* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Analysis of p75NTR-dependent apoptotic
Survey
Document related concepts
Cytokinesis wikipedia , lookup
Phosphorylation wikipedia , lookup
Cellular differentiation wikipedia , lookup
Hedgehog signaling pathway wikipedia , lookup
Protein phosphorylation wikipedia , lookup
Nerve growth factor wikipedia , lookup
G protein–coupled receptor wikipedia , lookup
List of types of proteins wikipedia , lookup
Programmed cell death wikipedia , lookup
Signal transduction wikipedia , lookup
VLDL receptor wikipedia , lookup
Transcript
Analysis of p75NTR-dependent apoptotic pathways and of p75NTR gene products Christine E. Paul Neurology and Neurosurgery McGill University Montreal, Quebec July, 2003 A Thesis submitted to the McGill University Faculty of Graduate Studies and Research in partial fulfilment of the requirements of the degree of Master in Science ©Christine Paul 2003 11 Table of contents Abstract iv Resume vi Acknowledgements vii List of Abbreviations viii Contribution of authors x Chapter 1: Introductory Literature Review 1 Developmental Apoptosis The neurotrophins p75NTR The pan neurotrophin receptor p75NTR is structurally similar to other TNFR superfamily members Other p75NTR ligands p75NTR Functions p75NTR as a co-receptor for Trk p75NTR as a co-receptor for NogoR p75NTR autonomous signaling (death and survival) The p75NTR knockouts p75NTRExonm-/-mice p75NTRExonIV-/-mice Statements of projects/hypotheses 2 2 4 5 7 8 9 10 12 17 17 22 23 Preface to Chapter 2 25 Chapter 2: p75NTR does not transcriptionally activate BH3-only proteins 26 I. II. III. IV. V. VI. VII. Literature Review: the BH3-domain-only proteins Statement of project/hypothesis Materials and Methods Results Closing Remarks Figure Legends Figures i. Figure 1 27 30 31 33 34 37 38 Ill Preface to Chapter 3 39 Chapter 3: A Pro-apoptotic Fragment of the p75 Neurotrophin Receptor is expressed in p75NTRExonlv null mice .40 I. II. III. IV. V. VI. VII. VIII. IX. Title Page Acknowledgements Abstract. Introduction Materials and Methods Results Discussion Figure Legends Figures i. Figure 2 ii. Figure 3 iii. Figure 4 41 42 43 44 46 51 56 58 62 63 64 Closing Remarks 65 Bibliography 70 Appendix 88 Asha L. Bhakar, Jenny L. Howell, Christine E. Paul. Amir H. Salehi, Esther B. E. Becker, Farid Said, Azad Bonni and Philip A. Barker. Apoptosis Induced by p75NTR Requires Jun Kinase-dependent Phosphorylation of Bad. Submitted to EMBO J, July 2003. 89 Research Compliance Certificate: McGill University Animal Use Protocol 124 IV Title: Analysis of p75NTR-dependent apoptotic pathways and of p75NTR gene products Abstract: The p75 neurotrophin receptor (p75NTR) binds members of the neurotrophin family and plays important roles in the regulation of neuronal survival, apoptosis and growth during development and after nervous system injury. Many in vitro and in vivo studies have shown that p75NTR induces cell death, though the signaling events that link p75NTR activation to apoptosis are not thoroughly understood. p75NTR-dependent apoptosis is associated with an increase in Rac and Jun kinase (JNK) activity, and recent work from our laboratory has shown that the p75NTR interactor, NRAGE, activates a mitochondrial death pathway involving JNK-dependent cytochrome C release and activation of Caspase-9, Caspase-7 and Caspase-3. Despite this progress, several important details of p75NTR apoptotic signaling remain unknown. In particular, it is unclear what targets of p75NTR-dependent JNK activation result in mitochondrial cytochrome C release and caspase activation. BH3-domain-only proteins are members of the Bcl-2 family that induce the association of Bax and Bak which in turn facilitate release of mitochondrial proteins such as cytochrome C into the cytosol. Transcriptional