Download OCT4B1, a novel spliced variant of OCT4, is highly expressed in

IJC
International Journal of Cancer
OCT4B1, a novel spliced variant of OCT4, is highly expressed
in gastric cancer and acts as an antiapoptotic factor
Malek H. Asadi1, Seyed J. Mowla1, Fardin Fathi2, Ahmad Aleyasin3, Jamshid Asadzadeh1 and Yaser Atlasi1
1
Department of Molecular Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran
Center for Cellular and Molecular Research, Faculty of Medicine, Kurdistan University of Medical Sciences, Sanandaj, Iran
3
Department of Medical Genetics, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran
2
On the basis of the cancer stem cell (CSC) hypothesis, a subpopulation of cells within tumors is responsible for the sustained growth and propagation of tumors. CSCs are also
believed to be the main reason for the tumor relapse and resistance to therapy. These cells share various characteristics
with normal tissue-specific adult stem cells, including selfrenewal potential. Based on this hypothesis, CSCs are originating either from the dysregulated self-renewal control in
normal adult stem cells or through reprogramming of the somatic progenitor or differentiated cells within the tissue.1–5
The octamer-binding transcription factor 4 (OCT4, also
known as OCT3 and POU5F1) belongs to a family of transcription factors containing the POU DNA-binding domain.
The encoded protein acts as a master self-renewal regulator
in embryonic stem cells and plays a critical role in maintain-
Key words: OCT4B1, cancer stem cells, gastric adenocarcinoma,
apoptosis
Additional Supporting Information may be found in the online
version of this article.
Grant sponsor: Iranian stem cell network
DOI: 10.1002/ijc.25643
History: Received 27 Feb 2010; Accepted 10 Aug 2010; Online 7 Sep
2010
Correspondence to: Seyed J. Mowla, Department of Molecular
Genetics, Faculty of Biological Sciences, Tarbiat Modares University,
P.O. Box: 14115-154, Tehran, Iran, Tel.: þ98-21-82883464,
Fax: þ98-21-82884717, E-mail: [email protected]
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V
ing the pluripotent state of stem cells. OCT4 expression is
strongly repressed following stem cell differentiation.6–10 Several recent studies have demonstrated the unexpected expression of the OCT4 gene in some human cancer cell lines and
tissues,11–18 including gastric cancer.19
The human OCT4 gene can potentially encode three spliced
variants, designated as OCT4A, OCT4B and the newly discovered OCTB1.20,21 OCT4A is primarily localized within the
nucleus of the embryonic stem cells, where it sustains the selfrenewal and pluripotency properties of the cells. In contrast,
OCT4B is mainly located within the cytoplasm of somatic
cancer cell lines and apparently lacks any self-renewal regulatory role.21,22 In addition to its expression in somatic cells,
OCT4B1 is highly expressed in ES/EC cells and is rapidly
down-regulated upon induction of differentiation.20 Based on
our previous data on SSEA3(þ) stem cells, there is a potential
correlation between the expression of OCT4B1 and the
pluripotent/undifferentiated state of ES/EC/CS cells.20
While the expression of OCT4 has been detected in several cancer cell lines and tumors, little information exists
about the discriminative expression and function of OCT4
splice variants in stem/cancer cells. Indeed for the newly discovered variant of OCT4, OCT4B1, almost nothing is known
about its expression and function in cancer tissues and cell
lines. Thus, we investigated the potential expression of
OCT4B1 in a series of gastric cancer samples. We further
investigated the possibility of its biological role by knockingdown OCT4B1 expression within a gastric adenocarcinoma
cell line, AGS, using RNAi technology.
Cancer Genetics
The octamer-binding transcription factor 4 (OCT4) is involved in regulating pluripotency and self-renewal maintenance of
embryonic stem cells. Recently, misexpression of OCT4 has been also reported in some adult stem as well as cancer cells; a
finding which is still controversial. In addition to the previously described spliced variants of the gene (e.g., OCT4A and
OCT4B), we have recently identified a novel variant of the gene, designated as OCT4-B1. In this study, we investigated a
potential expression and function of OCT4B1 in a series of gastric cancer tissues and a gastric adenocarcinoma cell line, AGS.
