Download Experimental induction of retinal ganglion cell death in adult mice.

1000
Reports
6. Bunt-Milam AH, SaariJC. Immunocytochemical localization of two
retinoid-binding proteins in vertebrate retina. / Cell Biol. 1983;97:
703-712.
7. Bok D. The retinal pigment epithelium: a versatile partner in
vision./ Cell Sci. 1993;17:189-195.
8. Bernstein PS, Law WC, Rando RR. Isomerization of all-trans-retinoids to 11-czs-retinoids in vitro. Proc Natl Acacl Sci USA. 1987;84:
1849-1853.
9. Deigner PS, Law WC, Canada FJ, Rando RR. Membranes as the
energy source in the endergonic transformation of vitamin A to
11-cfe-retinol. Science. 1989;244:968-971.
10. SaariJC, Bredberg L, Garwin GG. Identification of the endogenous
retinoids associated with three cellular retinoid-binding proteins
JOVS, April 1999, Vol. 40, No. 5
11.
12.
13.
14.
from bovine retina and retinal pigment epithelium. / Biol Chem.
1982;257:13329-13333.
Saari JC, Bredberg D, Noy N. Control of substrate flow at a branch
in the visual cycle. Biochemistry. 1994;33:3106-3112.
Morimura H, Berson EL, Dryja TP. Recessive mutations in the
RLBP1 gene encoding cellular retinaldehyde-binding protein in a
form of retinitis punctata albescens. Invest Ophthalmol Vis Sci.
1999;40:1000-1004.
Broman KW, Murray JC, Sheffield VC, White RL, Weber JL. Comprehensive human genetic maps: individual and sex-specific variation in
recombination. 1998 http://www.marshmed.org/genetics/.
Hudson T, Stein L, Gerety S, et al. An STS-based map of the human
genome. Science. 1995;270:1945-1954.
Recessive Mutations in the
RLBP1 Gene Encoding Cellular
Retinaldehyde-Binding Protein
in a Form of Retinitis
Punctata Albescens
Hiroyuki Morimura,1 Eliot L Berson,2 and
Thaddeus P. Dryja1'1
PURPOSE. TO determine the frequency and spectrum of
mutations in the RLBP1 gene encoding cellular retinaldehyde-binding protein (CRALBP) in patients with hereditary retinal degeneration.
The single-strand conformation polymorphism
(SSCP) technique and a direct genomic sequencing technique were used to screen the coding exons of this gene
(exons 2-8) for mutations in 324 unrelated patients with
recessive or isolate retinitis pigmentosa, retinitis punctata
albescens, Leber congenital amaurosis, or a related disease. Variant DNA fragments revealed by SSCP analysis
were subsequently sequenced. Selected alleles that altered
the coding region or intron splice sites were evaluated
further through segregation analysis in the families of the
index cases.
METHODS.
RESULTS. Four novel
mutations were identified in this gene
among three unrelated patients with recessively inherited
retinitis punctata albescens. Two of the mutations were
From the 'Ocular Molecular Genetics Institute and the 2 BermanGuncl Laboratory for the Study of Retinal Degenerations, Harvard Medical School and the Massachusetts Eye and Ear Infirmary, Boston,
Massachusetts.
Supported by Grants EY08683 and EY00169 from the National Eye
Institute, National Institutes of Health, Bethesda, Maryland; the Foundation Fighting Blindness, Hunt Valley, Maryland; and the Massachusetts Lions Eye Research Fund, Northborough; and by private donations to the Taylor Smith Laboratory and the Ocular Molecular Genetics
Institute. TPD is a Senior Scientific Investigator of Research to Prevent
Blindness, New York, New York.
Submitted for publication October 16, 1998; accepted December
11, 1998.
Proprietary interest category: N.
Reprint requests: Thaddeus P. Dryja, MD, Massachusetts Eye and
Ear Infirmary, 243 Charles Street, Boston, MA 02114.
missense: one was a frameshift, and one affected a canonical splice donor site.
Recessive mutations in the RLBP1 gene are
an uncommon cause of retinal degeneration in humans.
The phenotype produced by RLBP1 mutations seems to
be a form of retinitis punctata albescens. (Invest Ophthalmol Vis Sci. 1999;40:1000 -1004)
CONCLUSIONS.
T
he first step in vision occurs when a photon converts an
1 l-cis retinal chromophore, which is covalently linked to
rod or cone opsin, to the all-trans isomer.1 In mammals, this
reaction takes place in the outer segments of the photoreceptor cells of the retina. The aH-trans chromophore subsequently
leaves rod or cone opsin and travels as all-fraws-retinol to a
neighboring retinal pigment epithelial cell,2 where it is converted through a series of intermediates back to 11-m-retinaldehyde. The protein CRALBP seems to play a role in this
pathway. CRALBP is present in the retinal pigment epithelium
and the Miiller cells of the retina.3 The protein forms complexes with regenerated 11-a's-retinaldehyde and its immediate
precursor 11-czs-retinol.4'5 Still uncertain is whether these complexes are essential intermediates in this pathway or whether
CRALBP has another physiological role.
The requirement for CRALBP in the retina was highlighted
by a recent report of the missense mutation Argl50Gln in the
RLBP1 gene (chromosome 15q26)6 in a family from India with
a recessive retinal degeneration that was termed retinitis pigmentosa.7 The mutation was homozygous in the affected members but not in the unaffected members of an 11-member
sibship that was the product of a first-cousin marriage. Evidence for the pathogenicity of this mutation came from the
observations that the mutant protein in vitro was less water
soluble than normal and that it did not bind to 11-m-retinaldehyde.7 In the present report, we provide additional evidence, through the identification of mutations in patients of
European ancestry, that recessive defects in the human RLBP1
gene are pathogenic. Furthermore, the clinical findings from
our cases and those in the report by Burstedt et al8 in this issue
suggest that the phenotype can be distinguished from typical
retinitis pigmentosa.
METHODS
Ascertainment of Patients
This study, which involved human subjects, conformed to the
tenants of the Declaration of Helsinki. The index patients in
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
Reports
IOVS, April 1999, Vol. 40, No. 5
this study had a diagnosis of retinal degeneration or malfunction made through ophthalmologic examination including
electroretinography (ERG). Most patients resided in the United
States or Canada.
Patients with autosomal recessive retinitis pigmentosa had
unaffected parents and at least one affected sibling or were the
offspring of a consanguineous mating. If all affected siblings
with retinitis pigmentosa in a sibship were males, the possibility of X-linked disease was evaluated through an ophthalmologic examination of the mother, including an ERG to search
for the carrier state of X-linked retinitis pigmentosa; families
with X-linked retinitis pigmentosa were excluded from this
study. Some isolate cases were included. They had no affected
relatives and were not the offspring of a consanguineous mating. Atypical retinitis pigmentosa was diagnosed in these patients if they had some combination of the following features:
reduced but unusually large ERGs for their age, an unusual
pigmentary pattern, or no abnormality of dark adaptation
threshold after 45 minutes of dark adaptation; all were isolate
cases.
Patients with retinitis punctata albescens had ERG findings
indicating a generalized retinal degeneration, elevated dark
adaptation threshold after 45 minutes of dark adaptation, and
fundi that showed attenuated arterioles and subretinal yellow
or yellow-white deposits as a predominant feature. Some also
had intraretinal pigment deposits.
Patients with Leber congenital amaurosis had absent or
severely diminished vision within the first year of life and
markedly diminished ERGs; all had unaffected parents. Patients
with fundus albipunctatus had normal retinal vessels, diffuse
subretinal white deposits, elevated dark adaptation thresholds,
and reduced ERGs after 45 minutes of dark adaptation that
became normal after 6 to 12 hours of dark adaptation.