activation of BH3-domain-only genes through c-Jun- or p53dependent pathways is implicated in apoptosis in neuronal and non-neuronal systems. In the first part of this thesis, I examined whether p75NTR-induced apoptosis is correlated with accumulation of BH3-domain-only gene products. U373 human glioma cells and mouse cortical neurons were infected with adenovirus expressing p75NTR to constitutively activate p75NTR-dependent pathways, and alterations in mRNA levels of the BH3-domain-only family members Bim, Bmf, Hrk, Bik, Puma, and Noxa were determined by RT-PCR. The results from these experiments showed that p75NTRmediated cell death did not result in BH3-domain-only gene transcription. Subsequent studies in our laboratory established that the BH3-domain-only protein, Bad, is phosphorylated on Serine 128 in a JNK-dependent manner, and that this phosphorylation is a critical component of p75NTR-dependent apoptosis. The generation of animals that lack p75NTR expression has been a critical advance in understanding the in vivo role of this receptor. In the second part of this thesis, I analyzed the recently created p75NTRExonlv-/- mice, which were shown to produce a null mouse lacking all p75NTR gene products, in contrast to the previously constructed p75NTRExon1"-/- mouse, which maintains expression of an alternatively spliced form of p75NTR (s-p75NTR). Our studies revealed that p75NTRExonIV-/- mice continue to express a p75NTR gene product that encodes a truncated protein containing the p75NTR extracellular stalk region together with the entire transmembrane and intracellular domains. The gene product is initiated from a cryptic Kozak consensus/initiator ATG sequence within a region of Exon IV located 3' to the pGK-Neo insertion site, likely as a result of enhancer elements within pGK-Neo cassette. Characterization of this protein product indicated that it localized to the plasma membrane and overexpression of the p75NTRExonIV fragment in heterologous cells resulted in activation of JNK and cleavage of Procaspase 3, indicating that it can mediate pro-apoptotic effects in vivo. These results indicate that aspects of the p75NTRExonIV-/phenotype may reflect a gain-of-function mutation rather than a loss of p75NTR function. VI Titre: Analyses des proprietes de signalement apoptotiques du recepteur de neurotrophines p75NTR et analyses de souris, p75NTRExonIV -/- Resume: II est difficile d'identifier clairement la fonction du recepteur de neurotrophines p75NTR, cependant plusieurs etudes indiquent qu'il peut activer des signaux apoptotiques. Durant la premiere partie de ma maitrise, j'ai etudie la famille de proteines denommee "BH3-domain-only", membres de la famille Bcl-2. Ces dernieres interagissent avee les proteines Bax et Bak causant ultimement l'activation des caspases. Utilisant un systeme ou p75NTR est exprime par un adenovirus, j'ai determine que les proteines "BH3-domain-only" ne sont pas activees au niveau de la transcription durant l'apoptose induite par 1'expression de p75NTR. Des travaux effectues dans notre laboratoire ont reveles que les signaux apoptotiques de p75NTR mene a la phosphorilation de la proteine Bad, membre de la famille "BH3-domain-only", au niveau de la Serinel28. De plus, cette phosphorylation depend de l'activation de la cascade enzymatique de JNK et elle est essentielle a l'induction de l'apoptose par p75NTR. Durant la deuxieme partie de ma maitrise, j'ai etudie la souris p75NTRExonIV -/- qui a ete creee recemment. It a ete determine, suite a mes travaux, que cette souris exprime toujours une certaine portion du recepteur p75NTR. Cette portion comprendrait tout le domaine transmembranaire and intracellulaire. La transcription de cette partie du recepteur est causee par une region "enhancer" situee dans la cassette