Download Supplementary Data

Supplementary Figures and Methods
The Essential Role of PBX1, a Stem Cell Reprogramming Factor, in Ovarian Cancer
Chemoresistance
Jin-Gyoung Jung, Ie-Ming Shih, Joon Tae Park, Emily Gerry, Tae Hoen Kim, Ayse Ayhan,
Karen Handschuh, Ben Davidson, Amanda Nickels Fader, Licia Selleri, and Tian-Li Wang
Supplementary Fig. S1. Comparison between the PBX1-regulated transcriptome
identified in ovarian cancer cells and ES cell gene signature. (A) Similarities between geneexpression signatures of key ES cell factors and genes regulated by PBX1 in ovarian cancer
were assessed by Ben-Porath Method and Gene Set Enrichment Analysis (GSEA). NES:
normalized enrichment score. (B) Representative enrichment plots of ES cell gene signatures in
the PBX1-regualted transcriptome identified in the OVCAR3 cells by siRNA-mediated silencing.
Supplementary Fig. S2. PBX1 expression levels in ovarian cancer cells and PBX1
antibody specificity analysis. (A) Western blot analysis for endogenous PBX1, SOX2, and
MYC expression in ovarian cancer cell lines, SKOV3 and OVCAR3. GAPDH was used as a
loading control. (B) PBX1 protein expression assessed by immunohistochemical analysis of
formalin-fixed paraffin-embedded OVCAR3 and SKOV3 cell blocks.
Supplementary Fig. S3. Chemoresistant ovarian cancer cell lines exhibit enhanced CSC
phonotypes. (A) Carboplatin-resistant (CR) ovarian cancer cells were established by
incubating parental cells in medium containing 10 µM carboplatin for 3-6 months. Western blot
analysis of PBX1, MEOX1, and ALDH1A expression levels in pairs of parental and CR ovarian
cancer cell lines. GAPDH was used as a loading control. (B) Spheroid-forming assay in parental
and CR cells. Representative photos were taken on day 3, 6, and 9. Spheroid sizes were
digitally determined and normalized to the size measured on day 3. Data are presented as
mean ± SD (Student’s t test, *p<0.05, **p<0.01). (C) Representative flow cytometry plots of
Hoechst 33342-stained cells. Cells were incubated with Hoechst 33342, in the presence or
absence of verapamil, an inhibitor of the ATP-binding cassette (ABC) transporters, and
analyzed by flow cytometry using an ultraviolet laser. A small population of cells with side
population (SP) characteristics is shown in the gated area. This population is largely lost in the
presence of verapamil. (D) Representative flow cytometry plots of cells with differential ALDH
activity. Cells were incubated with ALDEFLUOR substrate. An aliquot of cells was treated with
an ALDH inhibitor, DEAB, to establish the baseline fluorescence level in the negative cell
population. Incubation of cells with ALDEFLUOR substrate in the absence of DEAB induces a
shift in BAAA fluorescence that defines the ALDHhigh population, which is shown as a
percentage of total cells counted. (E) Quantification of SP and ALDHhigh populations in parental
and CR cells.
Supplementary Fig. S4. The expression level of PBX1 in ALDHhigh/low cell populations
treated with carboplatin. (A) Schematic illustration of experimental design and procedure.
IOSE-80pc and Hey cells were treated with 10µM of carboplatin or DMSO for 7 days, and cells
were stained with ALDHFLUOR with or without an ALDH inhibitor, DEAB, to establish the base
line. Each of ten thousands of ALDHhigh and ALDHlow cells was sorted by FACSAria Ilu Cell
Sorter. (B) Expression level of PBX1 in ALDHhigh and ALDHlow IOSE-80pc and Hey cells.
Relative PBX1 mRNA expression was calculated by normalizing Ct value to mean GAPDH Ct
value in each sample. Level of significance was determined by two-tailed Student’s t-test;
*p<0.05, **p<0.01, N.S., not significant.
Supplementary Fig. S5. Co-expression analysis of PBX1 and its target genes using the
TCGA ovarian cancer datasets. (A) Analysis of transcript co-expression between PBX1 and
its direct target genes in the TCGA ovarian cancer data set, which consists of primary (n=569)
and recurrent (n=17) ovarian high-grade serous carcinomas. PBX1 expression significantly
correlated with expression of NOTCH3, MEIS1, and RXRB in recurrent (post-chemotherapy)
tumors. (B) Scatterplot of pairwise expression levels of PBX1 and NOTCH3 in primary (n = 569)
and recurrent (n = 17) tumors. Each point represents ranked order of expression value of PBX1
and NOTCH3 in each sample. Spearman rank correlation analysis was performed; r represents
correlation coefficient, two-sided Student’s t-test.
