Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Product Specifications Human LVX-ZsGreen lentiviral pooled shRNA-mir screening library Viral particles The pooled shRNA screening library includes high titer viral particles and primers for the primary PCR. The viral particles are ready to screen. The primers can be used to amplify the shRNA-mir sequence from genomic DNA extracted from cells transduced with the constructs from the screening library. Note: The Pooled Screening NGS Illumina Platform Primer kit (TRP0001) may be purchased to adapt the primary PCR product for analysis using the Illumina NGS platform. Kit components: The following viral particles are included: Plasmid Pooled shRNA screening library Non-targeting control #1 The following oligonucleotides are included: Primer Primary PCR Forward primer Primary PCR Reverse primer Primer sequence Primary PCR Forward Primary PCR Reverse Amount (TU/ml) 50 µl at > 108 25 µl at > 108 Concentration (µM) Volume (µl) 10 2 x 400 10 2 x 400 5’ CAGAATCGTTGCCTGCACATCTTGGAAAC 3’ 5’ CTGCTAAAGCGCATGCTCCAGACTGC 3’ Shipping and Storage Primers are shipped dry ice. Viral particles should be stored at -80°C. Primers may be stored at -20°C. Contact Information Technical support: 866.833.0712 or contact us at [email protected] ©transOMIC technologies, inc. All rights reserved. All other trademarks are the property of transOMIC technologies, inc. For Research Use Only.