pGK-Neo, qui a ete introduite dans le quatrieme exon de p75NTR durant la modification du gene de p75NTR. L'expression de cette portion de p75NTR dans plusieurs types de cellules a mene a l'activation de la cascade enzymatique de JNK and au clivage de la Procaspase-3, indiquant que p75NTRExonIV mene a des evenements apoptotiques. En conclusion, les resultats obtenus indiquent que les aspects de la mutation p75NTRExonIV reflectent un gain et non pas une perte de fonction. Vll Acknowledgements I would like to thank my supervisor, Phil Barker, for providing such a great environment in which to practice science. A part of that environment includes the people in my surroundings. As such, I would like to thank past and present members of the Barker lab for their friendship, guidance and support. I would like in particular to say thanks to Asha Bhakar, Philippe Roux and Amir Salehi for showing me the ropes when I first arrived. I would also like to acknowledge Genevieve Dorval (who helped me translate my abstract-thank you!) and Kathleen Dickson, who both helped me with numerous technical aspects of my projects. I would also like to thank my advisory committee, who comprise Dr. Ted Fon and Dr. Peter McPherson, for helpful advice throughout my studies. Thanks also to my academic mentor, Dr. Andrea Leblanc, and to Dr. Wayne Sossin for helpful discussions. I would like to thank my family (West Coast and East Coast contingencies alike) and my roomate, Carolyn Picco, for her everpresent support and friendship. Also, to other "MNIers" (especially to Amy Corcoran, Natasha Hussain, Andrew Jarjour, Tamra Werbowetsky, Anna Lee, Nic Tritsch and Simon Moore) without whom my Msc would never have been this much fun. In the social department, I would also like to thank the Lobotomizers, Ultimate team, FACE people, and fellow RVH-PCU volunteers, who helped make life great in Montreal. Finally, I would like to acknowledge Greg Walsh, for so many little things, the sum of which is much greater than the parts! You da best. Vlll List of Abbreviations AP-1 Activating Protein-1 APP Amyloid Precursor Protein BDNF Brain-Derived Neurotrophin Factor BH Bcl-2 Homology CGN Cerebellar Granule Neurons CNS Central Nervous System COS-7 CV-1 cells expressing Simian virus-40 antigen CRD Cysteine Rich Domain CRIB Cdc42/Rac-Interactive Binding CRNF Cysteine-Rich Neurotrophic Factor DD Death Domain DISC Death-Inducing Signaling Complex DRG Dorsal Root Ganglia ECD Extracellular Domain FADD Fas receptor Associated Death Domain FL-p75NTR Full Length p75NTR GCK Germinal Center Kinase GDP Guanine Diphosphate GFP Green Fluorescent Protein GPI GlycosylPhosphatidyllnositol Guanine Triphosphate GTP Human Embryonic Kidney HEK Inhibitor of Apoptosis IAP Intracellular Domain ICD JNK Interacting Protein JIP c-Jun N-terminal Kinase JNK Myelin-Associated Glycoprotein MAG Mitogen Activated Protein Kinase MAPK Mixed Lineage Kinase MLK p75NTR-associated cell death executor NADE Nerve Growth Factor NGF Neurotrophin Receptor Interacting Mage Homolog NRAGE Neurotrophin-3 NT-3 Neurotrophin-4/5 NT-4/5 Nogo Receptor NgR Oligodendrocyte-Myelin Glycoprotein OMgP p75 Neurotrophin Receptor p75NTR PhosphoGlycerate Kinase pGK Pheochromocytoma Cell line 12 PC12 Phosphatidylinositol 3-Kinase PI-3K Protein Kinase A PKA PhosphoLipase C PLCy Peripheral Nervous System PNS Pro-Nerve Growth Factor ProNGF Receptor Activator of NF-kappa (3 RANK IX Rho-GDI ROCK RTK SDS-PAGE s-p75NTR TNF TNFR TRADD TrkA TrkB TrkC TUNEL Rho GDP Dissociation Inhibitor Rho-associated serine-threonine protein kinase Receptor Tyrosine Kinase Sodium Dodecyl Sulfate-PolyAcrylamide Gel Electrophoresis Splice variant of p75NTR Tumor Necrosis Factor Tumor Necrosis Factor Receptor TNF Receptor Associated Death Domain Tropomyosin Related Kinase A Tropomyosin