Supplementary Fig. S6. Expression of PBX1 and its downstream target genes in cells
with ectopic expression of PBX1. Expression levels of each gene in PBX1-transfected or
vector control-transfected cells were measured by qRT-PCR. Relative mRNA expression was
calculated by normalizing mean Ct value of each gene to mean GAPDH Ct value in individual
sample. Fold change was calculated as 2-ΔCt and was subsequently log-transformed and
presented via a color-coded Heatmap. Level of significance was determined by two-way
ANOVA; *p<0.05, **p<0.01, ***p<0.001.
Supplementary Methods
Cell Viability Assay
Cells were seeded at a density of 3,000 cells per well in 96-well plates and incubated at 37°C
overnight. Various concentrations of carboplatin (Sigma-Aldrich) were added to each well and
incubated for 72 hr. Viability of cells was determined by CellTiter-Blue Cell Viability Assay
(Promega) using a microplate reader (POLARstar Omega, BMG, Durham, NC). Experiments
were repeated at least three times, and data are presented as the mean of six replicate wells +
SD. The IC50 value was calculated by using GraphPad Prism software (GraphPad Software Inc.
La Jolla, CA).
Immunohistochemistry
Immunohistochemical analysis was performed using a PBX1 antibody (cat # 4342; Cell
Signaling). The antibody specificity was verified by Western blot or immunohistochemical
analysis of paraffin sections of control ovarian cancer cell lines with known expression or nonexpression of the tested genes (Supplementary Figure 2). Tissue microarray sections, including
microarrays containing 41 paired primary and recurrent ovarian serous carcinoma tissues in
triplicated cores, were deparaffinized in xylene. Antigen retrieval was performed using Target
Retrieval Solution, pH 6.1 (DAKO, Carpinteria, CA). Immunostaining was performed using an
EnVision+System peroxidase kit (DAKO) according to the manufacturer’s protocol. Slides were
counter-stained with hematoxylin and coverslipped using Cytoseal (Thermo Scientific). Since
PBX1 nuclear immunoreactivity is positive in all tumor cells, immunostaining was scored based
on intensity level (0: none; 1+: weak; 2: moderate; 3+: strong).
Western Blot Analysis
Ovarian cancer cells were lysed using ice-cold RIPA buffer with freshly added 1 × Halt protease
inhibitor cocktail (Thermo Scientific, Waltham, MA). Lysates were centrifuged at 14,000 rpm for
15 min at 4°C, and the supernatants (40 µg protein) were separated by 4-12 % SDS-PAGE and
transferred onto PVDF membranes using a semi-dry apparatus (Bio-Rad, Hercules, CA).
Membranes were blocked with 2 % non-fat dry milk or with 5 % bovine serum albumin (BSA) in
TBST (20 mM Tris-HCl, 0.5 M NaCl, 0.1 % Tween20) and incubated with antibodies specific for
V5 (Invitrogen, Carlsbad, CA, USA), PBX1 (Abnova, Taipei, Taiwan), MEOX1 (Sigma-Aldrich),
ALDH1A (BD, Franklin Lakes, NJ, USA), JAK2 (Abcam), STAT3, phospho-STAT3 (Tyr705, Cell
Signaling, Beverly, MA), or GAPDH. Membranes were washed with TBST and incubated with
Horseradish peroxidase-conjugated secondary antibody (Jackson Laboratories, West Grove,
PA), and the signal was detected with ECL solution (GE Healthcare, Little Chalfont, UK).
siRNA Transfection and Quantitative Real-Time PCR
Two sets of PBX1-specific small interfering RNAs (siRNAs)
(CCCAGGUAUCAAACUGGUUUGGAAA) and (GCCAAGAAGUGUGGCAUCACAGUCU), and
scrambled Stealth RNAi control (siSCR) were purchased from Invitrogen. Cells were transfected
with siRNA at a final concentration of 100 nM using Lipofectamine RNAiMAX, according to the
manufacturer’s protocol (Invitrogen). Cells were harvested 48 hr after transfection for Western
blot, survival analysis, and RNA isolation.
