Download 1-s2.0-S0002961005805227-main

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
MOLECULAR BIOLOGY
Human Genome Project
Mark P. Sawicki, MD, Ghassan Samara, MD, Michael Hurwitz, MD, Edward Passaro, Jr., MD, LosAngeles,California
The Human Genome Project is an international effort to clone and sequence the entire human genome. This audacious undertaking, estimated to
cost 2 0 0 million dollars per year and require 15
Years to complete, promises to be one of the most
revolutionary and captivating scientific endeavors
ever conceived by mankind. By knowing the sequence of the estimated 3 billion base pairs of the
haploid human genome and its more than 3 0 , 0 0 0
genes, many questions will be answered. Moreover,
our ability to intervene at the genetic level will be
possible. This review outlines the scientific goals
and methods of this project and discusses some of
its ethical, legal, and social ramifications.
From the Department of Surgery, UCLA School of Medicine; Surgical
Service, Veterans Administration Medical Center West Los Angeles
(MPS, GS, EP), and the Department of Surgery, Harbor-UCLA Medical Center (MH), Los Angeles, California.
Requests for reprints should be addressed to Mark P. Sawicki, MD,
Surgical Service (W112), Veterans Administration Medical Center
West Los Angeles, Wilshire and Sawtelle Boulevards, Los Angeles,
California 90073.
Manuscript submitted July 28, 1992, and accepted in revised form
September 23 , 1992.
258
nce the prenatal diagnosis of cystic fibrosis is
O
made, the family is offered carrier screening and
counseling, with the option of terminating the pregnancy.
Carrying the fetus to term is not unrealistic. Improved
management of airway secretions with human recombinant DNaseI and the potential for the development of
gene therapy in the foreseeable future offer a more optimistic outlook for patients with cystic fibrosis.
INTRODUCTION
When Watson and Crick published their analysis of
the DNA double helix in 1953, they set in motion a
revolution in biology that has now culminated in one of
the most audacious undertakings of mankind: the Human
Genome Project. The principal goal of this project is to
Sequence the entire human genome. We must first ask
ourselves why we should engage in such an endeavor and
what it will take to complete it. These questions have
plagued leading DNA researchers since the Project's inception. We have only to consider the wide range of
important questions that can be answered by knowing the
identity of all of the estimated 30,000 to 100,000 genes in
the human genome to begin to fathom the significance of
this enterprise. Even though the project is within our
grasp and there are sufficient scientific reasons to proceed, does that still mean we should follow through and
complete it? Some have staunchly protested and argued
that we are heading toward an age of eugenics. Others
have argued that the estimated 200 million dollars per
year could be better spent on other scientific and social
agendas. By and large, however, public perception is
changing, and with strong legislative support, the momentum is in favor of completing the Project's goals. We
are now faced with the challenge of deliberately proceeding with the arduous task of sequencing the genome with
the caveat that there will be a forum to deal with the
social, ethical, and legal issues that will undoubtedly continue to arise as we carry on.
CLINICAL RELEVANCE
The implications of this project are staggering: approximately 3 • 109 nucleotides will be sequenced, and
more than 30,000 genes will be identified. Although it has
chiefly captured the enthusiasm of molecular biologists
and geneticists, the Human Genome Project will impact
upon all areas of clinical medicine and fields of biology.
Immediately apparent is its use as an aid in the diagnosis
of genetic diseases. It will also provide the tools necessary
for gene therapy including new technologies as well as
identification of disease genes. These diseases include not
only those that are thought to be monogenetic, such as
malignant hypertherrnia, but also those that are multifactorial, such as atherosclerosis. No doubtour understanding of carcinogenesis will be vastly improved. Even more
THE AMERICAN JOURNAL OF SURGERY VOLUME 165
FEBRUARY 1993
HUMAN GENOME PROJECT
exciting is the potential to affect the prognosis of patients
with these diseases through gene therapy. Furthermore,
we can begin to dissect the function of the genome and
gain an understanding of its evolution by comparing the
genomes of model organisms with the human genome.