Using the Taqman real-time PCR approach, we have detected the expression of OCT4B1 in tumors with no or much lower
expression in marginal samples of the same patients (p < 0.002). We have also analyzed the effects of OCT4B1 knock-down
in AGS cell line treated with specific siRNA directed toward OCT4B1. Our data revealed that interfering with the expression of
OCT4B1 caused profound changes in the morphology and cell cycle distribution of the cells. Furthermore, down-regulation of
OCT4B1 significantly elevated the relative activity of caspase-3/caspase-7 and the rate of apoptosis in the cells (more than
30%). All together, our findings suggest that OCT4B1 has a potential role in tumorigenesis of gastric cancer and candidates
the variant as a new tumor marker with potential value in diagnosis and treatment of gastric cancer.
2646
Material and Methods
OCT4B1, a novel spliced variant of OCT4
Table 1. Designed primers and prober for OCT4 variants and GAPDH
Clinical samples collection
Tumor and nontumor (apparently normal tissues from the
margin of same tumors, as control) surgical specimens from
36 patients with gastric adenocarcinoma were provided by
the Iran National Tumor Bank. The obtained samples had
been immediately snap-frozen in liquid nitrogen and had
been stored in 185 C until being used for RNA extraction.
A record of clinicopathological parameters, including grading
and staging, for each patient were received along with each
sample (Supporting Information Table 1). The experiment
design was approved by the Ethics Committee of Tarbiat
Modares University.
Gene
OCT4 A
variant
OCT4 B
variant
Cancer Genetics
RNA extraction and real-time PCR
Total RNA was isolated from the homogenized tissue specimens, using RNX plusTM solution (Cinnagen, Tehran, Iran)
according to the manufacturer’s instructions. Purity and integrity of the extracted RNA was measured by UV spectrophotometry (260/280-nm ratio) as well as visual observation
of samples on agarose gel electrophoresis. RNase-free DNase
(Fermentase, Lithuania) treatment of total RNA was performed according to the manufacturer’s instructions. The first
strand of cDNA was synthesized at 42 C for 60 min in the
presence of 1 lg RNA, 200 U/ll MMLV reverse transcriptase
(Fermentase, Lithuania), 20U RNase inhibitor, dNTP mix
(final concentration of 1 mM) with oligo(dT) 18 priming in
a 20 ll reaction.
Specific primers and probes were designed for OCT4A,
OCT4B, OCT4B1 and GAPDH (GenBank accession numbers:
NM_002701, NM_203289, EU518650 and NM-002046,
respectively) using AlleleID 4.0 and Gene Runner software
(Table 1).
Real-time PCR reactions were performed using Taqman
method with premix Ex TaqTM (Takara) on an ABI 7500
real-time quantitative PCR system. PCR reaction mixture
(12.5 ll premix Ex TaqTM, 0.2 lM forward primer, 0.2lM
reverse primer, 0.1lM TaqMan probe, 0.5 ll ROX reference
dye II, 2 ll template and 8 ll dH2O) was prepared and PCR
was performed with the following cycling conditions: initiation at 94 C for 30 seconds, amplification for 45 cycles with
denaturation at 94 C for 5 seconds, annealing and extending
Amplican
length
F
CGCAAGCCCTCATTTCAC
111
R
CATCACCTCCACCACCTG
P
CTTCGGATTTCGCCTTCTCGCCC
F
CAGGGAATGGGTGAATGAC
R
AGGCAGAAGACTTGTAAGAAC
P
AGTTAGGTGGGCAGCTTGGAAGGCA
OCT4 B1 F
variant
GGGTTCTATTTGGTGGGTTCC
R
TCCCTCTCCCTACTCCTCTTCA
P
ATTCTGACCGCATCTCCCCTCTAAG
Cell lines and cell culture
The gastric adenocarcinoma cell line AGS was obtained from
the national cell bank of Iran (Pasteur institute of Iran, Tehran) and was cultured in RPMI-1640 (Gibco), supplemented
with penicillin/streptomycin (100 U/ml and 100 lg/ml,
respectively) and 10% fetal bovine serum, at 37 C in a
humidified atmosphere of 5% CO2. The human EC cells,
NTERA2 (NT2), were cultured in Dulbecco’s Modified Eagle
Medium (DMEM) with high concentration of glucose (4500
mg/l), supplemented with 10% fetal bovine serum at 37 C
(humidified) and 5% CO2.