Relative transcript expression levels were measured by quantitative real-time PCR as
described previously (1). In brief, RNA was isolated using an RNeasy Mini kit (Qiagen,
Germantown, MD), and cDNA was synthesized using an iScript cDNA Synthesis kit (Bio-Rad).
Real-time PCR reactions were performed in triplicate using SYBR Green PCR mixture and the
Bio-Rad iCycler detection system. The mean Ct value of the gene of interest was calculated
from triplicate wells and normalized to the mean Ct value of a control gene, glyceraldehyde-3-
phosphate dehydrogenase (GAPDH). The PCR primer sequences used in this study are
available upon request.
Chromatin Immunoprecipitation
Chromatin immunoprecipitation (ChIP) was performed as previously described (1).
Approximately 1.2×107 OVCAR3 or OVCAR3CR cells were fixed with 1 % formaldehyde for 10
min, quenched with 125 mM glycine for 5 min, and washed in DPBS. Nuclei were isolated in
nuclei swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5 % NP-40) and lysed in a nuclei lysis
buffer (1 % SDS, 10 mM EDTA, 50 mM Tris-HCl, 0.5 % NP-40). Lysed nuclei were sonicated for
3 cycles of 30 sec ON/30 sec OFF protocol using the Bioruptor (Diagenode, Denville, NJ).
Sonicated lysates were diluted in ChIP dilution buffer (1 % Triton X-100, 2 mM EDTA, 20 mM
Tris-HCl, 167 mM NaCl) and incubated with anti-PBX1 antibody (Abnova, H00005087-M01) or
mouse IgG (Abcam, ab37355, Cambridge, UK) overnight at 4 °C with rotation. The sample was
mixed 1:1 with a slurry of BSA-blocked Protein G magnetic beads (Dynabead, Invitrogen) and
incubated for 6 hrs. Antibody-protein complexes bound to beads were washed once with high
salt buffer (0.5 M LiCl, 1 % NP 40, 1 % Sodium Deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH
8.0), once with low salt buffer (0.25 M LiCl, 1 % NP-40, 1 % Sodium Deoxycholate, 1 mM
EDTA, 10 mM Tris-HCl, pH 8.0), and twice with TE, pH 8.0. Complexes were eluted in 1 %
SDS, 0.1 M NaHCO3 overnight at 65 °C, and samples were treated with proteinase K for 1 hr,
37 °C. The recovered DNA fragments were purified using a QIAquick PCR Purification Kit
(Qiagen). The precipitated DNA was amplified by PCR for 1 cycle at 95 °C for 2 min; 35 cycles
at 95 °C for 30 sec, 58 °C for 30 sec, 72 °C for 30 sec; and 1 cycle at 72 °C for 10 min. A pair of
primers corresponding to a region of the genome that was not anticipated to be pulled down by
PBX1 antibody was used as a control. PCR was performed in triplicated wells, and data were
normalized to qPCR signals obtained from an input sample.
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear extracts were isolated from 293FT cells transfected with a plasmid encoding the PBX1V5 cDNA using NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology).
DNA probes in the STAT3 promoter regions were synthesized and annealed by Integrated DNA
Technology (IDT, Coralville, IA). EMSA was performed by incubating PBX1-containing nuclear
extracts or recombinant PBX1 protein (Origene, Rockville, MD) with 20 nM biotinylated-DNA
probes; the reaction mixtures were separated using a 4-12% TBE gel (Invitrogen), and the
signal was detected by LightShift Chemiluminescent EMSA kit (Pierce Biotechnology). In our
previous publications, we have described details of the experimental procedures (2, 3).
References
1. Thiaville MM, Stoeck A, Chen L, Wu RC, Magnani L, Oidtman J, et al. Identification of PBX1
target genes in cancer cells by global mapping of PBX1 binding sites. PLoS One.
2012;7:e36054.
2. Park JT, Shih Ie M, Wang TL. Identification of pbx1, a potential oncogene, as a notch3
target gene in ovarian cancer. Cancer Res. 2008;68:8852-60.
3. Chen X, Thiaville MM, Chen L, Stoeck A, Xuan J, Gao M, et al. Defining NOTCH3 target
genes in ovarian cancer. Cancer research. 2012;72:2294-303.