Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 A Supplemental Figure 1 170 N O + HO H+ N + H O N Pr O O O Pr M+ B O Pr N H O O HN Pr O O O Lys Pr M+ C HN 156 + O H+ N Pro Pr O HN +O O O O Pr M+ D Pr H N O O O HN O O O Pr Orn Pr M+ E authentic Pip Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 1. Mass spectral identification of the initially unknown substance detected in extracts of P. syringae-inoculated plants as pipecolic acid. (A) Mass spectrum of the unknown substance after derivatization with propyl chloroformate converting amino groups into propyl carbamate and carboxyl groups into propyl ester derivatives. The mass spectrum was not present in our mass spectral library containing 45 standard amino acids and amines. Containing the fragment series m/z 198, 170, 128, and 84, the spectrum showed similarities to the spectrum of the lysine derivative (B). Moreover, the m/z 257 ion appeared to be the molecular ion (M+) of the unknown substance. We recognized that a homologous relationship existed to the spectrum of the proline derivative (C) in a way that each of the fragments m/z 257 (M+), 198, 170, 128, and 84 of the unknown substance spectrum (A) was replaced by a fragment reduced by 14 mass units: m/z 243 (M+), 184, 156, 114, and 72, respectively (C). The spectra of the derivatives of lysine (“homoornithine”) (B) and ornithine (D) exhibited a similar 14 mass unit fragment shift, which is consistent with the presence of an additional methylene group in lysine compared to ornithine. These observations and deduced structures of fragment ions (A, C) were consistent with the assumption that the unknown compound is pipecolic acid (homoproline), the methylene homologue of proline. (E) Authentic pipecolic acid yielded an identical mass spectrum than the extracted substance (A) after propyl chloroformate derivatization. Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 2 Supplemental Figure 2. The plant-derived substance identified as Pip and authentic Pip have identical GC retention times. Overlay of GC ion chromatograms (m/z 158, before t = 10.6 min; m/z 170 after t = 10.6 min) derived from a pure plant extract sample (blue) and the same sample supplemented with 5 ng of authentic Pip demonstrate co-elution of extract peak and authentic Pip standard (retention time = 11.5 min). Note that NorVal (m/z 158, retention time = 10.4 min), which is used as an internal standard and was added to the plant extract before the work-up procedure, has similar abundance in the supplemented and original sample. Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 3 H 2N CO2H Lys NH2 aminotransferase H2N CO2H lysine ketoglutarate reductase LKR/SDH -ketoglutarate CO2H HO2C HN CO2H NH2 saccharopine dehydrogenase Glu LKR/SDH -amino--keto caproic acid O CO2H -amino adipic semialdehyde NH O 2 dehydrogenation sarcosine oxidase reduction HO2C N saccharopine CO2H 1-piperideine- 2-carboxylic acid N H CO2H pipecolic acid (Pip) N CO2H 1-piperideine- 6-carboxylic acid CO2H NH2 -aminoadipic acid (Aad) Supplemental Figure 3. Proposed scheme for pathogen-inducible Pip and Aad biosynthesis in plants via lysine catabolism. The scheme is based on earlier (e.g. Galili et al., 2001; Gupta and Spenser, 1969; Song et al., 2004b; Goyer et al., 2004) and present findings (e.g. Fig. 3). Our presented findings demonstrate that the lysine aminotransferase ALD1 mediates pathogen-induced pipecolic acid biosynthesis. Whether -amino--ketocaproic acid and/or 1-piperideine-2-carboxylic acid are direct reaction products of an ALD1-catalysed transamination reaction still needs experimental verification. Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 4 A ** 40 1° leaves, 1 dpi 30 Pip (µg g-1 FW) MgCl2 ** 35 *** 25 Psm avrRpm1 *** 20 15 * 10 ••• 5 0 °° ••• Col-0 B ald1 6,0 fmo1 ics1 pad4 ** *** 5,0 Pip (µg g-1 FW) 2° leaves, 2 dpi npr1 4,0 3,0 2,0 1,0 0,0 treatment of 1° leaves MgCl2 Psm Psm avrRpm1 Supplemental Figure 4. Psm avrRpm1-induced Pip accumulation in inoculated and distal leaves. (A) Accumulation of Pip in Psm avrRpm1-inoculated leaves of wild-type Col-0 and different defense mutant plants at 1 dpi. Details as described in the legend to Fig. 2. (B) Pip accumulation in upper (2°) leaves following inoculation of lower (1°) leaves with Psm or Psm avrRpm1 at 2 dpi. Details as described in the legend to Fig. 3. Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 5 * MgCl2 Psm E 1,2 0,4 0,2 25 20 15 10 5 0 MgCl2 Psm * 3,0 2,5 2,0 1,5 1,0 0,0 H G 0,6 F JA (ng ml -1 leaf-1) 0,4 0,3 0,2 0,1 1,4 1,2 1,0 0,8 0,6 0,4 0,0 MgCl2 Psm I 1,6 MgCl2 Psm 3,5 3,0 1,2 1,0 0,8 0,6 0,4 0,0 * 1,8 0,2 2,5 2,0 1,5 1,0 0,5 0,2 MgCl2 Psm MgCl2 Psm 1,6 1,4 0,5 AZA (ng ml -1 leaf-1) *** 30 0,5 MgCl2 Psm ** 35 MeSA (ng ml -1 leaf-1) SAG (ng ml -1 leaf-1) SA (ng ml -1 leaf-1) 0,6 45 40 3,5 0,8 0,0 C 4,0 1,0 0,0 50 45 40 35 30 25 20 15 10 5 0 Phe (ng ml -1 leaf-1) B Camalexin (ng ml -1 leaf-1) D 1,0 0,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0,0 Lys (ng ml -1 leaf-1) Aad (ng ml -1 leaf-1) A MgCl2 Psm 0,0 MgCl2 Psm Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 5. Metabolite levels in petiole exudates of leaves collected between 6 to 48 h post Psm- or MgCl2-treatment. Mean values are given in ng ml-1 exudate leaf-1 ± SD from at least three replicate samples. Asterisks denote statistically significant differences between P. syringae- and MgCl2samples (***: P < 0.001; **: P < 0.01; *: P < 0.05; two-tailed t test). The corresponding values for Pip are depicted in Fig. 3D. (A) -Amino adipic acid (Aad). (B) Lysine. (C) Phenylalanine. (D) Free salicylic acid (SA). (E) Conjugated salicylic acid (SAG). (F) Methyl salicylate (MeSA). (G) Azelaic acid (AZA). (H) Jasmonic acid (JA). (I) Camalexin. Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 6 B A 200 MgCl2 Psm *** 25 Relative LKR expression Relative ALD1 expression 250 *** 150 *** 100 50 0 C MgCl2 Psm *** 20 15 *** 10 *** 5 0 Col-0 ald1 lkr-1 Col-0 lkr-2 ald1 lkr-1 lkr-2 6 Relative ALD1 expression in 2° leaves * 5 1° leaves: MgCl2 1° leaves: Psm 4 3 2 1 0 Col-0 fmo1 ald1 Supplemental Figure 6. Pathogen-induced ALD1 and LKR expression in wild-type Col-0 and different mutant plants. (A) and (B) Psm-induced ALD1 (A) and LKR (B) expression in inoculated leaves of Col-0, ald1, lkr-1 and lkr-2 plants at 24 hpi. (C) Relative expression of ALD1 in upper (2°) leaves upon Psm-inoculation of lower (1°) leaves (2 dpi). Transcript levels were assessed and data analyses were performed as described in the legend to Fig. 4A. Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 7 A B Soil application H 2O ** 12 Soil application ** 10 µmol Pip 2,5 *** 6 4 2 Col-0 1,8 2,0 • 1,5 *** 1,0 0,5 °° 0,0 ald1 *** Col-0 ald1 Soil application 1,6 Leaf content (µg g-1 FW) 10 µmol Pip ° 0 C Aad leaf content (µg g-1 FW) Pip leaf content (µg g-1 FW) 10 8 H 2O 1,4 H 2O 1,2 10 µmol Aad 1,0 0,8 0,6 0,4 0,2 0,0 Aad Pip D Leaf content (µg g-1 FW) 250 *** 8 7 * *** 16 H 2O 6 200 150 4 8 3 100 2 50 * 1 0 4 0 0 BABA 10 µmol BABA 12 5 Pip Aad Soil application Lys Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 7. Metabolite levels in leaves following Pip, Aad, and -amino butyric acid (BABA) application via the root in Col-0 and ald1 plants. (A) and (B) Exogenous pipecolic acid supplied via the root is transported to the shoot and leads to an enhancement of Aad levels. Leaf contents of Pip (A) and Aad (B) in Col-0 and ald1 plants one day after supplying 10 µmol Pip via the roots (as outlined in Fig. 5). (C) Leaf contents of Aad and Pip in Col-0 plants one day after supplying 10 µmol Aad via the roots. (D) BABA treatment induces Pip accumulation in Col-0 plants. Leaf contents of BABA, Pip, Aad, and Lys one day after supplying plant pots with 10 µmol BABA. Mean values are given in µg g-1 fresh weight (FW) ± SD from at least three replicate samples. Asterisks denote statistically significant differences between samples from Pip-, Aad-, or BABA-fed and non-fed control plants (***: P < 0.001; **: P < 0.01; *: P < 0.05, twotailed t test). In (A) and (B), open (closed) circles indicate statistically significant differences of a H2O- (Pip-) supplied ald1 sample to the H2O- (Pip-) supplied wild-type sample (twotailed t test). Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 A *** 1000 Supplemental Figure 8 B H 2O Pip 100 10 1 root application Psm (cfu cm-2 * 10-4) Bacterial numbers 3 dpi Psm (cfu cm-2 * 10-4) Bacterial numbers 3 dpi 5000 *** 1000 *** 500 *** 100 10 µmol Pip leaf infiltration 0 0.1 *** 100 10 1000 5 µmol a Psm (cfu cm-2 * 10-4) Bacterial numbers 3 dpi b c 100 10 1 H 2O Pip Aad 1 10 ** ** s: H2O; 1°: MgCl2 s: Pip; 1°: MgCl2 s: H2O; 1°: Psm avrRpm1 s: Pip; 1°: Psm avrRpm1 100 10 1 H2O D,L-Pip D-Pip L-Pip 0.1 ald1 * Psm (cfu cm-2 * 10-4) 1000 Bacterial numbers 3 dpi Psm (cfu cm-2 * 10-4) Bacterial numbers 3 dpi 1000 10 µmol 0 ** *** 5000 E 10 ns D *** 1 Col-0 C 500 *** Col-0 ald1 Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 8. Concentration dependency of resistance induction by exogenous pipecolic acid, resistance-enhancing activity of L- but not D-Pip, and chemical complementation of ald1 defects in Psm avrRpm1-induced SAR by exogenous Pip. (A) Leaf resistance to Psm after application of 1 mM Pip via the root (as outlined in Fig. 5) or after infiltration into leaves. Bacterial inoculation was performed one day after Pip treatment. (B) Concentration dependency of resistance induction by exogenous pipecolic acid in Col-0 and ald1 plants. Plant pots were supplied with different amounts of D,L-Pip one day prior to inoculation. Experimental details were as outlined in the legend to Fig. 5. Asterisks denote statistically significant differences relative to the water control within each genotype (***: P < 0.001; two-tailed t test). (C) Resistance-enhancing activity of L- but not D-Pip. Indicated amounts of racemic D,L-Pip, D-Pip, or L-Pip were fed to plants one day prior to Psm inoculation, and bacterial numbers were scored at 3 dpi. Details as described in the legend to Fig. 5. Asterisks denote statistically significant differences relative to the water control (***: P < 0.001; two-tailed t test). (D) Psm growth in upper leaves following SAR induction by Psm avrRpm1 in lower leaves one day after exogenous Pip or water treatments via the root. Experimental details were as described in Fig. 6A, except that incompatible Psm avrRpm1 instead of compatible Psm was used as the SAR-inducing pathogen. (E) Col-0 resistance to Psm upon root application of water, 5 µmol L-Pip or 5 µmol L-Aad. Details as described in the legend to Fig. 5. Different letters above the bars denote statistically significant differences between pairwise compared samples (P < 0.05, twotailed t test). Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Figure 9 A *** Pip (µg g-1 FW) 20 18 H 2O 16 SA 14 12 10 8 6 4 * 2 0 8 hpi 24 hpi Psm 24 hpi B 4,0 H 2O 4500 SA Relative PR-1 expression Relative ALD1 expression 4,5 3,5 3,0 2,5 ** 2,0 1,5 1,0 0,5 ** *** H 2O SA 4000 3500 3000 2500 2000 1500 1000 500 0,0 0 4 hpi 24 hpi 4 hpi 24 hpi Supplemental Figure 9. Effect of exogenous SA on leaf Pip levels, ALD1-transcript levels, and PR-1-transcript levels. (A) Pip levels in leaves at indicated times after infiltration with water, 0.5 mM SA, or a suspension of Psm (OD 0.005). Details as indicated in the legend to Fig. 2. (B) Relative expression of ALD1 and PR-1 in Col-0 leaves at indicated times after infiltration with water or 0.5 mM SA. Transcript levels were assessed and data analyses were performed as described in the legend to Fig. 4A. Supplemental Data. Návarová et al. (2012). Plant Cell 10.1105/tpc.111.103564 Supplemental Table 1 Primer name ald1‐fw ald1‐rv lkr‐1‐fw lkr‐1‐rv lkr‐2‐fw lkr‐2‐rv ALD1‐FW ALD1‐RV LKR‐FW LKR‐RV FMO1‐FW FMO1‐RV PR‐1‐FW PR‐1‐RV PTB‐FW PTB‐RV Primer sequence (5’ to 3’) TTACGATGCATTTGCTATGACC TTTTAAATGGAACGCAAGGAG TCATTCTGCCTTCTCCATCAG AGCAACAACGATATTTCGTGG CGCTTCGATCATATCAAGAGC CCCCTATGACTTTCTGTGCAG GTGCAAGATCCTACCTTCCCGGC CGGTCCTTGGGGTCATAGCCAGA CATGTTGATGGGAAGAATCTC AATATCGTTGTTGCTTCGCT TCTTCTGCGTGCCGTAGTTTC CGCCATTTGACAAGAAGCATAG GTGCTCTTGTTCTTCCCTCG GCCTGGTTGTGAACCCTTAG GATCTGAATGTTAAGGCTTTTAGCG GGCTTAGATCAGGAAGTGTATAGTCTCTG Supplemental Table 1. Primers used in this study. Usage Genotyping of T‐DNA lines Genotyping of T‐DNA lines Genotyping of T‐DNA lines Genotyping of T‐DNA lines Genotyping of T‐DNA lines Genotyping of T‐DNA lines qRT‐PCR qRT‐PCR qRT‐PCR qRT‐PCR qRT‐PCR qRT‐PCR qRT‐PCR qRT‐PCR qRT‐PCR; reference gene qRT‐PCR; reference gene