Patients with other forms of stationary night blindness had
fundi without the stigmata of retinitis pigmentosa, elevated
dark-adaptation thresholds, reduced rod ERGs, and cone ERGs
that were normal when corrected for age and refractive error.
Control subjects had no known blood relative with hereditary
retinal degeneration and no symptoms of retinal malfunction.
After informed consent, we collected between 3 ml and
50 ml venous blood from each patient or control subject.
Leukocyte nuclei were prepared from the blood samples and
stored at — 70°C before DNA was purified from them.
Screening for RLBP1 Mutations
Exons 2 through 8 of the RLBP1 gene were individually amplified from human genomic DNAs by polymerase chain reaction (PCR) using the following primer pairs based on the
published genomic sequence6 (sense, antisense, respectively):
exon 2, TGAGATCCACAGTTCTGAGAC, AGGAGAGCCCTGGAGGACA; exon3, GGCTGATGCGGTTGGCTGTT, CCCCTCATGTTGCCTCCCTA; exon 4, CTCATCACCTGTGTGTCCTGCC, GAGAGCGGATAGCATCCTCATG; exon 5, CTTCTGAGTCCCACTAGGAGG, CCAGTAGAGGCCAGGGTTGA; exon 6,
CCTCAGGACCTCAAGCCTTA, CTGCAAGCACCATGAAAGGA;
exon 7, AATGAGTGGGAGCCTCTGAG, CCCTCTTGTCTCATTGTCTGG; and exon 8, CTCCTGCTCAGTTCTGTCTC, AGTTCAGCTGGCAGGAGATG. The single-strand conformation
polymorphism (SSCP) technique was used to screen for point
mutations and other small-scale sequence changes. PCRs were
performed in the wells of 96-well microtiter plates. In each
well was 50 ng to 100 ng leukocyte DNA in 20 /al of a solution
1001
containing 20 mM Tris-HCl (pH 8.4 or 8.6), 0.25 to 1.5 mM
MgCl2, 50 mM KC1, 0.02 mM deoxyadenosine triphosphate
(dATP), 0.02 mM deoxythymidine triphosphate (dTTP), 0.02
mM deoxyguanosine triphosphate (dGTP), and 0.002 mM deoxycytidine triphosphate (dCTP), 0.6 mCi [a-32P] deoxycytidine triphosphate (3000 Ci/millimole), 0.1 mg/ml bovine serum albumin, 0% or 10% dimethyl sulfoxide, and 0.25 units of
Taq polymerase. The pH, Mg2+ concentration, and presence
or absence of 10% dimethyl sulfoxide were tailored to each
primer pair to yield optimal amplification. After initial denaturation (94°C for 5 minutes), 35 cycles of PCR amplification were
performed. Each cycle consisted of denaturation (94°C for 30
seconds), primer annealing (54°C for 30 seconds), and extension (71°C for 30 seconds). The final extension was at 71°C for
5 minutes. The amplified DNA fragments were heat denatured,
and the single-stranded fragments were separated, each
through two sets of 6% polyacrylamide gels, one set with and
one without 10% glycerol. Gels were run at 8 W to 12 W for 5
to 20 hours before drying and autoradiography.
Variant bands were evaluated by sequencing of corresponding PCR-amplified DNA segments using a cycle-sequencing protocol in a radiolabeled terminator cycle sequencing kit
(Thermo Sequenase; Amersham Life Science, Cleveland, OH).
Sequence variations expected to affect protein sequence or
expression were evaluated further by recruiting the relatives of
the index patient to participate in a study to determine
whether the variant allele cosegregated with the disease. For
this purpose, leukocyte DNA samples from the relatives were
analyzed by SSCP or direct genomic sequencing for the presence of the variant sequence.
RESULTS
Based on the previously reported 5' untranslated, 3' untranslated, and flanking intron sequences for the human RLBPJ
gene,6 we developed assays using the SSCP technique to
screen for mutations in the entire coding sequence and the
intron sequences immediately flanking exons 2 through 8.
With these assays, we evaluated DNA from 189 patients from
separate families with autosomal recessive retinitis pigmentosa, 45 unrelated patients with congenital amaurosis, 6 unrelated patients with retinitis pigmentosa sine pigmento, 16 unrelated patients with atypical retinitis pigmentosa, 28 unrelated
patients with Bardet-Biedl syndrome, 28 unrelated patients
with retinitis punctata albescens, 2 unrelated patients with
fundus albipunctatus with night blindness, and 10 unrelated
patients with stationary night blindness.
Three index patients were found to be homozygotes or
compound heterozygotes for mutations listed in Table 1. All
reported European ancestors. One patient (003-188) was homozygous for a frameshift mutation in codon 278 (Gln278[l-bp
del]; Fig. 1A). This frameshift changes the amino acid sequence
downstream of codon 278 and extends the length of the
encoded protein from 316 to 326 residues. This patient's parents were third cousins. Only the mother was alive, and she
was found to be a heterozygote for this mutation. The patient
had one living sibling. This sister was unaffected and was a
heterozygote. No other family members were affected. Another patient (097-001) heterozygously carried two sequence
abnormalities: One was a point mutation involving the canonical splice donor site of intron 3 (TVS3 + 2 T—>C; Fig. IB) and
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
1002
IOVS, April 1999, Vol. 40, No. 5
Reports
TABLE
1. Mutations Found in the RLBPl Gene
Patient
Genomic Location
Region of Gene or Codon Affected
003-188
097-001
097-001
274-007
9483delC
Exon 8, Gln*278(l-bp del) (GAG to -AG)
Intron 3 splice donor site, IVS3+2 (GT to GC)
Exon 6, Met°226Lys+ (ATG to AAG)
Exon 7, Arg+234Trp° (CGG to TGG)
Nucleotide numbers are based on a published RLBPl genomic sequence.6 The codon numbering
includes the initiation methionine, a residue that is not present in the final protein product.15 The
superscript symbol after each three-letter amino acid abbreviation indicates the type of R group: * polar;
0
nonpolar; + positively charged.
the other a missense change (Met226Lys; Fig. 1C). Each of this
patient's parents, who were unaffected, carried one of these
changes heterozygously (the mother had the splice-site mutation and the father the missense mutation), indicating that the
mutations were allelic and that the patient was therefore a
compound heterozygote (data not shown). There were no
other affected members in this family. There was one unaffected sibling (a brother) who carried the missense mutation
heterozygously. A third patient (274-007) was homozygous for
the missense mutation Arg234Trp (not shown). This patient
was a member of a Swedish kindred that we subsequently
learned was fortuitously and independently being studied by
another group (see the accompanying report8). None of the
four mutations found in these patients was found among 69 or
70 normal control subjects.
Ten other sequence anomalies were encountered during
this study (Table 2). One was a biallelic, single-base polymorphism in intron 6 with a minor allele frequency of 035 to 0.39Most of the others were interpreted as rare variants, because
they were not predicted to alter the sequence or expression of
the encoded protein. An exception was the missense change
Phel82Cys that was found heterozygously in an isolate case of
retinitis pigmentosa sine pigmento (patient identification number 008-005). No defect was found in the homologous allele in
this patient, and it was not studied further.
Clinical examination of patients 097-001 at age 19 years
and 003-188 at age 52 years showed small yellow deposits at
the level of the retinal pigment epithelium across the fundus.
In the older patient, there were round areas of atrophic retinal
pigment epithelium in the midperiphery and far periphery that
A. Gin278(1-bp del)
were reminiscent of those seen in gyrate atrophy (Fig. 2).
Intraretinal pigment deposits were sparse and were sometimes
seen at the borders of the atrophic patches of retinal pigment
epithelium. Retinal vessels were attenuated in both patients,
more so in the older patient. The funduscopic findings of the
Swedish patients with an RLBPl mutation were similar.8 Our
patients with RLBPl mutations had reduced rod and cone
ERGs with predominant loss of rod function.
