Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
SUPPLEMENTAY FIGURES Phosphate starvation induced OsPHR4 mediates the PiSignaling and Homeostasis in Rice Wenyuan Ruan1§, Meina Guo1§, Ping Wu2, Keke Yi1 * Author affiliation: 1Key Laboratory of Plant Nutrition and Fertilizer, Ministry of Agriculture, Institute of Agricultural Resources and Regional Planning, Chinese 2 College of Life Science, Zhejiang University. §Wenyuan Ruan and Meina Guo contributed equally to this work. *To whom correspondence should be addressed: [email protected] E-mail of all authors: Wenyuan Ruan ([email protected]) Meina Guo ([email protected]) Ping Wu ([email protected]) Keke Yi ([email protected]) Fig. S1 Amino acid sequence comparison of OsPHR1, OsPHR2, OsPHR3, and OsPHR4 The PHR1-subfamily members in rice have conserve MYB DNA binding domain (indicated by red box) and colied-coli (CC) (indicated by green box) domain. The two conserved domain are located on the protein C-term. 1.5 Root Shoot 1.0 0.5 +P -P PHR1 PHR2 PHR3 PHR4 PHR1 PHR2 PHR3 PHR4 0.0 PHR1 PHR2 PHR3 PHR4 PHR1 PHR2 PHR3 PHR4 Relative expression level (PHR2, 3 and 4 vs PHR1) 2.0 +P -P Figure S2 Related mRNA levels of OsPHR1-4 genes (OsPHR1 set as 1) Two-week-old plants grown in Pi-sufficient (200 μM Pi) solution were transferred to Pi-sufficient or Pi-lacking solution for other 7d; RNA from roots and shoots were isolated separately. qRT-PCR was performed using specific primers (Supplemental Table S1) for OsPHR1, 2, 3 and 4. Values represent means ±SD of three replicates. Fig. S3 Nucleotide aliment of OsPHR1, OsPHR2, OsPHR3, and OsPHR4 DNA homology analysis indicated that there is no homology on the 5’ term for the four OsPHRs . Therefore the sequence from 4bp to 207bp of OsPHR4 was chosen as the target for RNA interfering design. Relative mRNA expression 30 WT 25 PHR4-Ri-5 20 PHR4-Ri-11 PHR4-OE-9 15 PHR4-OE-14 10 2.0 1.5 1.0 0.5 Sh o R ot oo Sh t o R ot oo Sh t o R ot oo Sh t o R ot oo Sh t o R ot oo t 0.0 Figure S4 The relative expression levels of OsPHR4 in RNAi and overexpressors The plants of WT, PHR4-Ri and PHR4-OE grown in Pi-sufficient (200 μM Pi) solution for three-week before RNA isolation. qRT-PCR was performed using specific primers (Supplemental Table S1) for OsPHR4. Values represent means ±SD of three replicates. Relative mRNA expression level 1.5 WT PHR4-Ri-5 PHR4-Ri-11 1.0 0.5 0.0 OsPHR1 OsPHR2 OsPHR3 Fig S5 Knock down of OsPHR4 does not affect the expression of OsPHR1-3 The plants of WT, PHR4-Ri-5 and PHR4-Ri-11 grown in Pi-sufficient (200 μM Pi) solution for three-week before RNA isolation. qRT-PCR was performed using specific primers (Supplemental Table S1) for OsPHR1, 2, and 3. Values represent means ±SD of three replicates. Table S1 Primers used in this study Usage qRT-PCR primers Over expression primers GUS fusion primers Primers (enzyme site) Sequences ( 5’ to 3’) OsACTIN-RT-F OsACTIN-RT-R OsIPS1-RT-F OsIPS1-RT-R OsmiR827-RT-F OsmiR827-RT-R OsPT2-RT-F OsPT2-RT-R OsPHR1-RT-F ATCCTGACGGAGCGTGGTT CCAGGGCGATGTAGGAAAGC TTGGCAATTATTCGGTGGAT ACCATTTCACCATCCTCTTTATG GCCCTGGATATGTTTTAGTAC GGGTGAAAATGTATTGTCGAT CACAAACTTCCTCGGTATGCT GAAACCCCACAAATCCACAAC CCAAGAGCCAGTGTTGTCAGA OsPHR1-RT-R OsPHR2-RT-F GAGAAATAAAGGGAGCAGCCAT CGCTTTGTAGATGCTGTCAATC OsPHR2-RT-R OsPHR3-RT-F OsPHR3-RT-R OsPT10-RT-F OsPT10-RT-R OsIPS2-RT-F AGACCCTCATCACATCCTCATTATC GCAGAAACCTCTTCAGCACCTT ATGATTATTCGTCATGCACCATT GAGCTCGCACCTCAGCAT GAGTTCACTCACACGGAGACC CCT TCTTCTGGATTCCTCTC OsIPS2-RT-R OsPHR4-RT-F OsPHR4-RT-R OsSPX1-RT-F OsSPX1-RT-R AGTTCACCACAAAAGATACAGTAG TACCATTCCTGCCTCACCCT GCCAATATCACCATCACCACC GAAGTTTGGGAAGAGCCTGAGT TGTAGTTGAGGGCGCTGTAGTT OsPHO2-RT-F Os PHO2-RT-R ACAATGCTACAAGTCCTGGTCTCAGTTC GCAGCTCTTGTCGCCCTCATC OsPHR4-Ov-F (KpnI) CGGGGTACCATGAGCTCCCAGAGTGTTGT OsPHR4-Ov-R (XhoI) CCGCTCGAGCTATGAACACTGGTGCTCATC OsPHR4-P-GUS-F(BamHI) CGCGGATCCTTTGTAGCCTGCTGAACTAATC OsPHR4-P-GUS-R(KpnI) CGGGGTACCGCTGGTTCAGTTGATTGATGG Yeast-one or two hybrids fusion to pB42AD primers OsPHR4-y1-AD-F(EcoRI) CCGGAATTCATGAGCTCCCAGAGTGTTGT OsPHR4-y1-AD-R(XhoI) CCGCTCGAGCTATGAACACTGGTGCTCATC Yeast-one hybrids fusion to pLacZ2u primers OsPHR4-P-F(KpnI) CGGGGTACCGAGGGACCTTAACTCTCTCCT OsPHR4-P -R(XhoI) CCGCTCGAGGCTGGTTCAGTTGATTGATGG OsPHR4 fusion to pGX4T-1 primers OsPHR4-GST-F(EcoRI) CCGGAATTCATGAGCTCCCAGAGTGTTGT OsPHR3-GST-R(XhoI) OsPHR4-probe-F OsPHR4-probe-R CCGCTCGAGCTATGAACACTGGTGCTCATC GAATATCTGATGCTGTGAAT TTTTGGAGAAATTTCCCGTC EMSA probe primers