Designed
oligo
Sequence
GAPDH
F
GTGAACCATGAGAAGTATGACAAC
R
CATGAGTCCTTCCACGATACC
P
CCTCAAGATCATCAGCAATGCCTCCTG
177
128
123
Abbreviations: F, forward primer; R, reverse primer; P, probe.
at 60 C for 34 seconds. To determine the reaction efficiencies
for each primer pair and the corresponding probe, standard
curves were plotted by using serial dilutions of NT2 cDNA.
All reaction efficiencies were measured to be close to 100%.
All experiments were conducted in duplicate or triplicate.
Group-wise comparison and statistical analysis of relative
expression results of real-time PCR were carried out by REST
2008 (Relative Expression Software Tool, V2.0.7, Corbette
Research). SPSS 17.0 for windows (Chicago, IL) was also
used to plot the charts and to analyze the correlation between
the expression of each variant and the tumor state and grade
of the samples.
Immunocytochemistry
AGS and NT2 cells were fixed in 4% paraformaldehyde for
15 min at room temperature. Cells were then permeabilized
in 0.25% Triton X-100 [0.1% Tween-20 in phosphate buffered saline (PBS)] for 10 min and blocked in 1% BSA in
PBST for 30 min. The cells were then incubated in the
diluted first antibody (an affinity-purified goat polyclonal
anti-OCT4 antibody, sc-8629; Santa Cruz Biotechnology) in
PBST containing 1% BSA for 1 hr at room temperature. The
antibody reacts with the C-terminus of OCT4 protein and
hence recognizes both OCT4A and OCT4B variants. After
washing the cells three times with PBS, cells were incubated
with the secondary antibody (anti-goat IgG; Sigma-Aldrich)
at dilutions 1:100 in 1% BSA for 1 hr at room temperature.
The cells were then washed 3 times with PBS, counterstained
with Geimsa and visualized under a fluorescent microscope
(Nickon, Germany). For negative control samples, all conditions were kept the same, except that the primary antibody
was omitted.
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V
2647
Asadi et al.
RNA interference
Caspase assay
Two specific siRNAs for OCT4B1 suppression in AGS cell
line and an irrelevant siRNA (IR-siRNA) with no complementary target sequence more than 16 out of its 21 mer
length within human genome were designed by the siRNA
Selection Program (Whitehead Institute for Biomedical
Research; http://jura.wi.mit.edu/) and synthesized by MWG
company (Germany).
The sequences of the siRNAs are as followed:
Caspase-3 and caspase-7 activities were measured using Caspase-Glo 3/7 reagent (Promega). Caspase-Glo 3/7 reagent
added to the cell suspension aliquots in quadruplicate, and
incubated at room temperature for 1 h. The luminescence of
each sample was then measured by a Luminometer (Berthold,
Germany).
The above siRNAs were designed based on the Exon2b
sequence of OCT4B1, which discriminates it from the other
variants of OCT4.
IR:
Sense: GCGGAGAGGCUUAGGUGUAdTdT
Antisense: UACACCUAAGCCUCUCCGCdTdT
One day before siRNAs transfection, 2 104 cells per
well (30–50% of confluency at the time of transfection) were
cultured on six-well plates in growth medium without antibiotic. siRNAs were introduced into the cells, using the LipofectamineTM RNAiMAX Transfection Reagent (Invitrogen).23
Briefly, 5ll of siRNA (25lM) solution and 4.5ll RNAiMAX reagent were diluted in 250ll Opti-MEM (Invitrogen)
and incubated for 10 min in room temperature. The mixture
was then added to the cells in a final volume of 2.5 ml. Cells
were further incubated for 3 days at 37 C in a 5% CO2
incubator.
Cell cycle analysis
For cell cycle analysis, cells were washed with PBS and trypsinized with 0.025% trypsin-EDTA to yield single cell suspensions. Then cells were stained with 50 lg/ml propidium iodide
solution containing 0.1% Triton X-100 and sodium citrate as
described elsewhere.24 The single cell suspensions were then
used for flow cytometric (Partec, Germany) analysis. Cell cycle
profiles were analyzed using Partec Flomax software.
Apoptosis analysis by annexin-V-FLUOS staining kit
Apoptosis was measured by detecting the exposed phosphatidylserine in the cell membrane, using the Annexin-V-FLOUS
and propidium iodide kit (Roch). The cells were then analyzed on a flow cytometer and typical histograms of apoptotic
versus nonapoptotic and necrotic cells were generated.
