Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Table S1 : Detailed overview of strategies used to assemble the different constructs. Overview of all constructions that were compared. The molecular strategy and applied primer sequences are summed in the table. In the primer sequences, uppercase Italic letters are part of the secretion signal sequence, while uppercase bold letters are used for TrCel6A+His-tag DNAsequence. Construct description Codon optimized TrCel61A preceded by alpha-mating factor (EKR-EA-EA) TrCel61A with native codon usage + alphamating factor (EKR-EA-EA) Trichoderma reesei Cel61A preceded by alpha-Mating factor ending in Enterokinase cleavage site Strategy 1. Include XhoI restriction site at 5’ and NotI at 3’ end of the sequence, starting from a pMAT vector including TrCel61A (primers FW1+REV1, restriction sites underlined) 2. Restriction digest from the PCR product and pPpT4 backbone with XhoI-NotI followed by ligation 1. Include XhoI restriction site at 5’ and NotI at 3’ end of the sequence, starting from a pJET vector including TrCel61A (primers FW1 +REV1) 2. Restriction digest from the PCR product and pPpT4 backbone with XhoI-NotI followed by ligation One-piece Gibson assembly (1) removing E-A-E-A from the alphamating factor and changing it for D-D-D-D-R amino acid sequence (underlined) (Primers FW1 + REV2) Primer sequences FW1 : 5’- AAACTCGAGAAGAGAGAGGCCGAAGCT CACGGTCACATTAACGACATCGTTATC -3’ REV1 : 5’tagcggccgcCTAGTGATGGTGATGGTGATGGTTCAAAC ACTGAGCGTAGTAAGGG -3’ FW1 : 5’AAACTCGAGAAAAGAGAGGCTGAAGCTCATGGACATA TTAA -3’ REV1 : 5’aatgcggccgcTCAATGATGATGATGATGATGGTCGTCGT T -3’ FW1: 5’GGTGTCTCTCTCGAGAAGAGAGATGACGATGACAGAC ACGGTCACATTAACGACATCG -3’ REV1: 5’- (EKR-DDDDR-) TrCel61A with native codon usage + CGATGTCGTTAATGTGACCGTGTCTGTCATCGTCATCTC TCTTCTCGAGAGAGACACC -3’ Method as described by Sanchis et al (2008) (2) to remove aminoacids E-A-E-A at the 3’ end of the alpha-mating factor starting from the complete vector with alpha-mating factor ending in EKR-E-A-EA (Primers FW1 +REV1) FW1: 5’GGTGTCTCTCTCGAGAAGAGACACGGTCACATTAACGA CATCG -3’ REV1: 5’- gaagaggagtgggaaatacc -3’ 1. Amplify TrCel61A with the DDDK-protein secretion signal in front via PCR amplification and including the sequence into the primer (primers FW1+REV1) 2. Gibson assembly (1) to insert gene and secretion signal into pPpT4 vector (insert amplification primers: FW2 +REV1, backbone primers: FW3 + REV2) FW1: 5’CTACTTTGGCTTCCATTGCTGTTGCTCACGGTCACATTA ACGACATCGTTATC -3’ REV1: 5’cttgagcggccgcctAGTGATGGTGATGGTGATGGTTCAAA CACTGAGCGTAGTAAGG -3’ alpha- mating factor (EKR) DDDK protein native secretion signal FW2: 5’GTTTAACTTGAAGACTATTTTGATTTCTACTTTGGCTTCC ATTGCTGTTGCT -3’ Phanerochaete chrysosporium GH61D Gibson assembly (1) to exchange TrCel61A sequence to pPpT4 vector containing already Phanerochaete chrysosporium GH61D secretion signal (insert amplification primers: FW1 +REV1, backbone primers: FW2 + REV2) FW3: 5’CCTTACTACGCTCAGTGTTTGAACCATCACCATCACCAT CACTAGgcggccgctcaag -3’ REV2: 5’CAAAATAGTCTTCAAGTTAAACATcgtttcggaattctttcaat aattag -3’ FW1: 5’GTTGTCTCTGCTCCATTTGTCTTGGGTCACGGTCACATT AACGACATCG -3’ REV1: 5’ccgctcAATGATGATGATGATGATGGTTCAAACACTGAG CGTAGTAAGG -3’ Trichoderma reesei Cel61A preceded by its native secretion signal sequence 1. Precede TrCel61A by its native secretion signal sequence via PCR primers and include EcoRI restriction site at the 5’ and NotI site at 3’ end of the sequence (primers FW1 + REV1, restriction sites underlined) 2. Restriction digest from the PCR product and pPpT4 backbone with EcoRI-NotI followed by ligation FW2: 5’CCTTACTACGCTCAGTGTTTGAACCATCATCATCATCAT CATTGAgcgg -3’ REV2: 5’CGATGTCGTTAATGTGACCGTGACCCAAGACAAATGGA GCAGAGACAAC -3’ FW1 : 5’aaagaattccgaaacgATGATTCAAAAATTGTCTAACTTACT TGTTACTGCTTTGGCAGTTGCTACTGGTGTTGTGGGAC ACGGTCACATTAACGACATCGTTATCAAC - 3’ REV1 : 5’tagcggccgcCTAGTGATGGTGATGGTGATGGTTCAAAC ACTGAGCGTAGTAAGGG -3’ 1. D.G. Gibson, L. Young, R. Chuang, et al. (2009) Enzymatic assembly of DNA molecules up to several hundred kilobases. 6, 12–16. 2. J. Sanchis, L. Fernández, J.D. Carballeira, et al. (2008) Improved PCR method for the creation of saturation mutagenesis libraries in directed evolution: application to difficult-to-amplify templates. Applied microbiology and biotechnology. 81, 387–97.