DISCUSSION
The mutations in the RLBPl gene encountered in this study are
likely to be pathogenic, .because they were not found among
normal control subjects and because affected people, who had
recessively inherited disease, were either homozygotes or compound heterozygotes. Except for the mutation found in the
Swedish patient (see the accompanying report8), the probands
were from small families and had no affected relatives, so that
meaningful cosegregation analyses were not possible. Ah1 the
mutations could be predicted to have major effects on the
encoded protein. One of the mutations is a frameshift that
would alter the carboxyl terminus of the protein. Another is a
splice-site mutation that is likely to interfere with proper processing of the RNA transcript. Two of the mutations are missense and one changes a nonpolar residue to a positively
charged one (Met226Lys), whereas the other changes a positively charged residue to a nonpolar one (Arg234Trp). Additional work will be necessary to determine whether the corresponding mutant proteins have a reduced affinity for the
B. IVS3+2T->C
C. Met226Lys
wild type mutarrt
Control 097-001
CTAG CTAG
Control 003-188
CTAG C T A G
Gln228
Leu227
Met226Lys
Asp225
Val224
Phe27$
Met223
FIGURE 1. Sequence of the mutations found in the RLBPl gene. In each panel, the relevant region of the RLBPl genomic sequence is shown with
the sense direction going from the bottom to the top. The corresponding regions from a subject with the wild-type sequence are shown for
comparison.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
IOVS, April 1999, Vol. 40, No. 5
TABLE
Reports
1003
2. RLPB1 Polymorphisms, Rare Silent Variants, and Rare Variants of Uncertain Pathogenicity
Number of Respective Alleles*
Genomic Location
878C-»A
2779delGAGGCC
4674G->A
8008T-*G
8l67C-»T
Region of Gene or Codon Affected
Patients
Exon 2, 5' untranslated region (G versus A)
Exon 2, 5' untranslated region (C versus A)
Exon 2, 5' untranslated region (T versus C)
Exon 3, Arg + 42Arg + (CGC versus CGT)
IVS3-3 (T versus G)
rVS4+3 (GAGGCC versus —)
Exon 5, Arg + 121Arg + (CGG versus CGA)
Exon 6, Leu°177Leu° (TTG versus CTG)
Exon 6, Phe°182Cys* (TTC versus TGC)
IVS6+20 (C versus T)
646:2
647:1
647:1
647:1
647:1
645:3
647:1
647:1
647:1
397:251 (0.39)
Controls
140:0
140:0
140:0
140:0
138:0
134:4
140:0
138:0
138:0
90:48 (0.35)
Nucleotide numbering, codon numbering, and symbols are the same as in Table 1.
* Minor allele frequency in parentheses.
retinoids that are thought normally to form complexes with
CRALBP, an abnormality found in the previously reported missense mutation. 7
Certain clinical characteristics of the patients with RLBP1
mutations are similar to those found in patients with retinitis
pigmentosa, such as night blindness as an early symptom,
FIGURK 2. (A, B) Fundus photographs of the right eye of patient 097-001 at age 19 show slight retinal arteriolar attenuation with yellow subretinal
deposits throughout the retina and areas of atrophic retinal pigment epithelium in the periphery. (A) Temporal midperiphery; (B) posterior pole.
(C, D) Photographs of the right eye of patient 003-188 at age 52 show retinal arteriolar attenuation and peripheral and midperipheral atrophy of
the retinal pigment epithelium. (C) Posterior pole; (D), nasal midperiphery.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
1004
Reports
funduscopic findings of attenuated retinal vessels and intraretinal pigment deposits, and reduced ERGs. Other clinical findings shared by patients carrying RLBP1 mutations may be
sufficiently distinguishing to warrant a separate diagnostic category. All patients had small yellow deposits at the level of the
retinal pigment epithelium. Subretinal yellow deposits were
also described in the affected members of the previously reported family with an RLBP1 mutation,7 suggesting that this
feature may be a characteristic of the disease caused by defective or absent CRALBP. A second feature is the development of
patches of atrophic retinal pigment epithelium with well-defined, rounded margins in the retinal periphery that are reminiscent of those found in patients with gyrate atrophy.
The term "retinitis punctata albescens" is probably the
best existing one for the patients with RLBP1 defects, because
it is commonly used by ophthalmologists to describe a photoreceptor degeneration with or without intraretinal pigmentation that has minute yellow or yellow-white deposits deep in
the retina or at the level of the retinal pigment epithelium.910
Areas of chorioretinal atrophy have been described in some
patients with retinitis punctata albescens.10'11 Similar to retinitis pigmentosa, retinitis punctata albescens is genetically heterogeneous, with reports documenting cases caused by defects
in the RDS gene on chromosome 6p or in the rhodopsin gene
on chromosome 3q.12'13
The RLBP1 gene seems to be a rare cause of recessive
retinal disease, accounting for only 3 of 324 unrelated patients
with retinitis pigmentosa or an allied retinal degeneration or
malfunction in our series. A previous search among an overlapping set of patients for mutations in the RLBP1 gene using
Southern blot techniques14 was understandably negative, because the types of mutations found here involving single-base
changes or deletions are beyond the resolution of Southern
blot techniques. With recognition of the clinical features that
seem to be characteristic of this disease, it may be possible to
identify patients with a similar phenotype and to determine
whether they also have RLBP1 gene defects.
Acknowledgments
The authors thank Sten Andreasson for obtaining blood samples from
some of the patients.
Experimental Induction of
Retinal Ganglion Cell Death in
Adult Mice
Yan Li, Cassandra L Schlamp, and
Robert W. Nickells
Retinal ganglion cells die by apoptosis during
development and after trauma such as axonal damage and
exposure to excitotoxins. Apoptosis is associated with
changes in the expression of genes that regulate this
process. The genes that regulate apoptosis in retinal ganglion cells have not been characterized primarily because
previous studies have been limited to animal models in
which gene function is not easily manipulated. To overcome this limitation, the rate and mechanism of retinal
PURPOSE.
IOVS, April 1999, Vol. 40, No. 5
References
1. Schoenlein RW, Petenau LA, Mathies RA, Shank CV. The first step
in vision: femtosecond isomerization of rhodopsin. Science. 1991;
254:412-415.
2. Dowling JE. Chemistry of visual adaptation in the rat. Nature.
1960;188:ll4-118.
3- Bunt-Milam AH, Saari JC. Immunocytochemical localization of two
retinoid-binding proteins in vertebrate retina. / Cell Biol. 1983;97:
703-712.
4. Saari JC, Bredberg DL, Noy N. Control of substrate flow at a branch
in the visual cycle. Biochem. 1994;33:31O6-3112.
5. Crabb JW, Carlson A, Chen Y, et al. Structural and functional
characterization of recombinant human cellular retinaldehydebinding protein. Protein Sci. 1998;7:746-757.
6. Intres R, Goldflam S, Cook JR, Crabb JW. Molecular cloning and
structural analysis of the human gene encoding cellular retinaldehyde-binding protein. JBiol Chem. 1994;269:254l 1-25418.
7. Maw MA, Kennedy B, Knight A, et al. Mutation of the gene
encoding cellular retinaldehyde-binding protein in autosomal recessive retinitis pigmentosa. Nat Genet. 1997;17:198-200.
8. Burstedt MSI, Sandgren O, Holmgren G, Forsman-Semb K. Bothnia
dystrophy caused by mutations in the cellular retinaldehyde-binding protein gene (RLBP1) on chromosome 15q26. Invest Ophthalmol Vis Sci. 1999;40:995-1000.
9. Lauber H. Die sogenannte Retinitis punctata albescens. Klin
Monatsbl Augenbeilkd. 1910;48:133-l48.
10. Franceschetti A, Francois J, Babel J. Chorioretinal Heredodegenerations. Springfield, IL: Charles C. Thomas; 1963.
11. Pillat A. Tapetoretinal degeneration of the central fundus region.
Am J Ophthalmol. 1930;13:l-12.
