Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supporting information for Transgenic citrus expressing synthesized cecropin B genes in the phloem exhibits decreased susceptibility to Huanglongbing Xiuping Zou1, 2 , †, Xueyou Jiang 2, 3, lanzhen Xu1, 2, Tiangang Lei1, 2, Aihong Peng1, 2, Yongrui He1, 2, Lixiao Yao1, 2, Shanchun Chen1, 2, † 1 Citrus Research Institute, Chinese Academy of Agricultural Sciences/ National Center for Citrus Variety Improvement, Chongqing 400712, P. R. China. 2 Citrus Research Institute, Southwest University, Chongqing 400716, P. R. China. 3 Guangan Agricultural Bureau, Chongqing 400716, P. R. China † Corresponding author Tel: 86-23-68349001 Fax: 86-23-68349020 e-mail:, [email protected] and [email protected] Supplemental Table 1 Source of selected promoters and their expression patterns in transgenic citrus Promoter Source Expression pattern in citrus Specifc and strong expression GRP1.8 French bean (Phaseolus vulgaris) in phloem tissue (Xu et al. 2014) Constitutive expression in citrus rolC Agrobacterium rhizogenes (Xu et al. 2014) Very weak expression in RSs1 Rice (Oryza sativa L.) phloem (Dutt et al. 2012; Xu et al. 2014) Specific expression in phloem PFN2 Rice tungro bacilliform virus (Christensen et al. 1996) Promoters were fused with the GUS reporter gene. The gene cassette was delivered into Tarocco blood orange (Citrus sinensis Osbeck) genome by Agrobacterium-mediated transformation method. Their expression patterns were determined by GUS staining. Supplementary Table 2 Primers used in the study name GRP-f GRP-r sequence(5′→3′) purpose CAAGCTTGAAGCCATATCAATGG TAATAAG Cloning GRP1.8 promoter with TGGATCCGTGAAGTGAAGCTGA HindIII and BamHI sites AATAGGTTG g-f AGCCATATCAATGGTAATAAG PCR confirmation for the c-r TCGACCTAACCAAGAGCTTTAG integration of transgenes in e-r TTAGAGTTCGTCGTGACCAAG transgenic plants qCB-f GCTAAATGGAAAGTTTTCAAG Quantitative RT-PCR analysis qCB-r AAGAGCTTTAGCTTCACCCA for expression of cecropin B gene CtAct-f CATCCCTCAGCACCTTCC Quantitative RT-PCR analysis CtAct-r CCAACCTTAGCACTTCTCC of the citrus reference gene actin Cla16s-f GCGCGTATGCAATACGAGCGGCA PCR analysis for Calas Cla16s-r GCCTCGCGACTTCGCAACCCAT pathogen in citrus plants qCla16s-f TGAGTGCTAGCTGTTGGGTG Quantitative real-time PCR qCla16s-r CTGCGCGTTGCATCGAATTA analysis for Calas16S gene Ct18s-f AATTGTTGGTCTTCAACGAGGAA Quantitative real-time PCR Ct18s-r AAAGGGCAGGGACGTAGTCAA Note: The sequences of restriction enzyme sites were in italic. analysis for citrus 18S gene Supplmentary Table 3 Quantitative PCR analysis of Calas population in transgenic lines 3 months after graft infection Bacterial population Line (Calas cells µg-1 of citrus DNA) pGA1 6.40×105±5.92×105 e pGA5 1.61×104±1.20×104 e pGA6 9.29×103±6.93×103 f pGA10 1.61×105±1.21×105 e pGA12 3.33×104±1.36×104 e pGA16 5.08×105±4.99×105 e pGA21 2.47×104±2.43×104 e pGA25 1.53×105±1.43 ×105 e pGA27 4.64×105±4.45×105 e pGC8 4.89×103±3.64×103 f pGC16 1.92×104±1.62×104 e pGC17 1.48×107 ±9.00×105 c pGE3 pGE4 pGE5 pGE6 pGE7 pGE8 3.19×103±4.51×102 f 1.92×105±1.82×105 e 2.77×105±2.70×105 e 5.49×103±4.78×103 f 6.01×104±4.91 ×104 e 1.80×107±2.68×105 b pGE10 pGE11 pGE12 pGE17 pGN WT 3.56×106±2.77×105 d 3.05×106±4.13×105 de 2.48×106±3.93×105 de 1.26×107 ±9.15×106 c 2.24×107±8.43×106 a 2.57×107±3.94×106 a The bacterial population (Calas cells µg-1 of citrus DNA) 3 months after infection was investigated using qPCR. Standard errors per line were calculated from three plants. Different letters on the upper right of values represented significantly different from wild type (WT) control by Tukey’s test (P<0.05). Supplementary Fig. 1 Synthetic cecropin B gene and plant expression vectors used for citrus transformation. a Nucleotide and amino acid sequences of the CB, PR1aCB, and PR1aCBer genes. For PR1aCB gene, the signal sequence (underlined) from the tobacco PR1a protein was fused to the CB gene, and for PR1aCBer, ER retention signal sequence (KDEL) was fused to the 3′ terminus of PR1aCB gene. ET corresponded to the consensus sequence for efficient translation in plants. b Schematic diagrams of the plant expression vectors used for transformation. 