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V
OCT4B1 is highly expressed in gastric adenocarcinoma
To study the possibility of OCT4B1 expression in gastric adenocarcinoma, and to compare its expression level with those
of the OCT4A and OCT4B variants, we carefully designed
forward and reverse primers and probes for specific amplification of each variant. The primers also designed in a way to
avoid nonspecific amplification of OCT4 pseudogenes, which
have highly similar sequences to OCT4A. Furthermore, the
identity of the amplified products was confirmed by direct
DNA sequencing (data not shown). The relative expression
of OCT4 spliced variants was compared between tumor and
nontumor marginal tissues obtained from the same patients.
Expression of GAPDH was used in all samples as an internal
control, for normalization of probable sampling errors.
Our data revealed that OCT4B1 is expressed in both tumor and nontumor samples of stomach. OCT4B1 expression
was detected in 86.1% (31/36) of the tumor samples and
55.5% (20/36) of the marginal counterparts of the same
tumors (Fig. 1a). However, the level of expression was much
higher in the tumor samples compared to the apparent normal tissues obtained from the margin of same tumors (p <
0.002; Fig. 1b). Moreover, in the tumor group, OCT4B1
expression was much higher in the high-grade tumors compared to the low-grade ones (p < 0.05; Fig. 1c).
Similar observations were made for OCT4A and OCT4B
variants. OCT4A expression was detected in 91.67% (33/36)
of tumor samples and 58.33% (21/36) of marginal samples.
Moreover, its expression level was several folds higher in the
tumor group compared to that of nontumor (marginal)
group (p < 0.001; Fig. 1d and 1e). The level of expression
was also significantly higher in high-grade tumors compared
to the low-grade ones (p < 0.01, Fig. 1f).
Similarly, the expression of OCT4B was detected in
91.67% (33/36) of tumor samples and 44.5% (16/36) of nontumor ones. OCT4B showed a significant overexpression in
the tumor group in comparison to the marginal samples
(p < 0.001; Figs. 1g and 1h). In contrast to other two variants, while the expression of OCT4B was apparently higher
in the high-grade tumors, the difference was not statistically
significant (Fig. 1k).
All three variants of OCT4 are expressed in the
AGS gastric adenocarcinoma cell line
We used AGS, a gastric adenocarcinoma cell line, as a model
system to evaluate the effects of OCT4B1 knock-down on the
Cancer Genetics
Oct4B1-siRNA1 Target sequence: AAG GAG TAT CCC
TGA ACC TAG
Sense: (GGA GUA UCC CUG AAC CUA G)dT dT
Antisense: (CUA GGU UCA GGG AUA CUC C)dT dT
Oct4B1-siRNA2 Target sequence: AAG AGG TGG TAA
GCT TGG ATC
Sense: (CAG GUG GUA AGC UUG GAU C)dT dT
Antisense: (GAU CCA AGC UUA CCA CCU C)dT dT
Results
OCT4B1, a novel spliced variant of OCT4
Cancer Genetics
2648
Figure 1. Histograms comparing the results obtained by quantitative RT-PCR: (a,d,g) percentages of non-tumor and tumor samples
expressing OCT4 variants. (b,e,h) the relative expression of OCT4 variants to GAPDH in tumor vs. non-tumor samples. (c,f,k) the relative
expression of OCT4 variants to GAPDH in high grade vs. low-grade tumors. Values shown represent the mean 6STD.
cells’ behavior. Accompanying each set of experiments, the
embryonic carcinoma cell line, NT2, was also employed as a
positive control. As shown in Figure 2a, all three variants of
the gene are expressed at the mRNA level in both cell lines.
Since there is not yet a specific antibody against OCT4B1,
and it is not even clear whether the variant is translated at
the protein level, we examined the expression of the other
two variants of OCT4 at protein level. Using a polyclonal
antibody capable of detecting both OCT4A and OCT4B isoforms, we determined the expression and subcellular localization of these variants by immunocytochemistry. While a nu-
clear signal was easily detectable in NT2 cells (Fig. 2e), the
immunoreactivity signal was primarily cytoplasmic in AGS
cells (Fig. 2c). The latter finding suggests that despite expression of OCT4A at mRNA level, its translated form is either
not produced or stably maintained in AGS cell line.