These achievements alone justify the expense and time
commitment of the Human Genome Project.
With the development of new technologies and knowledge of the human genome, our ability to detect the more
than 4,000 known genetic diseases will escalate. It is
estimated that the overall population frequency of monogenie disorders is 10 per 1,000 livebirths. Currently, prenatal diagnosis and carrier detection for monogenic diseases, including cystic fibrosis, Duchenne's muscular
dystrophy, and hemoglobinopathies, are possible with the
existing DNA technologies. A number of these diseases,
such as familial malignant hyperthermia (MH), although uncommon, may be important for the practicing
surgeon. Considering the potentially catastrophic consequences of MH, it is likely that routine or selective preoperative screening will be instituted. Genetic testing for
multifactorial diseases such as atherosclerosis may also
be important for the surgeon. For example, some patients
with abdominal aortic aneurysms may be genetically predisposed to rapid progression or early rupture. Such patients, who may be identified through DNA testing, may
require earlier operation.
By far the most important immediate application of
these technologies for the surgeon will be the development of more reliable cancer screening and prognostic
DNA markers. Already some advances have been made
in prognostic markers. For example, amplification of the
proto-oncogene her-2-neu (erbB-2) in breast cancer is
associated with a worse prognosis. It remains to be seen
how these data will affect the way such patients are
treated. However, one important application may be in
stratification of patients with node-negative tumors into
high- and low-risk populations based upon the presence or
absence of amplification. High-risk patients may require
additional surgery or adjuvant therapy. Cancer screening
will also become more sophisticated. For example, we
currently perform testing for occult blood and endoscopy
to identify patients with colon cancer. Recently, it has
been demonstrated that feces may be analyzed using the
polymerase chain reaction to identify mutations within
cells shed from a colon tumor. It is not inconceivable that
such testing may be done with over-the-counter products
similar to home pregnancy tests. With earlier diagnosis,
more patients may be cured with less extensive surgery.
These goals, which are both readily apparent and
reasonable to attain, do not really stretch our imagination. The far-reaching ideas are more exciting. The current situation is comparable to Galileo conceiving a trip to
the moon. What may seem impossible now may be commonplace in the future. It is very likely that our ability to
manipulate DNA will steadily increase such that manipulation of the human genome will not only be technicaUy feasible, but there will be a demand to do just that.
Treatment of genetic diseases and tumors with gene therapy will be common. Creation of life de novo in the test
TABLE I
Genome Size
Organism
Total Size
Human genome
Fruit fly genome
Nematode genome
Yeast genome
Escherichia coil genome
3,000,000,000 bp
t 60,000,000 bp
100,000,000 bp
15,000,000 bp
5,000,000 bp
tube, although it may seem outrageous now, will probably
become one of the main areas of focus.
It is these latter points that both excite and frighten
us. After the Holocaust, there has been heightened sensitivity to any notion that approaches eugenics. Although
eugenics is not the goal of the Human Genome Project, at
times we cannot help but fear the unknown. Similarly, it
is not inconceivable that a person's genetic predisposition
to all types of monogenic and multifactorial disease can
be determined with a single blood sample. If such information were available, how would we deal with it? Current practices of prenatal care include options for abortion based upon the condition of the fetus. Armed with
genomic information, exactly how far might this be carried? Furthermore, what effect might this information
have on the availability and cost of health insurance?
Certainly "pre-existing" medical illness can increase the
cost of a person's insurance. With the precise information
that can be obtained by knowing a person's risk for diseases such as atherosclerosis, cancer, and diabetes, it is
possible that one's health care cost may be significantly
affected. For these reasons and other related issues, considerable emphasis will be placed upon discussion of the
ethical, social, and legal issues of the Human Genome
Project.
