Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Table S1. Oligonucleotide primers and specific annealing temperatures for real-time RT-PCR. Gene Forward primer (5’-3’) Reverse primer (5’-3’) Collagen III TTCCTTTTGTTCTAATCTTGTCA TAGCACCATTGAGACATTTTGA Collagen I TGAGCCAGCAGATTGAGAAC CCAGTGTCCATGTCGCAGA VCAM-1 AGTCCCTCGTCCATCGTG TGF-β1 Tm 60oC PCR product (bp) Reference 195 (1) 54oC 143 (1) GAAAGAGGCTGTAGGTCC 60oC 122 (2) AGGACGCCAACTTCTGCCT AGGACCTTGCTGTACTGGGTGT 60oC 70 (3) IL-10 GAGAACCACAGTCCAGCCAT CATGGCTTTGTAGACGCCTT 60oC 179 (4) MMP-9 CTTCCAACTTTGACAGCGACA GGAGTGATCCAAGCCCAGTG 60oC 110 NM_00108220 3.1 IFN-γ CTGGTCCAGCGTAAAGCAGT TCAGTACTTGGATGCTCGCC 60oC 126 NM_00108199 1.1 TNF-α AGATGGTCACCCTCAGATCAG GAAGAGAACCTGGGAGTAGATGAG 60oC 206 (5) MCP-1 CTTCTGTGCCTGCTGCTCATAG TGCTTGGGGTCAGCACAGAT 60oC 221 NM_00108229 4.1 eNOS GTGAGACTTTCTGCGTGGGA CAGACCTGGCAGCAACTGTA 60oC 131 NM_00108273 3.1 TIMP-1 AGCAGAGCCTGCACCTGTGT TGATTGACTTCTGGAGCCCC 60oC 101 (6) GAPDH GAACGGGAAACTCACTGGCAT CCTTCTTGATGTCGTCATACTTAGC 54oC 110 (2) VCAM: Vascular Cell Adhesion Molecule; TGF: Transforming Growth Factor; IL: Interleukin; MMP: Matrix Metalloproteinase; IFN: Interferon; TNF: Tumor Necrosis Factor; MCP: Monocyte Chemoattractant Protein; eNOS: Endothelial Nitric Oxide Synthase; TIMP: TissueInhibitor of Metalloproteinase; GAPDH: Glyceraldehyde 3-Phosphate Dehydrogenase; Tm: Annealing Temperature; RT-PCR: Reverse Transcriptase-Polymerase Chain Reaction Table –S1 References: 1. Dong B, Zhang C, Feng JB, Zhao YX, Li SY, Yang YP, Dong QL, Deng BP, Zhu L, Yu QT, Liu CX, Liu B, Pan CM, Song HD, Zhang MX, Zhang Y. Overexpression of ACE2 enhances plaque stability in a rabbit model of atherosclerosis. Arterioscler Thromb Vasc Biol. 2008 Jul;28(7):1270-6. 2. Li CJ, Sun HW, Zhu FL, Chen L, Rong YY, Zhang Y, Zhang M. Local adiponectin treatment reduces atherosclerotic plaque size in rabbits. J Endocrinol. 2007 Apr;193(1):137-45. 3. Hofstaetter JG, Wunderlich L, Samuel RE, Saad FA, Choi YH, Glimcher MJ. Systemic hypoxia alters gene expression levels of structural proteins and growth factors in knee joint cartilage. Biochem Biophys Res Commun. 2005 May 6;330(2):386-94. 4. Godornes C, Leader BT, Molini BJ, Centurion-Lara A, Lukehart SA. Quantitation of rabbit cytokine mRNA by real-time RT-PCR. Cytokine. 2007 Apr;38(1):1-7. 5. Charoenwanthanang P, Lawanprasert S, Phivthong-Ngam L, Piyachaturawat P, Sanvarinda Y, Porntadavity S. Effects of Curcuma comosa on the expression of atherosclerosis-related cytokine genes in rabbits fed a high-cholesterol diet. J Ethnopharmacol. 2011 Apr 12;134(3):608-13. 6. Park KC, Park EJ, Kim ER, Kim Y, Chung SH, Cho BW, Kim S, Jin M. Therapeutic effects of PG201, an ethanol extract from herbs, through cartilage protection on collagenase-induced arthritis in rabbits. Biochem Biophys Res Commun. 2005 Jun 17;331(4):1469-77.