Morphological changes of AGS cells after
OCT4B1-siRNA transfection
The level of OCT4B1 expression in AGS cells treated with the
specific siRNA against the variant was dramatically reduced in
a magnitude of 10 times, compared to the cells transfected
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V
Figure 2. Expression of OCT4 variants in NT2 and AGS cell lines.
(a) RT-PCR analysis was performed using carefully designed
primers for specific amplification of each variant. Note that all
Figure 3. Suppressing OCT4B1 expression in AGS cell line by means
of siRNA. (a) Cells treated with OCT4B1-siRNA, compared to the ones
three variants are expressed in both cell lines. GAPDH was used as
treated with IR-siRNA, demonstrated a dramatic down-regulation of
an internal control. (b)–(d) The immunocytochemistry results
demonstrated a primarily cytoplasmic signal for translated form of
OCT4B1 expression, as determined by real-time PCR. GAPDH was
used as an internal control. (b,c) Giemsa staining of AGS cells
OCT4 in AGS cells (c). In contrast, NT2 cells, an embryonic
treated with IR-siRNA (b) or OCT4B1-siRNA (c). Note that multinuclear
carcinoma cell line, showed a nuclear immunoreactivity signal for
OCT4 (e). (b) The phase contrast invert microscopy counterpart
giant-like cells were generated after treatment with OCT4B1-siRNA.
(d,e) No difference in the expression level of OCT4A (d) and OCT4B
image of the cells in C. (d) DAPI staining of the cells in (c),
(e) in the AGS cells treated with IR-siRNA and OCT4B1-siRNA. [Color
illustrating the nuclei of the cells. [Color figure can be viewed in
the online issue, which is available at wileyonlinelibrary.com.]
figure can be viewed in the online issue, which is available at
wileyonlinelibrary.com.]
with an irrelevant (IR)-siRNA (Fig. 3a). Three days following
the suppression of OCT4B1, the morphology of the cells was
dramatically altered; while there were no obvious morphological changes in the cells treated with the IR-siRNA (Fig. 3b).
The altered morphology of the cells mimicked the ones of
multinuclear giant cells (MNGCs, Fig. 3c), with some of the
cells showing unusually higher number of nuclei. Similar
observations were made with a second set of siRNA (oct4B1siRNA2, Supporting Information Fig. 1).
Cell cycle alterations following OCT4B1
knock-down in AGS cells
Figure 4. Effect of OCT4B1 knockdown on cell cycle distribution in
Cell cycle distribution of the AGS cells transfected with
OCT4B1-siRNA and IR-siRNA was determined by flow
cytometry, 3 days after transfection. Compared to the cells
treated with IR-siRNA, there existed only two peaks of
counted cells in OCT4B1-siRNA transfected group (Fig. 4).
in flow cytometry diagram. The first sub-G1 peak depicts the
fraction of apoptotic cells and the second peak shows the fraction
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V
AGS cell line. After inhibition of OCT4B1, we observed two peaks
of cells with similar DNA contents of the multinuclear giant-like
cells. [Color figure can be viewed in the online issue, which is
available at wileyonlinelibrary.com.]
Cancer Genetics
2649
Asadi et al.
2650
OCT4B1, a novel spliced variant of OCT4
Moreover, the fraction of the cells appearing in sub-G1, a
characteristic feature of apoptotic cells, constituted about
50% of the total cells. The remaining cells had DNA contents
higher than that of normal cells, suggesting that the cells
were multinuclear, probably containing two or more nuclei.
Elevated rate of apoptosis in AGS cells treated
with OCT4B1-siRNA
Cancer Genetics
Flow cytometry analyzes of the cells stained with Annexin-VFLOUS and propidium iodide demonstrated that by 3 days
after OCT4B1-siRNA transfection up to 39% of the cells had
been undergone apoptosis, in comparison to the 13% of the
cells transfected with IR-siRNA. Furthermore, the ratio of
apparently necrotic cells increased to 20% of the total cells in
OCT4B1-siRNA treated cells, a five-times increase compared
to that of IR-siRNA transfected cells (Fig. 5a and 5b).
Similar observations were made with Caspase activity
assay experiment in which relative activities of caspase-3 and
caspase-7 were measured using a luminescence-based assay.
OCT4B1-siRNA treated cells showed a significant elevation
in the activities of caspase-3 and caspase-7, in contrast to the
cells treated with IR-siRNA (p < 0.01, Fig. 5c).