COMPLEXITY OF THE HUMAN GENOME
PROJECT
The ultimate goal of the project is to determine the
complete nucleotide sequence of the human genome. Although this is the primary goal, the agenda is actually
much broader in scope and includes sequencing the genomes of several model organisms (Table I). At first
glance, the reasons for sequencing these other genomes
may not be apparent. There are, however, very cogent
arguments to do parallel studies of these model organisms. First, it is likely that the study of these model
organisms will provide the necessary technologic advances needed to efficiently sequence the much larger
human genome. Second, the model organisms provide an
experimental advantage that cannot and should not be
pursued in humans. Third, by studying all of these organisms, we can better understand the function of DNA and
its evolution. Perhaps it is not too surprising that, in the
course of cloning and characterizing more than 1,800
human genes to date, many of these genes were found to
have been conserved in other distantly related organisms
such as yeast. Thus, if these genomes are studied in parallel, we can gain tremendous insight into the detailed func-
THE AMERICAN JOURNAL OF SURGERY
VOLUME 165
FEBRUARY 1993
259
SAWICKI ET AL
T A B L E II
Cloning Vectors
Vector
Cloning Capacity
Yeast artificial chromosome (YAC)
Cosmid
Bacteriophage
Plasmid
1,000,000 bp
40,000 bp
25,000 bp
10,000 bp
tion of these genes as well as insight into their evolution
from single-celled organisms.
The relative sizes of these genomes vary significantly
(Table I). Of the organisms to be studied, the human
genome is the largest and most complex. Most human
cells are diploid, containing 22 pairs of autosomal chromosomes and 2 sex chromosomes (XY or XX). The human genome consists of all of the chromosomal DNA
located within the nucleus as well as the mitochondrial
DNA. Human mitochondrial DNA is a closed circular
duplex containing 16,569 bp, and the entire sequence has
been determined. Several diseases have been attributed to
mutations in these genes. The primary focus of the Human Genome Project, therefore, is to determine the sequence of all of the DNA contained within the chromosomes, only a fraction of which has been determined to
date.
It is estimated that there are approximately 3 • 109
nucleotide bases in the haploid human genome. Given its
enormous size, the sequence of the haploid human genome cannot be readily determined within the proposed
time frame of 15 years using existing techniques. Consequently, one of the goals of the project is to develop newer
technologies for rapid automated cloning and sequencing
of DNA. As a result, this is an international effort with a
wide variety of scientific disciplines working together,
including computer analysts, physicists, engineers, and
molecular biologists, to accomplish this task. Moreover,
industry has been encouraged to participate and is anticipated to play a significant role in the completion of the
project. Once the DNA sequence is determined, it is still a
formidable task to catalogue and analyze all of the data.
Thus, another goal is to develop new areas of genome
informatics. It is not inconceivable that many important
predictions and hypotheses will not come directly from
the laboratory bench, but rather from supercomputers
sifting through the genome sequence.
CLONING BASICS
The first step toward mapping the human genome is
to break down the DNA into fragments small enough to
propagate and characterize. Practically, this is achieved
by making a genomic library from human DNA. This
type of library can be made by fragmenting large pieces
of human DNA with a restriction enzyme and cloning
these fragments randomly into a suitable vector. Theoretically, once a sufficiently large library is made, any given
segment of genomic DNA should be present in one of the
cloned fragments.
260
THE AMERICAN JOURNAL OF SURGERY
Extraordinary technologic advances have been made
in our ability to clone DNA for the construction of libraries, particularly in our ability to handle large fragments.
A human genomic library can be constructed using any of
the commonly used cloning vectors: plasmids, bacteriophages, cosmids, or yeast artificial chromosomes
(YACs). The principal difference between these various
vectors is the size of the D N A fragment that may be
cloned into them (Table H). Ideally, it would be useful to
work initially with large fragments (several hundred kilobases each) that can be cloned into YACs. However,
because there are many technical problems in using these
vectors, most of the cloning to date has used cosmids or a
mixture of YACs and cosmids. Each cosmid clone, much
smaller than the average YAC, contains approximately
40 kb of human DNA.
Sequencing the human genome is divided into efforts
to sequence each individual chromosome. Therefore,
many of the genomic libraries are made from DNA isolated from single chromosomes, rather than from total
genomic DNA. This is frequently accomplished by using
flow cytometry to sort the chromosomes and then constructing a library from the enriched chromosomal DNA.