12. Kajiwara K, Sandberg MA, Berson EL, Dryja TP. A null mutation
in the human peripherin/RDS gene in a family with autosomal
dominant retinitis punctata albescens. Nat Genet. 1993;3:208212.
13- Souied E, Soubrane G, Benlian P, et al. Retinitis punctata albescens
associated with the Argl35Trp mutation in the rhodopsin gene.
Am J Ophthalmol. 1996;121:19-25.
14. Cotran PR, Ringens PJ, Crabb JW, Berson EL, Dryja TP. Analysis
of the DNA of patients with retinitis pigmentosa with a cellular
retinaldehyde binding protein cDNA. Exp Eye Res. 199O;51:1519.
15. Crabb JW, Goldflam S, Harris SE, Saari JC. Cloning of the cDNAs
encoding the cellular retinaldehyde binding protein from bovine
and human retina and comparison of the protein sequences. J Biol
Chem. 1988; 263:18688-18702.
ganglion cell death in mice was characterized using optic
nerve crush and intravitreal injections of the glutamate
analog ./V-methyl-D-aspartate (NMDA).
METHODS. TO expose
retinal ganglion cells (RGCs) to excitotoxins, adult CB6F1 mice were injected intravitreally
in one eye with NMDA. In an alternative protocol to
physically damage the axons in the optic nerve, the nerve
was crushed using self-closing fine forceps. Each animal
had one or the other procedure carried out on one eye.
Loss of RGCs was monitored as a percentage of cells lost
relative to the fellow untreated eye. Thyl expression was
examined using in situ hybridization. DNA fragmentation
in dying cells was monitored using terminal transferasedUTP nick-end labeling (TUNEL).
comprise 67.5% ± 6.5% (mean ± SD) of
cells in the ganglion cell layer (GCL) of control mice based
RESULTS. RGCS
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
Reports
IOVS, April 1999, Vol. 40, No. 5
on nuclear morphology and the presence of mRNA for the
ganglion cell marker Thyl. One week after optic nerve
crush, these cells started to die, progressing to a maximum
loss of 57.8% ± 8.1% of the cells in the GCL by 3 weeks.
Cell loss after NMDA injection was dose dependent, with
injections of 10 nanomoles having virtually no effect to a
maximum loss of 72.5% ± 12.1% of the cells in the GCL
within 6 days after injection of 160 nanomoles NMDA.
Cell death exhibited features of apoptosis after both optic
nerve crush and NMDA injection, including the formation
of pyknotic nuclei and TUNEL staining.
Quantitative RGC death can be induced in
mice using two distinct signaling pathways, making it
possible to test the roles of genes in this process using
transgenic animals. (Invest Ophthalmol Vis Set. 1999;40:
1004-1008)
CONCLUSIONS.
etinal ganglion cells (RGCs) are the retinal neurons most
R
affected in disorders of the optic nerve, of which glaucoma
is the most prevalent. Recent studies indicate that RGCs die
with characteristics of apoptosis during normal development
of the retina and after injury to the axons of adult RGCs such
as axotomy of the optic nerve, experimental glaucoma in
animals, and glaucoma and anterior ischemic optic neuropathy
in humans.'
Various stimuli cause the death of RGCs. During development these cells acquire absolute dependence on neurotrophins secreted by the brain as part of the mechanism to ensure
proper synaptic connection with higher visual centers. Loss of
neurotrophic support stimulates the death of RGCs in culture.2
Similar neurotrophic loss may be encountered after optic nerve
transection, because RGC death under this condition can be
delayed by injecting exogenous growth factors into the vitreous.3 RGCs are also sensitive to the toxic effects of high
concentrations of excitatory amino acids such as glutamate. In
the retina, RGCs and a subset of cells in the inner nuclear layer
express subunits for the 7V-methyl-D-aspartate (NMDA) receptor. In an excitotoxic response, glutamate hyperactivates the
NMDA receptor and precipitates a Ca2+-dependent chain of
events that can lead to apoptosis or necrosis, depending on the
magnitude of the excitatory response. RGCs are exquisitely
sensitive to the effects of glutamate and the glutamate analog
NMDA, which cause a dose-dependent loss of RGCs both in
vitro and in vivo.4'5 Both neurotrophin deprivation and gluta-
From the Department of Ophthalmology and Visual Sciences,
University of Wisconsin, Madison.
Supported by grants from the American Health Assistance Foundation, Rockville, Maryland and the Retina Research Foundation, Houston, Texas; Grant 1 R29 EY12223 from the National Institutes of
Health, Bethesda, Maryland; and a Career Development Award to RWN
and an unrestricted gift to the Department of Ophthalmology and
Visual Sciences from Research to Prevent Blindness, New York, New
York. YL was the recipient of the Shaffer International Fellowship from
the Glaucoma Research Foundation, San Francisco, California.
Submitted for publication July 16, 1998; revised November 19,
1998; accepted December 21, 1998.
Proprietary interest category: N.
Reprint requests: Robert W. Nickells, Department of Ophthalmology and Visual Sciences, K6/458 CSC, University of Wisconsin, 600
Highland Avenue, Madison, WT 53792.
1005
mate toxicity have been implicated in the pathophysiology of
glaucoma.'
The genes that regulate the cell death program in RGCs
have also been studied. These studies have traditionally been
carried out on rats after axotomy of the optic nerve and entail
measuring the changes in the expression of select genes such
as bax and bcl-x.6'7 These observations are limited, however, in
that they only provide circumstantial evidence of gene function in RGCs. Ideally, the most rigorous test of function is to
genetically alter a select gene and test the effect of either the
loss-of-function or the gain-of-function of that gene after experimentally activating RGC death. Currently, the ability to alter
genes in a mammalian system is most well developed in mice.
Until recently, however, these animals have not been used to
study RGC death, in part because of the technical difficulties in
stimulating the death of these cells. The ability to use mice to
study RGC death would represent an advance in this area of
research. Here, we report the characterization of RGC death in
adult mice using two protocols that activate apoptosis via
different signaling pathways.
METHODS
Experimental Animals
The animals used in this study were handled in accordance
with the ARVO Resolution for the Use of Animals in Ophthalmic and Vision Research. All protocols were reviewed and
approved by the Research Animal Resource Center of the
University of Wisconsin. The experiments shown here were all
conducted on CB6F1 mice (an Fl hybrid generation of a
BALB/c female crossed with a C57BL/6 male) of an average age
of 4 months, weighing 20 g to 25 g. No obvious differences in
cell loss after treatment were detected in several other strains
tested (data not shown). For each surgical procedure the mice
were first anesthetized by intraperitoneal injection of 0.2 ml to
0.3 ml of solution containing ketamine (6 mg/mL) and xylazine
(0.4 mg/mL). At select time points after surgery, the mice were
killed by cervical dislocation.
Optic Nerve Crush
Mice were first anesthetized. A lateral canthotomy was made
on one eye to allow access to the posterior pole. The bulbar
conjunctiva was cut 90° in die superior temporal region and
gently peeled back to the posterior region of the globe. The
optic nerve was then exposed through a small window made
between the surrounding muscle bundles by gentle bluntdissection using a pair of watchmaker forceps. Care was taken
not to cut the muscles or the vessels in the surrounding fascia,
because this leads to excessive bleeding. At a site approximately 1 mm from the posterior pole, the nerve was clamped
using a pair of Dumont No. 5 self-closing forceps for 3 to 5
seconds. After this procedure, the conjunctiva and lateral canthotomy were closed with sutures and the mice allowed to
recover. These mice exhibited normal eating and drinking
behaviors and showed no signs of ill effects for a period of at
least 6 weeks. Operated eyes were monitored for signs of
ischemia due to damage of the central retinal artery both by
direct observation of the retinal blood vessels using a dissecting microscope and histologically after they had been killed.
