its centromere. Southern blot: The transfer of size-separated DNA fragments to a synthetic membrane for further studies, initially described by E.N. Southern. Sporadie: Not familial. Sticky ends: The cut pieces of a single strand of DNA, which, because of base pairing, can be made to rejoin again at complementary base pairs, using the enzyme DNA ligase. Telomere: The distal ends of the chromosome. Transcription: The copying of DNA into messenger RNA. Transduetion: The incorporation of a cellular gene in a viral genome that can then be introduced into other cells. Transfeetinn: The process of placing foreign DNA into mammalian cells. Transformation: The cancerous alteration of mammalian cells; also the act of putting foreign DNA into bacteria. THE AMERICANJOURNALOF SURGERY VOLUME165 FEBRUARY1993 263 SAWICKI ET AL Trm~slation: The process of converting the genetic code into polypeptides, mRNA codons are recognized by tRNA anti-codons. Each tRNA codes for a single amino acid. Tumor suppressor: A gene that prevents tumor formation until deleted or mutated. Vector: A construct used to propagate DNA in a host 264 THE AMERICAN JOURNAL OF SURGERY (bacteria, yeast, or cultured cells) (see Plasmid, Phage, and/or Yeast Artificial Chromosome). Virion: A replication virus particle. Western analysis: Protein electrophoresis characterizing size of unknown protein. Yeast artificial chromosome (YAC): A vector used in yeast that can propagate large fragments of DNA. VOLUME 165 FEBRUARY 1993