After the genomic libraries are made from each chromosome, the fragments must be ordered by their original
position on the chromosome. This is like putting together
a large jigsaw puzzle. In general, this process is called
mapping. There are several types including cytogenetic,
physical, and genetic maps. It is likely that the final map
for each chromosome will consist of a mixture of overlapping YAC, cosmid, and bacteriophage clones that span
the entire length of the chromosome and represent its
entire sequence.
Initially, framework maps will be developed with
closely spaced DNA markers for each chromosome, Subsequently, the gaps between these framework markers
will be filled. The final goal will be to have DNA clones
that when laid end-to-end stretch from one telomere to
the other. These DNA clones may then be sequenced so
that the DNA sequence is determined for the entire
length of the chromosome.
CHROMOSOME MAPS
Chromosome maps indicate where a DNA sequence
or probe lies relative to bands on the stained chromosome.
When stained with specific dyes such as Giemsa (G banded) and examined under the microscope, each metaphase
human chromosome has a specific band pattern that may
be used to identify it. Figure 1 is a schematic representation of chromosome 11, which has been stained with the
G-banded technique. DNA sequences may be mapped to
a specific region of the chromosome by using fluorescent
in situ hybridization (FISH). By labeling a DNA fragment such as a cosmid with a fluorescent dye and hybridizing it to metaphase chromosomes on a microscope slide
and then looking at the chromosomes under a fluorescent
microscope, it is possible to identify which chromosome
the DNA fragment came from. Furthermore, it is possible to localize or map the sequence to the specific band.
By using dyes with different colors, it is also possible to
VOLUME 165
FEBRUARY 1993
HUMAN
Figure 1. Various types of maps that
are being used for the Human Genome Project and the approximateordar of organization. At the top of the
diagram is a chromosome map. It is
G-banded with distinctive alternating
light and dark bends that can be seen
under the microscope. Two DNA
probes designated X and Y have been
mapped by fluorescent in situ hybridization to the proximal long arm of the
chromosome. They are separated
from each other by approximately 11
cM on the linkage map. In addition,
two other DNA probes, A and B, have
been mapped between X and Y using
linkage analysis. A restriction map reveals the location of various restriction sites between A and B (arrows).
Overlapping yeast artificial chromosomas (YACs) and cosmids (contigs)
that span a portion of the interval betwean A and B have been isolated
using chromosome walking techniques. The physical distance of this
region could be estimated by adding
up the net length of the YACs. A partial DNA sequence from one of the
cosmids is shown at the bottom.
X
~
4~
m
4-
GENOMEPROJECT
Y
CHROMOSOME MAP
LINKAGE MAP
c
,~
iiii
4-
4.
4-
4-
,'---4
RESTRICTION MAP
OVERLAPPING
YACs
OVERLAPPING
COSMIDS
DNA SEQUENCE
TATAACTGCGTGGACTCGCCCTCTCACACACATGGTGTGTGTCTAATGCTATI'TCGA
map more than one probe on a single chromosome and
determine where one DNA sequence lies relative to another. Although very useful, the current resolution of this
technique is low. The chromosome bands range in size
from 1 to 5 Mb. Thus, it is possible to map DNA sequences that are, on the average, more than 1 Mb apart.
More recently, techniques have been developed using interphase nuclei rather than metaphase spreads. This significantly increases the resolution of FISH to distinguish
sequences that are separated by as little as 100,000 bp
(0.1 Mb).