Discussion
The transcription factor OCT4 is a well-known embryonic
stem cell marker, with a key role in regulating stemness state,
self-renewal and pluripotency of stem cells.6–10 Recent reports
showing the expression of OCT4 in cancer cell lines and tissues,11–19 appeared to be highly controversial. Several other
reports claimed that OCT4 is not expressed in cancer cell
lines and somatic stem cells and its expression in the earlier
reports is prone to artifacts, probably generated by OCT4
pseudogene transcripts.25–28 One other possibility for the
contrary results presented by these reports is their failure to
discriminate among the expressions of different variants of
OCT4.
In an earlier work to address the aforementioned issue,
we designed specific PCR primers and probes to distinguish
the expression of different variants of OCT4 (OCT4A and
OCT4B) in a wide spectrum of tumor vs. stem cell lines.20
Our data revealed that OCT4A is primarily expressed in ES
cell lines, where the protein is primarily located in the nuclei
of the cells. In contrast, the OCT4B variant is preferentially
expressed in tumor cell lines, and the encoded protein is
mostly located within the cytoplasm of the cells.20 This distinctive expression pattern and subcellular distribution of
OCT4 variants accounts for some earlier inconsistency and
highlighted the necessity of defining the variant of OCT4
when addressing the expression of the gene in different cell
lines and tissues.
Furthermore, we discovered a novel variant of OCT4, designated as OCT4B1, which is highly expressed in stem cells
and some tumor cell lines, and down-regulated upon the
induction of differentiation.20 The differential pattern of
OCT4B1 expression in differentiated and nondifferentiated
Figure 5. Increased rate of apoptosis following OCT4B1 inhibition
in AGS cells. (a,b) Annexin histograms illustrate that around 39%
of the cells have been undergone apoptosis by 3 days after
transfection with OCT4B1 specific siRNA (b) versus 13% in IRsiRNA transfected cells (a). The percentage of necrotic cells in
OCT4B1 and IR siRNA transfected cells were 12% and 4%,
respectively. Elevation of caspase-3/caspase-7 relative activities in
response to OCT4B1 knockdown in AGS cells was determined
using Caspase-Glo 3/7 kit, as a measurement of the apoptotic
level (c). [Color figure can be viewed in the online issue, which is
available at wileyonlinelibrary.com.]
stem cell lines20 suggests a potential biological role for the
variant in stem as well as tumor cell lines.
To investigate the possibility of OCT4B1 involvement in
tumorigenesis, we investigated here the expression of the variant in tumor vs. nontumor marginal tissues of 36 patients
with gastric adenocarcinoma. Our results revealed that
OCT4B1 is expressed in most samples of gastric adenocarcinoma, where its level of expression is highly elevated in tumor tissues compared to that of nontumor samples. Interestingly, the level of OCT4B1 expression was significantly
higher in high-grade tumors in contrast to that of low-grade
ones. This finding suggest that (1) OCT4B1 can be regarded
as a new tumor marker for gastric, and probably other
tumors and (2) in contrast to the OCT4B variant, OCT4B1
had a better correlation with the state of differentiation of
the cells and could better predicts the degree of malignancy
of tumors. This finding is in accordance with our previous
report that the expression of OCT4B1 is sharply down-regulated upon the induction of differentiation of stem cell
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V
lines.20 The low expression of OCT4 variants in apparently
nontumor marginal tissues of the same patients could be due
to the penetration of cancer cells into their apparently normal margins.11 An alternative interpretation is that the
detected OCT4 expression is due to the presence of the normal adult stem cells, which do exist in all normal tissues.
Indeed, the expression of OCT4 at mRNA and protein levels
has been already reported in several tissue-specific human
adult stem cells.5
To investigate weather the upregulation of OCT4B1 in tumor samples has a causative tumorigenic role, we knockeddown the expression of the variant by using two separate sets
of specific siRNAs in a gastric adenocarcinoma cell line, AGS.
Successful inhibition of OCT4B1 in AGS cells, as confirmed by
real-time RT-PCR, gave rise to the formation of some multinuclear giant-like cells and a significant increase in the rate of
apoptosis. The latter findings suggest that OCT4B1 has a causative role in tumorigenesis and that it could be regarded as a
potential therapeutic target to combat cancer.