Typically, an eye with a severed artery showed signs of acute
damage within 2 days after the operation. This occurred in less
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
1006
Reports
IOVS, April 1999, Vol. 40, No. 5
than 5% of the cases of partial optic nerve crush, but in 100%
of the cases of intraorbital axotomy of the optic nerve (data not
shown).
Intravitreal Injection of NMDA
Mice were first anesthetized. A small incision was made with a
30-gauge needle 0.5 mm to 1,0 mm behind the limbus in the
superior region of the globe of one eye, through the conjunctiva and sclera. For microinjcctions, a glass micropipet was
passed through this incision at a 40° to 50° angle to the
equator. In animals with dilated pupils, it was possible to view
the needle entering the vitreous. The eyes were routinely
injected with 2 /xl of solution. For NMDA injections, we prepared balanced saline solution containing 5 mM to 80 mM
NMDA (Research Biochemicals International, Natick, MA). For
control experiments, eyes were injected with balanced saline
solution alone. Only one eye of each mouse was ever injected.
Occasionally, this procedure created cataracts in mice, possibly due to damage to the lens with the micropipet. Mice that
had developed cataracts were killed and not used for analysis.
Quantification of Cell Loss in the Retinal
Ganglion Cell Layer
Experimentally induced cell loss in the retinal ganglion cell
layer (GCL) was measured from histologic sections of the
mouse retina. In each mouse, one eye was operated on leaving
the other eye for the unoperated control. At select time points
after surgery, the mice were killed and the eyes were enucleated and fixed in 100 mM phosphate buffer containing 4%
(wt/vol) paraformaldehyde and 2.5% (wt/vol) glutaraldehyde.
After fixation the retinas were removed and embedded in
glycolmethacrylate (|B4-Plus; Polysciences, Warrington, PA).
Each retina was cut into transverse sections (2-jxm thickness)
extending from the peripheral retina to the optic disc. Histologic landmarks, such as the ciliary epithelium and the edge of
the optic disc, allowed for orientation of the sections from
both eyes of each mouse for counting. Representative sections
(12-16 total for each eye) were cut from both the superior and
inferior retinas. The sections were then stained with 4,6-diamidino-2-phenylindole (DAPI; Boehringer Mannheim Biochemicals, Indianapolis, IN) to fluorescently label all the nuclei. Stained nuclei in the GCL were then counted in
photographs of 2 microscopic fields of each section corresponding to approximately 400 /u.m of retina extending from
the ciliary epithelium (peripheral retina) or from the optic disc
(central retina). To compensate for slightly oblique sections,
the number of cells in the GCL was corrected to the number of
cells in the outer nuclear layer in the same field. The amount of
cell loss was then calculated as a percentage of the cells
present in the control eye of the same individual.
In Situ Hybridization
In situ hybridization to localize Thy-1 mRNA, a DNA sequence
corresponding to the third exon of murine Thyl was amplified
by the polymerase chain reaction using sequence-specific
primers (5'-CTTGCAGGTGTCCCGAGGGC-3'J forward primer;
5-ATGGGATTCGCGCCCGAGAC-3', reverse primer) and
mouse genomic DNA as a template. These primers generated a
305-bp DNA that was blunt-end cloned into the Smal site of the
plasmid pBK-CMV (Stratagene, La Jolla, CA). Sequence analysis
confirmed both the identity and orientation of this DNA. In situ
FIGURE 1. DAPi-staLned sections of central regions of mouse retinas
showing cell loss after optic nerve crush or intravitreal injection of
NMDA. (A) Section from a control retina of a mouse 3 weeks after the
optic nerve of the fellow eye was crushed. ONL, outer nuclear layer;
INL, inner nuclear layer; GCL, ganglion cell layer. (B) Section from the
same region of the retina of an experimental eye 3 weeks after optic
nerve crush. (C) Section through the central retina of a control eye 6
days after intravitreal injection of 160 nanomoles NMDA into the fellow
eye. (D) Section through the same region of an experimental eye 6
days after injection. Both treatments cause similar percentage losses of
cells in the GCL at the times shown. Scale bar, 20 pm.
hybridization was carried out using a whole-mount procedure
described for the rat retina.7 Quantification of the number of
positive cells was determined by comparing photographs of
the DAPI-stained image with the Nomarski image of 5 to 8
sections from a minimum of two mice at each time point.
Analysis of DNA Fragmentation
Cells with fragmented DNA in histologic sections were identified by TUNEL staining. Harvested retinas were embedded in
paraffin. Sections of 4-/xm thickness along the horizontal meridian were cut and stained as described previously. To quantify the TUNEL staining, all the positive cells in each layer of the
retina of a section (6 sections per retina) were counted.
RESULTS
Cell Loss in the GCL after Optic Nerve Crush and
NMDA Injection
Optic nerve crush caused a gradual loss of the principle cell
type in the GCL, which contained large round nuclei with
prominent nucleoli consistent with the nuclear moq^hology of
RGCs in the mouse retina (Figs. 1A, IB). A consistent loss of
cells was first detected 1 week after crush and maximum loss
occurred by 3 weeks (Fig. 2A). On average, this maximum loss
was 57.8% ± 8.1% (mean ± SD, n = 6 mice) of the cells in the
GCL. No further loss was detected in eyes examined up to 6
weeks after crush (data not shown).
Intravitreal injections of NMDA caused the dose-dependent loss of the same principal population of cells in the GCL
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
IOVS, April 1999, Vol. 40, No. 5
Reports
8
10
12
Days
Days
B
FIGUKE 2. Graphic representation of cell loss in the GCL. All data are
shown as a percentage of cells in the GCL remaining in the treated eye
relative to the control fellow eye for each mouse. Each data point
represents the mean of at least four eyes ( ± SD). (A) Cell loss after
optic nerve crush. No further loss of cells was detected after 3 weeks
(data not shown). (B) Cell loss measured after intravitreal injection of
10 nanomoles NMDA (filled circles) or 160 nanomoles NMDA (open
circles'). Injection of 10 nanomoles NMDA caused virtually no cell
death, whereas maximal cell loss was measured after injection of 160
nanomoles. Intermediate doses of NMDA had proportionately intermediate effects on the kinetics of cell death (data not shown). Cell
number was also observed to increase in the GCL after longer periods
of exposure to high doses of NMDA. These additional cells did not
resemble ganglion cells and may have appeared in the GCL as a
consequence of gliosis.
(Figs. 1C, ID). Low doses of NMDA (10 nanomoles) had virtually no effect on cell number, whereas higher doses (160
nanomoles injected) rapidly stimulated cell loss (Fig. 2B). Maximum loss in the GCL occurred 6 days after injection of 160
nanomoles NMDA and averaged 72.5% ± 12.1% (n = 6) of the
cells.
Depletion of Cells in the GCL Correlates with the
Loss of Thyl mRNA
To confirm that optic nerve crush and NMDA injection caused
the death of RGCs, we also examined the loss of expression of
Thyl by in situ hybridization. Thyl is predominantly expressed
by RGCs in the retina, so it serves as a marker for these cells in
this tissue. In control retinas 67.5% ± 6.5% (n = 8) of the cells
in the GCL were Thyl-positive. By 2 weeks after optic nerve
crush, no Thy 1 -positive cells were detected in the GCL. Similarly, no Thy-1 -positive cells were detected in retinas 4 days
after injection of 160 nanomoles NMDA. Time-course experiments suggest that loss of Thy-1 mRNA precedes actual cell
death in the retina (Li Y, Schlamp CL, and Nickells RW, unpublished data). It is also noteworthy that the maximum number of cells lost after NMDA injection (72.5% ± 12.1%) closely
matched the number of Thyl-posixive cells in the control retina
(67.5% ± 6.5%).