PHYSICAL MAPS
Although chromosome maps provide very useful information about the approximate location of a DNA
sequence on a specific chromosome, the resolution is far
from sufficient to assemble all of the DNA fragments
from the chromosome-specific library. These large gaps
can be bridged by completion of complex physical maps,
which are based upon restriction mapping and overlapping DNA fragments called contigs. Basically, the physical map (Figure 1) is a guide to the distance between
DNA sequences based upon the number of nucleotides
that separate them. Sequences separated by distances as
large as several hundred kilobases may be readily linked
together. The general strategy is to identify relatively
closely spaced (less than 1 Mb) sequences within a region
of interest on the chromosome and then to identify other
clones that fill the gaps. When first mapping a specific
region, identifying clones that map to the region of interest is somewhat arbitrary. Efforts to date have focused on
randomly isolating DNA sequences from a genomic library and mapping them to the chromosome using techniques such as FISH. For any given chromosome, hundreds to thousands of clones will need to be mapped by
this approach. Once this is done, any given chromosomal
band region will have many DNA clones mapped to it.
Unfortunately, they will traverse a very large distance, at
least a megabase, and their order will not be known. They
must then be ordered, and the gaps between them must be
filled with other clones using "chromosome walking" and
other techniques. Only then may the sequence for the
entire region be determined.
Chromosome walking refers to the method of isolating neighboring overlapping clones to form a contig. For
example, in isolating the cystic fibrosis gene, it was first
discovered that the disease gene was located between
known DNA sequences on 7q31 called "met" (an oncegene) and D7S8 (an anonymous DNA segment). It was
estimated that the distance between these two markers
was approximately 1.5 Mb. In searching for the cystic
fibrosis gene, one of the techniques used to fill this large
gap was chromosome walking. By using DNA sequences
that map to this interval to screen a genomic library,
neighboring overlapping clones were isolated. The overlapping but not identical clones represent a contiguous
stretch of DNA. As mentioned previously, such arrays of
clones are called contigs. Overlap between the newly iso-
THE AMERICAN JOURNAL OF SURGERY VOLUME165 FEBRUARY1993 261
SAWICKI ET AL
lated clones was confirmed by restriction mapping each
of them. Restriction mapping is simply determining the
location of restriction enzyme sites in a cloned piece of
DNA. In this instance, if two cloned pieces of DNA have
overlapping patterns of restriction maps, then they can be
arranged into a contig.
man genome, 3 X 109 bp, this is a formidable task. Recent
automated technologies have been developed that allow a
single laboratory with three automatic sequencers to sequence 100 kb/d. Even at this high rate, it would take 10
years to complete the sequencing. It is likely that even
more powerful techniques will be developed for this work.
LINKAGE MAPPING
Linkage maps can be used to determine the location,
relative order, and distance between DNA sequences on a
chromosome (Figure 1). They are useful to map disease
genes such as cystic fibrosis and are helpful as adjuncts to
the development of physical maps. They are derived from
studying the inheritance of polymorphic DNA sequences
in large families. This concept is often difficult to grasp.
Basically, these maps are based upon the concept of
linked genes. When two genes are on different chromosomes and their inheritance is studied in a pedigree, the
genes will segregate independent of each other (recombination fraction -- 0.50). This occurs since, during meiosis,
the chromosomes are inherited independently. If, however, the two genes are located on the same chromosome,
they will tend to be inherited together (recombination
fraction less than 0.50). When this occurs, they are said to
be linked. This is not always the case, however. Occasionally, there may be recombination between them during
meiosis, and they may not be inherited together. Generally, the closer two genes are on the chromosome, the less
likely they will undergo recombination. That is to say,
tightly linked genes have a lower frequency of recombination.
By determining the frequency of recombination between two genes, their proximity can be estimated. Thus,
as an approximation, two genes with a high frequency of
recombination between them are usually further apart
than two genes with a low frequency of recombination.
This may be intuitively obvious because the larger the
distance between two genes on the same chromosome, the
higher the chance that a crossover may occur between
them during meiosis. On the linkage map, their separation is described in terms of recombination frequency
(centimorgans [cM]), rather than nucleotides as with
physical maps. One centimorgan is defined as the probability of I% that a recombination event will take place
between two genes during a single meiosis. On average, 1
cM is approximately equivalent to 1 Mb of physical distance. It is important to realize that there is tremendous
variation in recombination frequencies throughout the
genome; this approximation may vary as much as fivefold. This is important because the data from the linkage
maps cannot be readily translated into physical distances.