One hallmark of the OCT4B1 knockdown in AGS cells
was a transformation of the treated cells into a multinuclear
giant-like morphology. The morphological changes in the
AGS cells might be a mechanism to protect some cells from
apoptosis or senescence, a hypothesis that need to be experimentally validated. However, based on previous reports, following the induction of apoptosis, cells mutated for p53
could enter into an abnormal cycle that leads toward the formation of giant polyploidy cells. On contrary, cells with wild
type p53 exhibited mitotic arrest as well as programmed cell
death.29 Despite having apparently wild type p53, AGS cells
change their morphology into giant cells following treatment
with anticancer drug, taxol.29 Therefore, this property of AGS
cells suggests that inhibition of OCT4B1 may induce cell
death in most cells, but giant-cell transformation in a portion
of cells could help them to escape apoptosis.
It is not yet clear whether OCT4B1 exerts its functions at
the mRNA or protein level. Insertion of intron 2 generates a
frame-shift in the sequence of OCT4B1 and the formation of
a putative 115 amino acids truncated form of the protein.20
Due to the lack of a specific antibody against OCT4B1, the
possible generation of a stable protein form of the variant is
still unclear. Comparison of the amino acid sequences of
OCT4B1 and OCT4B showed the identity of amino acids 180 between the two proteins. They have similar N-terminal
domain and a part of the POUs domain, comprising amino
acids 43 through 80. However, OCT4B1 lacks the rest of the
POUs domain as well as the POUH and C-terminal transactivation domains. Determining the expression of OCT4B1 at
the protein level along with its subcellular distribution within
stem and cancer cells would shed more light on clarifying the
biological role of OCT4B1 in stem and cancer cells. In this
regard, our primary data suggests that OCT4B1-HA is translated and localized in the cytoplasm of the transfected cells
(own unpublished observations).
In conclusion, for the first time our data revealed the upregulation of OCT4B1 in gastric adenocarcinoma and that
the variant is contributing in tumorigenesis process as an
antiapoptotic factor. Hence, OCT4B1 can be considered as a
novel tumor marker with potential diagnostic, prognostic and
therapeutic value.
Acknowledgements
The authors thank Dr. Kamran Alimoghadam and Dr Forouzandeh Fereidooni for their encouragement and support. All biological materials were
provided by the IRAN NATIONAL TUMOR BANK which is funded by the
Cancer Institute of Tehran University, for Cancer Research.
References
1.
2.
3.
4.
5.
6.
Robert WC and Clarke MF. Recent
advances in cancer stem cells. Curr Opin
Genet Dev 2008;18:48–53.
Clarke MF, Fuller M. Stem cells and
cancer: two faces of eve. Cell 2006;124:
1111–5.
Pardal R, Clarke MF, Morrison SJ.
Applying the principles of stem-cell
biology to cancer. Nat Rev Cancer 2003;3:
895–902.
Al-Hajj M, Clarke MF. Self-renewal and
solid tumor stem cells. Oncogene 2004;23:
7274–82.
Tai MH, Chang CC, Kiupel M, Webster
JD, Olson LK, Trsko JE. Oct4 expression in
adult human stem cells: evidence in
support of the stem cell theory of
carcinogenesis. Carcinogenesis 2005;26:
495–502.
Nichols J, Zevnik B, Anastassiadis K, Niwa
H, Klewe-Nebenius D, Chambers I, Scholer
H, Smith A. Formation of pluripotent stem
cells in the mammalian embryo depends
on the POU transcription factor Oct4. Cell
1998;95:379–391.
7. Scholer HR, Ruppert S, Suzuki N
Chowdhury K, Gruss P. New type of POU
domain in germ line-specific protein Oct-4.
Nature 1990;344:435–439.
8. Rosner MH, Vigano MA, Ozato K,
Timmons PM, Poirier F, Rigby PW, Staudt
LM. A POU-domain transcription factor in
early stem cells and germ cells of the
mammalian embryo. Nature 1990;345:
686–92.
9. Niwa H, Miyazaki J, Smith AG.
Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or selfrenewal of ES cells. Nat Genet 2000;24:
372–6.
10. Babaie Y, Herwig R, Greber B, Brink TC,
Wruck W, Groth D, Lehrach H, Burdon T,
Adjaye J. Analysis of Oct4-dependent
transcriptional networks regulating self-
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V
11.
12.
13.
14.
15.
renewal and pluripotency in human
embryonic stem cells. Stem Cells 2007;25:
500–510.