Characteristics of Cell Death in the GCL
Dying cells resulting from optic nerve crush or NMDA injection
exhibited identical characteristics, including highly condensed
(pyknotic) nuclei, fragmentation of the cell body, and a lack of
residual debris (data not shown). Neither procedure elicited an
inflammatory response, even though NMDA injection caused
the rapid death of the majority of GCL cells.
Dying cells also exhibited DNA fragmentation as assayed by TUNEL staining (Fig. 3). Peak TUNEL staining in the
GCL occurred 2 days after injection of 160 nanomoles
NMDA and 1 week after optic nerve crush (Fig. 4). NMDA
injection also stimulated cell death in the inner nuclear
layer, although the total number of TUNEL-positive cells was
lower than in the GCL.
DISCUSSION
We adapted two protocols that stimulate RGC death in rats to
study RGC death in mice. The first method, optic nerve crush,
causes ganglion cell death possibly by blocking retrograde
transport of neurotrophic factors from the brain to the RGC
soma. In mice, this procedure causes a gradual loss of cells in
the GCL over a 3-week period, which is similar to the rate of
cell loss observed in rats after optic nerve transection.8 The
major difficulties in adapting this protocol for mice were accessing the optic nerve in the orbit without causing excessive
bleeding from damaged vessels in the fascia surrounding the
ocular muscles and damaging the RGC axons without severing
the central retinal artery. Bleeding can be avoided by using
GCL
A
— B
1007
ft,
FIGURE 3- TUNEL-stained mouse retinas after various treatments. (A) Control retina from a mouse 2 days
after intravitreal injection with 2 /xl balanced saline solution. ONL, outer nuclear layer; INL, inner nuclear
layer; GCL, ganglion cell layer. (B) Control retina treated with DNase I to nick the DNA in all the nuclei
as a positive control for TUNEL. (C) Retina harvested from an eye 1 week after optic nerve crush. A single
TUNEL-positive cell is present in the GCL. (D) Retina harvested from an eye 2 days after intravitreal
injection of 160 nanomoles NMDA. At least 7 TUNEL-positive cells are visible in the GCL. Scale bar, 20 /urn.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
1008
Reports
IOVS, April 1999, Vol. 40, No. 5
c
o
do not survive this procedure long enough to measure an effect
on RGC survival (data not shown).
In mice, the injection of NMDA causes a dose-dependent loss
of cells in the GCL, which occurs over a period of 6 days at the
highest concentration tested. As with optic nerve crush, similar
kinetics of RGC loss have been reported in rats injected with
comparable doses of NMDA.4 NMDA injection also stimulated the
death of a small number of cells in the inner nuclear layer. These
cells were situated in the proximal region of this cell layer, which
is generally populated by amacrine cells. Several different cell
types in this layer express NMDA receptor subunits, although
only amacrine cells appear to express the same subunits detected
in RGCs. In addition, biochemical and histologic evidence also
suggest that amacrine cells are adversely affected by NMDA.4 It is
also possible that some of the affected cells were displaced RGCs,
although the number of TUNEL-positive cells in this layer exceeded the number of 7frj//-positive cells identified in control
retinas (data not shown).
The characteristics of cell death stimulated by both optic
nerve crush and NMDA injection included features of apoptosis. Dying cells contained pyknotic condensed nuclei, cellular
fragmentation, and DNA fragmentation. In addition, neither
treatment resulted in the accumulation of cellular debris and
inflammation normally associated with necrosis. The observation that cells in the GCL of mice die by apoptosis is consistent
with several other studies in rats, rabbits, and primates. 1
5,
I
4-
0)
a>
'55
o
a•.
1.
UJ
z
1
2
3
4
Weeks
Acknowledgments
8
B
10 12
Days
FIGURE 4. Graphs showing the peak periods of cell death in sections
of the entire retina as a function of TUNEL staining. Each data point
represents the mean number of TUNEL-positive cells/section obtained
from 4 mice (6 sections each) (± SD). (A) Optic nerve crush showing
the results for the GCL only. No TUNEL-positive cells were detected in
other retinal layers after optic nerve crush. (B) NMDA (160 nanomoles)
injection showing the counts for both the ganglion cell layer (GCL) and
the inner nuclear layer (INL). For each treatment, maximum TUNEL
staining preceded the point of maximum cell loss.
blunt dissection to create a window in the fascia to access the
nerve. Damage to the central retinal artery can be avoided by
clamping the nerve with a pair of self-closing Dumont forceps.
This clamp is sufficient to damage axons without permanently
damaging the major blood vessels. The alternative to crushing
the optic nerve is axotomy. A complete transection of the optic
nerve in the eye orbit is impossible because the artery is still
closely apposed to the nerve at this point. Others have circumvented this problem by accessing the nerves of newborn mice
at a more posterior site using an intracranial approach. This
method proved to be unsuitable for adult mice, many of which
The authors thank Paul Kaufman and Leonard Levin of the University
of Wisconsin, Madison, for helpful discussions and critical review of
the manuscript and Soesiawati Darjatmoko for assistance with the
handling of the mice.
References
1. Nickells RW. Retinal ganglion cell death in glaucoma: the how, the
why, and the maybe./ Glaucoma. 1996;5:345-356.
2. Johnson JE, Barde Y-A, Schwab M, Thoenen H. Brain-derived
neurotrophic factor supports the survival of cultured rat retinal
ganglion cells. / Neurosci. 1986;6:3031-3038.
3. Mey J, Thanos S. Intravitreal injections of neurotrophic factors
support the survival of axotomized retinal ganglion cells in adult
rats in vivo. Brain Res. 1993;602:304-317.
4. Siliprandi R, Canella R, Carmignoto G, et al. N-methyl-D-aspartateinduced neurotoxicity in the adult rat retina. Vis Neurosci. 1992;
8:567-573.
5. Vorwerk CK, Lipton SA, Zurakowski D, Hyman BT, Sabel BA,
Dreyer EB. Chronic low-dose glutamate is toxic to retinal ganglion
cells: toxicity blocked by memantine. Invest Ophthalmol Vis Set.
1996;37:l6l8-l624.
6. Isenmann S, Wahl C, Krajewski S, Reed JC, Bahr M. Up-regulation
of Bax protein in degenerating retinal ganglion cells precedes
apoptotic cell death after optic nerve lesion in the rat. Eur JNeurosci. 1997:9:1763-1772.
7. Levin LA, Schlamp CL, Spieldoch RL, Geszvain KM, Nickells RW.
Identification of bcl-2 family genes in the rat retina. Invest Ophthalmol Vis Sci. 1997;38:2545-2553.
8. Berkelaar M, Clarke DB, Wang Y-C, Aguayo AJ. Axotomy results in
delayed death and apoptosis of retinal ganglion cells in adult rats.
J Neurosci. 1994;l4:4368-4374.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
JOVS, April 1999, Vol. 40, No. 5
Effect of Staurosporine on
Outflow Facility in Monkeys
Baohe Tian, B'Ann T. Gabelt, and
Paul L Kaufman
PURPOSE. TO determine the effect of the serine-threonine
kinase inhibitor staurosporine on outflow facility in living
monkeys.
METHODS. Total outflow facility was determined by two-
level constant pressure perfusion of the anterior chamber
bilaterally before and after intracameral infusion of staurosporine or vehicle in opposite eyes.
RESULTS. Intracameral staurosporine
dose-dependently
doubled outflow facility, with 0.1 \xM, 1 /LIM, and 10 juM
being subthreshold, effective, and maximal doses, respectively. At 50 /xM, intracameral staurosporine was less effective than 10 /xM on facility and induced corneal toxicity.