On the other hand, if several genes in a specific chromosomal region are analyzed at one time, their relative order
may be reliably determined. This is very useful when first
trying to construct a physical map for a region.
CONCLUSIONS
Sequencing the human genome is one of the most
audacious scientific enterprises ever conceived. Its impact
on modern medicine staggers our imagination. New technologies will be developed that will affect every discipline.
The knowledge gained will improve disease diagnosis and
provide the tools necessary for the development of gene
therapy. Undoubtedly, our ability to manipulate the human genome will progress and lead to new areas of genome research. With these advances, the Human Genome Project promises to capture and hold our
imagination for generations to come.
SEQUENCING
As physical maps are developed and contigs of large
genomic regions are completed, sequencing on a larger
scale will begin. Considering the size of the haploid hu262
REFERENCES
1. Watson JD. The Human Genome Project: past, present, and
future. Science 1990; 248: 44-9.
2. Green ED, WatersonRH. The Human GenomeProject: prospects and implicationsfor clinical medicine. JAMA 1991; 266:
1966-75.
3. Yager TD, Nickerson DA, Hood LE. The Human Genome
Project:creatingan infrastructurefor biologyand medicine.Trends
Biochem Sci 1991; 16: 454.
GLOSSARY
Allele: One member of a pair of genes for a given trait.
Each member is of maternal or paternal origin.
Amplify: To increase the quantity of a specific gene by a
variety of techniques.
Aneuploid: A cell containing extra chromosomes.
B a n d : A pattern of light and dark regions by Giemsa
staining that can serve as landmarks on chromosomes.
Base pairing: The pairing of specific nitrogenous bases
between complementary strands of DNA. For example, adenine is always paired with thymine and guanine with cytosine.
eDNA (complementary DNA): Single- or doublestranded DNA made from an RNA template using
the enzyme reverse transcriptase.
Centimorgan (eM) : A measure of the statistical probability of recombination between alleles. One cM represents a 1% chance of recombination per meiotic event.
Centromere: The constricted region of a chromosome
separating the short and long arms from one another.
Chromosome: A single, linear, highly condensed DNA
molecule.
Clone (noun): One of a collection of cells or vectors
containing identical genetic material.
C l o n e (verb): The act of duplicating genetic material
within a vector.
THE AMERICAN JOURNAL OF SURGERY VOLUME165 FEBRUARY1993
HUMANGENOMEPROJECT
Codon: A group of three consecutive nucleotides within
messenger RNA (mRNA) that encodes one of 20
amino acids or encodes a message to stop translation
(see Translation).
Cosmid: A vector that incorporates components of plasraids and phage to carry larger clones (up to 40 kilobases).
Diploid: Cells containing copies of both the maternal and
paternal chromosomes.
DNA (deoxyribonucleic acid): The molecule responsible for storing and transmitting genetic information;
composed of two strands of nucleotides twisted around
each other in the shape of a double helix.
Double helix: The twisted double-strand shape assumed
by DNA.
Exon: A contiguous segment of genomie DNA that is
translated into polypeptide (see Intron).
Familial: An inherited trait.
Flow eytometry: Method used to measure nuclear DNA
quantity in order to determine ploidy status.
Gene: A segment of DNA within a chromosome encoding a single protein.
Genome: The entire complement of genetic material in
the form of DNA for a given organism.
Genetic map: The ordering of genes by the statistical
determination of recombination events between them.
Genes separated by greater distances are more likely
to recombine.
Heterozygons: An individual containing dissimilar alleles for a given gene or locus.
Homozygous: An individual containing identical alleles
for a given gene or locus.
Hybridization: The alignment of complementary
strands of DNA (or RNA) via base pairing, widely
used to identify portions of DNA on a Southern (or
Northern) blot, using labeled probes.
Intron: A noncoding sequence of DNA within the gene
(see Exon).
Karyotype: The physical appearance of the full complement of stained chromosomes for an individual.
Locus: A site on a segment of DNA.