Atlasi Y, Mowla SJ, Ziaee AM, Bahrami
AR. OCT-4, an embryonic stem cell
marker, is highly expressed in bladder
cancer. Int J Cancer 2007;120:
1598–1602.
Chang CC. Recent translational research:
Stem cells as the roots of breast cancer.
Breast Cancer Res 2006;8:103–106.
Du Z, Jia D, Liu S, Wang F, Li G, Zhang
Y, Cao X, Ling EA, Hao A. Oct4 is
expressed in human gliomas and promotes
colony formation in glioma cells. Glia
2009;57:724–33.
Kasper S. Exploring the origins of the
normal prostate and prostate cancer stem
cell. Stem Cell Rev 2008;4:193–201.
Prince ME, Ailles LE. Cancer stem cells in
head and neck squamous cell cancer. J Clin
Oncol 2008;26:2871–5.
Cancer Genetics
2651
Asadi et al.
2652
21.
22.
23.
24.
cells. Stem Cells 2008;26:
3068–74.
Lee J, Kim HK, Rho JY, Ham YM, Kim Y.
The human OCT-4 isoforms differ in their
ability to confer self-renewal. J Biol Chem
2006;281:33554–65.
Cauffman G, Liebaers I, Van Steirteghem
A, Van de Velde H. POU5F1 isoforms
show different expression patterns in
human embryonic stem cells and
preimplantation embryos. Stem Cells
2006;24:2685–2691.
Zhao M, Yang H, Jiang X, Zhou W, Zhu
B, Zeng Y, Yao K, Ren C. Lipofectamin
RNAi MAX: an efficient siRNA
transfection reagent in human embryonic
stem cells. Mol Biotechnol 2008;40:19–26.
Nikpour P, Mowla SJ, Jafarnejad SM,
Fischer U, Schulz WA. Differential effects
of Nucleostemin suppression on cell cycle
arrest and apoptosis in the bladder cancer
cell lines 5637 and SW1710. Cell Prolif
2009;42:762–769.
25. Cantz T, Key G, Bleidiel M, Han DW,
Brenne A, Scholer HR. Absence of OCT4
expression in somatic tumor cell lines.
Stem Cells 2008;26:692–697.
26. Berg JS, Goodell MA. An argument
against a role for Oct4 in somatic stem
cells. Cell Stem Cell 2007;1:
359–360.
27. Liedtke S, Enczmann J, Waclawczyk S,
Wernet P, Kogler G. Oct4 and its
pseudogenes confuse stem cell research.
Cell Stem Cell 2007;1:
364–367.
28. Suo G, Han J, Wang X, Zhang J, Zhao Y,
Zhao Y, Dai J. Oct4 pseudogenes are
transcribed in cancers. BBRC 2005;337:
1047–1051.
29. Kim SM, Kim R, Ryu JH, Jho EH, Song
KJ, Jang SI, Kee SH. Multinuclear giant
cells formation is enhanced by downregulation of Wnt signaling in gastric
cancer cell line, AGS. Exp Cell Res 2005;
308:18–28.
Cancer Genetics
16. Dylla SJ, Beviglia A, Park IK, Chartier C,
Raval J, Ngan L, Pickell K, Aguilar J,
Lazetic S, Smith-berdan S, Clarke MF,
Hoey T, et al. Colorectal cancer stem cells
are enriched in xenogeneic tumors
following chemotherapy. PLoS One 2008;
18: 3:e2428.
17. Sotomayor P, Godoy A, Smith GJ, Huss
WJ. Oct4 A is expressed by a
subpopulation of prostate neuroendocrine
cells. Prostate 2009;69:401–410.
18. Gidekel S, Pizov G, Bergman Y Pikarsky E.
Oct-3/4 is a dose-dependent oncogenic fate
determinant. Cancer Cell 2003;4:361–70.
19. Chen Z, Xu WR, Qian H, Zhu W, Bu XF,
Wang S, Yan YM, Mao F, Gu HB, Cao
HL, Xu XJ. Oct4, a novel marker for
human gastric cancer. J Surg Oncol 2009;
99:414–419.
20. Atlasi Y, Mowla SJ, Ziaee AM Gokhale PJ,
Andrews PW. OCT4 spliced variants are
differentially expressed in human
pluripotent and non-pluripotent
OCT4B1, a novel spliced variant of OCT4
C 2010 UICC
Int. J. Cancer: 128, 2645–2652 (2011) V