CONCLUSIONS. The broad-spectrum protein kinase inhibitor
staurosporine increases outflow facility in living monkeys,
perhaps by affecting the trabecular meshwork cytoskeleton. (Invest Ophthalmol Vis Sci. 1999;40:1009 -1011)
T
he serine-threonine kinase inhibitor H-7 (l-(5-isoquinolinylsulfonyl)-2-methylpiperazine) inhibits acto-myosin contractility and thereby leads to deterioration of the actin microfilament system and perturbation of its membrane anchorage, in
turn reducing tension at cell- cell and cell- extracellular matrix
adherens junctions in several types of cultured cells, including
human trabecular meshwork cells.1"4 H-7 also inhibits pilocarpine-induced contraction of isolated monkey ciliary muscle
strips in vitro and pupillary constriction in vivo, probably by
disrupting the actin filament network in the ciliary and iris
sphincter smooth muscle cells.5 In living monkeys, topical or
intracameral H-7 increases outflow facility and reduces intraocular pressure,3 perhaps due to similar effects on the actin
cytoskeleton of the trabecular meshwork.
The serine-threonine kinase inhibitor staurosporine depletes actin microfilament bundles in cultured rat astrocytes,6
inhibits contraction of guinea pig airway smooth muscle cells
induced by the protein kinase C activator phorbol myristate
acetate,7 and inhibits intracellular Ca2+-dependent contractions induced by various agonists in rabbit aortic strips.8 In
view of the similarity of the effects of H-7 and staurosoprine on
the actin filament network in cultured cells and on smooth
From the Department of Ophthalmology and Visual Sciences,
University of Wisconsin, Madison.
Supported by grants from the National Eye Institute (EY02698),
National Institutes of Health, Bethesda, Maryland; Glaucoma Research
Foundation, San Francisco, California; Research to Prevent Blindness,
New York, New York; and the Ocular Physiology Research & Education Foundation, Madison, Wisconsin.
Submitted for publication May 7, 1998; revised November 3, 1998;
accepted December 17, 1998.
Proprietary interest category: P, C3, C5, Ccl, Cc3, Cc4, Cc6.
Reprint requests: Paul L. Kaufman, Department of Ophthalmology
and Visual Sciences, University of Wisconsin-Madison, F4/328 CSC,
600 Highland Avenue, Madison, WI 53792-3220.
Reports
1009
muscle contraction, we determined the effect of staurosporine
on the outflow facility in living monkey eyes.
METHODS
Fourteen adult cynomolgus monkeys (Macaca fascicularis) of
both sexes, weighing 2.5 kg to 6.0 kg, were anesthetized with
intramuscular ketamine (10 mg/kg), followed by intramuscular
(35 mg/kg) or intravenous (15 mg/kg) pentobarbital-Na. Total
outflow facility was determined by two-level constant pressure
perfusion of the anterior chamber (AC) with Bariiny's solution,
using one double-branched and one single-branched needle
and correcting for internal apparatus resistance.9 Most monkeys were used in more than one protocol, had undergone
more than one prior perfusion, or both, but none within the
preceding 5 to 6 weeks; all were free of AC cells and flare. After
35 minutes of baseline facility measurement, the AC was exchanged with 2 ml of 0.1 /nM to 50 /xM staurosporine (Sigma,
St. Louis, MO) solution in one eye, vehicle (0.01% to 5%
dimethyl sulfoxide [DMSO] in Barany's solution) in the other,
for 10 to 15 minutes. The reservoirs were then immediately
filled with the corresponding solutions, closed for 45 minutes,
and reopened for 45 minutes of post-drug facility measurement. In some experiments, the monkey received two different doses on one occasion, with a higher dose (1.0 JLLM or 10
/xM) administered to the same eye following post-lower dose
(0.1 JLLM or 1.0 /xM) facility measurements. All investigations
were in accordance with University of Wisconsin and NIH
guidelines and with the ARVO Statement on the Use of Animals
in Ophthalmic and Vision Research.
RESULTS
AC exchange with 0.1 /LtM to 50 /xM staurosporine produced a
dose-dependent facility increase; 0.1 /xM was ineffective, whereas
1 /nM, 10 /LIM, and 50 /uM staurosporine increased facility by 69%
± 20% (n = 8, P < 0.02), 168% ± 48% (n = 8, P < 0.01), and
117% ± 39% (n = 4, P < 0.1), respectively, relative to baseline
and adjusted for contralateral control eye changes (Fig. 1, Table
1). The initial facility values on restarting the perfusion after die
closed reservoir waiting period were only slightly increased relative to the control eyes, but the increase was dose-dependent (Fig.
1). At 50 ju,M, corneal cloudiness and edema were present the day
after perfusion and persisted for at least several months. No
apparent corneal toxicity was observed by casual examination
under normal room light 1 day after or by slit-lamp 5 to 8 weeks
after 0.1 jixM, 1 /LtM, or 10 /xM intracamerally.
DISCUSSION
The serine-threonine kinase inhibitor staurosporine, which has
cytoskeletal effects similar to those of H-7 in cultured cells,6 also
has a similar facility-increasing effect in the living monkey eye at
concentrations (^1 jtxM) comparable to that (100 nM) reported
for cytoskeletal effects in rat astrocytes.6 Similar to H-7, the initial
facility values were only slightly elevated compared with the
ipsilateral baselines after intracameral exchange infusion of 1 /xM
or 10 |LtM staurosporine, with substantial facility elevation produced only after continued perfusion.3 Most likely, drug-induced
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
1010
IOVS, April 1999, Vol. 40, No. 5
Reports
1.3
Staurosporine
1.1
n=4
n=8
Vehicle
0.9
0.1 p.M Staurosporine
LOjiM Staurosporine
0.7-
X
0.5-
T
Hi-1!
0.3"
I
Res Closed
0.1-
a
1.2-
O
1^
I
I
I0.1 \iM Staurosporine
Res Closed
I
l.OuM Staurosporine
n=8
n=4
lOuM Staurosporine
50nM Staurosporine
9
O
0.8 H
0.6-
X^
0.4-
j.-1-
Res Closed
0.2-
Res Closed
50)iM Staurosporine
10(iM Staurosporine
10
I
30
50
70
90
110
i
130
10
30
i
BL
50
70
90
110
130
1
BL
Time (min)
FIGURE 1. Effect of intracameral exchange infusion with 0.1 JUM to 50 JU-M staurosporine on outflow
facility in monkeys. BL, Baseline; Res, Reservoir. Data are means ± SEM /xl/min per mm Hg for n animals,
each contributing one staurosporine- and one vehicle-treated eye. Difference between eyes =£0.0 by the
two-tailed paired f-test: *P < 0.1, }P < 0.05.
architectural changes within the meshwork produce only slight
resistance washout at physiological flow rates, whereas at the
higher flow rates and pressure heads during perfusion, disruption
of resistance-relevant structures and reduction of flow resistance
are more substantial.3 At 50 /xM, staurosporine produced a substantial initial facility increase, perhaps suggesting that at higher
doses the drug may render the meshwork architecture unstable
even at normal flow rates.
TABLE 1. Effect of Intracameral Staurosporine on Outflow Facility
Outflow Facility (fil/min/mm Hg)
Stau
Dose
0.1 pM in 0.01% DMSO (n = 4)
BL
Rx
Rx/BL
1.0 jaM in 0.1% DMSO (n = 8)
BL
Rx
Rx/BL
10 JU-M in 1% DMSO (n = 8)
BL
Rx
Rx/BL
50 jaM in 5% DMSO (n = 4)
BL
Rx
Rx/BL
0.30 ±
0.27 ±
0.97 ±
0.28 ±
0.50 ±
1.96 ±
0.32 ±
0.74 ±
2.26 ±
0.33 ±
0.51 ±
1.55 ±
0.09
0.07
0.05
0.05
0.08
0.25
0.05
0.18
0.33
0.06
0.10
0.14
Veh
0.29 ±
0.28 ±
0.99 ±
0.30 ±
0.33 ±
1.19 ±
0.44 ±
0.39 ±
1.00 ±
0.32 ±
0.24 ±
0.79 ±
0.09
0.08
0.04
0.05
0.04
0.12
0.08
0.08
0.20
0.07
0.04
0.15
Stau/Veh
1.04 ± 0.14
1.03 ± 0.17
0.98 ± 0.04
0.96 ±0.11
1.57 ± 0.25
1.69 ± 0.20t
0.81 ± 0.12
1.99 ± 0.43
2.68 ± 0.48*
1.05 ± 0.09
2.17 ± 0.28f
2.17 ± 0.39*
Values are means ± SEM for n animals.