Long arm (g) : One of the two prominent segments of a
chromosome; the short or "p" arm is the other. The
arms of a given chromosome join at its centromere.
Library: A collection of recombinant genes cloned into a
vector.
Linkage: A measure of proximity between two alleles
determined by recombination events. If they are not
linked, they are on separate chromosomes; if loosely
linked, they are distant to each other on the same
chromosome. The closer they are to one another, the
more tightly they are linked.
mRNA (messenger RNA): The single-stranded edited
copy of a gene ultimately translated into protein.
Northern blot: The transfer of size-separated RNA fragments to a synthetic membrane for further studies.
Nueleotide: One of the four building blocks of DNA
(dATP, dGTP, dCTP, or dTTP) or RNA (ATP,
CTP, GTP, or ATP) that are combined to form the
nucleic acids.
Oneogene: A cancer-inducing gene.
Phage: A virus that infects a bacterial host, used in the
laboratory as a cloning vector.
Physical map: Analysis of the distance, in base pairs,
between loci.
Plasmid: Circularized DNA fragment, distinct from genomic DNA, found within bacteria, used as a cloning
vector or to alter characteristics of the bacteria.
Polymerase chain reaction (PCR): An efficient, simple, and rapid technique to multiply a length of DNA
in a test tube.
Promoter site: Region of a DNA molecule found in front
of a gene that controls the expression of the gene.
Proto-oncogene: Normal gene that may become an oncogene; also called cellular oncogene.
Recombinant DNA: The combination of foreign DNA
inserts with vector DNA (e.g., plasmid, phage, or cosmid) to produce a clone within a host.
Recombination: The rearrangement of DNA by breaking and re-ligations of the DNA strands; also called
crossovers.
Replieon- A sequence in the DNA that initiates replication.
Restriction mapping: The creation of a physical map by
ordering enzymatically cut DNA fragments.
Restriction endonuclease: Enzyme, isolated from bacteria, that recognizes specific base-pair sequences to
cut DNA. The sites vary from frequent to rare cutting,
depending upon the length of the restriction site.
Restriction fragment length polymorphism (RFLP) :
Variation in the distance between restriction enzyme
cleavage sites that exist within a population producing
unique DNA fingerprint patterns.
RNA (ribonucleic acid): Single-strand nucleic
acid found mainly in the nucleolus and ribosomes;
contains ribose sugar and uracil, whereas DNA contains thymine.
Short arm (p) : One of the two prominent segments of
a chromosome; the long or "q" arm is the other.
The arms of a given chromosome join at its centromere.
Southern blot: The transfer of size-separated DNA
fragments to a synthetic membrane for further studies, initially described by E.N. Southern.
Sporadie: Not familial.
Sticky ends: The cut pieces of a single strand of DNA,
which, because of base pairing, can be made to rejoin
again at complementary base pairs, using the enzyme
DNA ligase.
Telomere: The distal ends of the chromosome.
Transcription: The copying of DNA into messenger
RNA.
Transduetion: The incorporation of a cellular gene in a
viral genome that can then be introduced into other
cells.
Transfeetinn: The process of placing foreign DNA into
mammalian cells.
Transformation: The cancerous alteration of mammalian cells; also the act of putting foreign DNA into
bacteria.
THE AMERICANJOURNALOF SURGERY VOLUME165 FEBRUARY1993 263
SAWICKI ET AL
Trm~slation: The process of converting the genetic code
into polypeptides, mRNA codons are recognized by
tRNA anti-codons. Each tRNA codes for a single
amino acid.
Tumor suppressor: A gene that prevents tumor formation until deleted or mutated.
Vector: A construct used to propagate DNA in a host
264
THE AMERICAN JOURNAL OF SURGERY
(bacteria, yeast, or cultured cells) (see Plasmid,
Phage, and/or Yeast Artificial Chromosome).
Virion: A replication virus particle.
Western analysis: Protein electrophoresis characterizing
size of unknown protein.
Yeast artificial chromosome (YAC): A vector used in
yeast that can propagate large fragments of DNA.
VOLUME 165
FEBRUARY 1993