35S, Cauliflower mosaic virus 35S promoter from tobacco; gus::npt-II, fusion of β-glucuronidase and neomycin phosphotransferase genes (for screening of citrus transformants); nos, nos terminator; LB, left border; RB, right border Supplementary Fig. 2 Construction of standard equation for quantifying Calas population in transgenic citrus Standard equations were developed mainly based on previous work by Tatineni et al.(2008). Here, the 2× iQTM SYBR Green Supermix (Bio-Rad) was used to quantify Calas populations by qPCR analysis. A 1,165-bp DNA fragment of the HLB-specific 16s rDNA was amplified using Cla16s-f/Cla16s-r primers (Table S2), and cloned into pGEM T-easy vector (Promega Corp.) to construct pCalas16S plasmid. 10 μl 12.2 ng μl-1 pCalas16S plasmid and 10 μl 560 ng μl-1 citrus (Tarocco blood orange) DNA were mixed together. A series of the mixture ranging from 108 to 2×100 were used to construct the standard equations for quantifying Calas populations. Calas 16S and citrus 18S genes were amplified from above the dilutions using qCla16s-f/ qCla16s-r and Ct18s-f /Ct18s-r primers, respectively (Supplementary Table 2). Then the standard equations for calculating bacterial cell copies (a) and evaluating citrus genome quality (b) were generated by blotting the mean Ct values against the nature log concentrations in MS Excel. Based on the data, the bacterial population per µg citrus DNA were calculated as the formula: Calas cells µg-1 citrus DNA= [10^(-0.2718×Ctcalas16S+10.624)/ 10^(0.2749×CtCs18S+4.0531)]×103 (12.7< Ctcalas16S <31.3 and 8.4< CtCs18S <26.5). Supplementary Fig. 3 GUS expression patterns in Tarocco blood orange (Citrus sinensis Osbeck) by four different promoters Histochemical GUS staining as described by Zou et al. (2008) . Leaf and cross stems from regenerated shoots were incubated in 1 mM 5-bromo-4-chloro-3-indolyl-β-Dglucuronic acid (X-gluc; Sigma, St Louis, MO, USA) reaction buffer at 37 °C for 3 h. Samples were destained in 75% ethanol for 12 h to remove chlorophyll and other pigments and then photographed. Ten independent transgenic plants per promoter were used to investigate GUS expression patterns. The results showed that the GRP1.8 promoter from the French bean (Phaseolus vulgaris) had phloem-specific expression characteristic in Tarocco blood orange and was the strongest promoter compared with others. Supplementary Fig. 4 Western blot analysis of cecropin B protein in transgenic plants 50 µg soluble protein extracts from fresh veins were probed with a ployclonal antibody against cecropin B. Lane CB is a positive control with 0.05 µg of synthetic CB peptide (abcam, Shanghai, China). WT, wild type control. References Christensen HE, Ramachandran S, Tan CT, Surana U, Dong CH, Chua NH (1996) Arabidopsis profilins are functionally similar to yeast profilins: identification of a vascular bundle-specific profilin and a pollen-specific profilin. Plant J 10:269-279. doi:10.1046/j.1365-313X.1996.10020269.x Dutt M, Ananthakrishnan G, Jaromin MK, Brlansky RH, Grosser JW (2012) Evaluation of four phloemspecific promoters in vegetative tissues of transgenic citrus plants. Tree Physiol 32:83-93. doi:10.1093/treephys/tpr130 Tatineni S, Sagaram US, Gowda S, Robertson CJ, Dawson WO, Iwanami T, Wang N (2008) In planta distribution of 'Candidatus Liberibacter asiaticus' as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology 98:592-599. doi:10.1094/PHYTO-98-5-0592 Xu L et al. (2014) Expression Analysis of Three Phloem-specific Promoters in Transgenic Poncirus trifoliata. Acta Horticulturae Sinica 41:1-8 Zou X, Li D, Luo X, Luo K, Pei Y (2008) An improved procedure for Agrobacterium-mediated transformation of trifoliate orange (Poncirus trifoliata L. Raf.) via indirect organogenesis. In Vitro Cell Dev-Pl 44:169-177. doi:10.1007/s11627-008-9106-5