Staurosporine administered by exchange perfusion; BL, baseline; Rx, post-drug facility; Stau, staurosporine-treated eye; Veh, vehicle-treated
eye; post-drug data encompasses 45 min, beginning 45 min after drug administration.
i
* P < 0.1, t P < 0.05, t P < 0.01 for ratios different from 1.0 by the two-tailed paired f-test.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017
Reports
IOVS, April 1999, Vol. 40, No. 5
The overall facility increase, relative to both ipsilateral
baseline values and contralateral vehicle-treated control eyes,
induced by 50 p,M staurosporine was no greater, and may have
been less, than that induced by 10 yM staurosporine. A similar
phenomenon was observed with cytochalasin D, l 0 where a 5X
maximal intracameral dose for increasing facility actually
caused a facility decrease in —40% of eyes. Also, because a
concentration of DMSO in the AC of 4% or greater tends to
reduce outflow facility and blunt resistance washout,'' the 5%
concentration likely caused the trend toward reduction of
facility in the control eyes, and presumably in the drug-treated
eyes as well, for 50 /AM staurosporine. Staurosporine at 50 JLLM
produced corneal cloudness and edema, perhaps suggesting
separation of corneal endothelial cells and elevation of corneal
endothelium permeability. However, 1 JXM and 10 ju,M staurosporine significantly increased facility without corneal toxicity
apparent to gross observation. Studies involving multiple
doses, more sensitive measurements of corneal structure and
function, and older animals are needed.
Preliminary ultrastructural studies indicate that administration of H-7 into monkey eyes induces generalized relaxation and
apparent expansion of the trabecular meshwork and Schlemm's
canal (Sabanai I, Gabelt B, Tian B, Kaufman P, and Geiger B,
unpublished data, August 1998). This, in conjunction with data
showing that H-7 relaxes human trabecular meshwork cells in
culture, 12 suggests that H-7 may affect facility by inhibiting cell
contractility, leading to "relaxation" of the trabecular outflow
pathway and expansion of the draining surface, and thus allowing
more extensive flow through the meshwork. Although staurosporine has somewhat different specificities than H-7,13'14 both
are relatively broad serine-threonine protein kinase inhibitors and
have similar cytoskeletal and physiological effects in cultured cells
and smooth muscles, and on outflow facility in living monkeys.
Nonetheless, further physiological and morphologic studies are
needed to clarify the mechanisms by which these and related
compounds affect outflow facility.
References
1. Birrell GB, Hedberg KK, Habliston DL, Griffith OH. Protein kinase
C inhibitor H-7 alters the actin cytoskeleton of cultured cells.y Cell
Physiol. 1989;l4l:74-84.
Mechanism of Exercise-Induced
Ocular Hypotension
Bruce Martin? Alon Harris,2 Ted Hammel,1 and
Vic Malinovsky5
PURPOSE. Although acute dynamic exercise reduces intraocular pressure (IOP), the factors that provoke this response
remain ill-defined. To determine whether changes in colloid
osmotic pressure (COP) cause the IOP changes during exercise, standardized exercise was performed after dehydration
and hydration with isosmotic fluid.
METHODS. Progressive cycle ergometer exercise to volitional exhaustion was performed after 4 hours' dehydration, and after hydration with 946 ml isosmotic liquid (345
1011
2. Volberg T, Geiger B, Citi S, Bershadsky AD. Effect of protein kinase
inhibitor H-7 on the contractility, integrity, and membrane anchorage of the microfilament system. Cell Motil Cytoskel, 1994;29:321338.
3. Tian B, Kaufman PL, Volberg T, Gabelt BT, Geiger B. H-7 disrupts
the actin cytoskeleton and increases outflow facility. Arch Ophthalmol. 1998; 116:633-643.
4. Liu X, Glasser A, Croft MA, Polansky JR, Fauss DJ, Kaufman PL.
Effect of H-7 on cultured human trabecular meshwork (HTM) cells
[ARVO Abstract]. Invest Ophthalmol Vis Set. 1998;39(4):S705.
Abstract nr 3235.
5. Tian B, Millar C, Kaufman PL, Bershadsky A, Becker E, Geiger B.
H-7 effects on the iris and ciliary muscle in monkeys. Arch Ophthalmol. 1998;116:1070-1077.
6. Mobley PL, Hedberg K, Bonin L, Chen B, Griffith OH. Decreased
phosphorylation of four 20-kDa proteins precedes staurosporineinduced disruption of the actin/myosin cytoskeleton in nit astrocytes. Exp Cell Res. 1994;2l4:55-66.
7. Souhrada M, Souhrada JF. Inhibitor)' effect of staurosporine on
protein kinase C stimulation of airway smooth muscle cells. Am
Rev Respir Dis. 1993; 148:425- 430.
8. Sasaki Y, Seto M, Komatsu K, Omura S. Staurosporine, a protein
kinase inhibitor, attenuates intracellular Ca (2+)-dependent contractions of strips of rabbit aorta. EurJPharmacol. 1991 ;202:367372.
9. Baniny EH. Simultaneous measurement of changing intraocular
pressure and outflow facility in the vervet monkey by constant
pressure infusion. Invest Ophthalmol, 1964;3:135-l43.
10. Kaufman PL, Erickson KA. Cytochalasin B and D dose-outflow
facility response relationships in the cynomolgus monkey. Invest
Ophthalmol Vis Sci. 1982;23:646-650.
11. Kiland JA, Peterson JA, Gabelt BT, Kaufman PL. Effect of DMSO
and exchange volume on outflow resistance washout and response to pilocarpine during anterior chamber perfusion in monkeys. Curr Eye Res. 1997;l6:1215-1221.
12. Gills JP, Roberts BC, Epstein DL. Microtubule disruption leads to
cellular contraction in human trabecular meshwork cells. Invest
Ophthalmol Vis Sci, 1998;39:653-658.
13- Takagi A, Yamada Mizutani M, Tomioka N, Itai A. Inhibition mechanisms of staurosporine and H7 to cAMP-dependent protein kinase
through docking study. Chem Pharm Bull. 1996;44:6l8-620.
14. Cagnoli CM, Kharlamov E, Atabay C, Uz T, Manev H. Apoptosis
induced in neuronal cultures by either the phosphatase inhibitor
okadaic acid or the kinase inhibitor staurosporine is attenuated by
isoquinolinesulfonamides H-7, H-8, and H-9. /Mol Neurosci. 1996;
7:65-76.
mOsM). In each experiment, venous blood taken before
and immediately after exercise was analyzed for hematocrit, plasma protein concentration, total plasma osmolality, and plasma COP.
RESULTS. Exercise in both experiments significantly reduced IOP and elevated COP (each P < 0.01). Dehydration, compared with hydration, also significantly reduced
IOP and elevated COP, when measured before and after
exercise (P < 0.05). The correlation of mean IOP with
mean COP, over the entire range created by varying exercise and hydration statuses, was statistically significant
(r = -0.99; P < 0.001). In contrast, other indexes of
hydration status, including hematocrit, total plasma osmolality, and plasma protein concentration, failed to change
as IOP changed and failed to correlate with IOP, on either
a group or individual basis, in conditions of varying levels
of exercise and hydration.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933211/ on 08/12/2017