Related Kinase B Tropomyosin Related Kinase C Terminal deoxynucleotidyl transferase biotin-dUTP Nick End Labeling Contribution of authors Chapter 2: p75NTR does not transcriptionally activate BH3-only proteins I performed the design of primers, preparation of cDNA from infected cells, and subsequent RT-PCRs. This work was apart of the following manuscript, that is included in the appendix of this thesis: Asha L. Bhakar, Jenny L. Howell, Christine E. Paul. Amir H. Salehi, Esther B. E. Becker, Farid Said, Azad Bonni and Philip A. Barker. Apoptosis Induced by p75NTR Requires Jun Kinase-dependent Phosphorylation of Bad. Submitted to EMBO J, July 2003. Chapter 3: A Pro-apoptotic Fragment of the p75 Neurotrophin Receptor is expressed in p75NTRExonlv -/- mice I performed all the experiments and helped to write the manuscript: Christine E. Paul and Philip A. Barker. A Pro-apoptotic Fragment of the p75 Neurotrophin Receptor is expressed in p75NTRExonIV -/- mice. Submitted to Nature Neuroscience, July 2003. Chapter 1: Introductory Literature Review Developmental Apoptosis During embryonic and early postnatal development, many neurons formed by neurogenesis are killed in an active form of cell death known as apoptosis. This process results in death of up to 50% of all neurons initially created, in order to create appropriate connections between neurons and their target organs, and to allow for proper morphogenesis such as neural tube closure (Jacobson et al., 1997; Oppenheim, 1991). There is also increasing evidence that apoptosis contributes significantly to the pathology of human neurodegenerative diseases (Pettmann and Henderson, 1998). The neurotrophins are a family of growth factors that act as critical mediators of the survival or death of neurons in both the developing and the mature nervous system. While initially identified as target-derived neuronal survival cues (Oppenheim, 1991; Purves et al., 1988), the neurotrophins are now widely recognized to elicit a variety of responses ranging from regulation of proliferation, synaptic plasticity, neuritic outgrowth, survival and apoptosis. The Neurotrophins In mammals, there have been four neurotrophins identified, which include nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and neurotrophin-4/5 (NT-4/5). NGF, the prototypical neurotrophin, was discovered more than fifty years (Huang and Reichardt, 2001; Levi-Montalcini, 1987) as a survival factor that enabled dorsal root ganglia to survive during a "critical phase" in which they normally underwent massive and rapid cell death. Initial discoveries by Rita LeviMontalcini, Stanley Cohen and Victor Hamburger led to the neurotrophic hypothesis, which maintained that the number of neurons innervating a target is limited by the amount of target-derived trophic factor made available to these neurons. In addition to NGF, three other neurotrophins have been discovered in mammals. BDNF was the second discovered neurotrophin, and sequence homology between NGF and BDNF prompted the search for the other mammalian neurotrophins, NT-3 and NT4/5, which were discovered by cloning (Ernfors et al., 1990; Hohn et al., 1990) in the early 1990's. All four neurotrophins share similar primary, secondary, tertiary and quaternary structure. They are initially synthesized as 31-35 kDa precursors that are then cleaved by a variety of processing enzymes to give rise to the mature processed neurotrophins (13.215.9 kDa). Once fully processed, neurotrophins exist as non-covalently linked homodimers that are secreted through either the constitutive secretory pathway (in the case of NGF and NT-3) or through a regulated activity-dependent pathway (in the case of BDNF) (Ghosh et al., 1994; Mowla et al., 1999). Each neurotrophin promotes the survival of specific populations of mammalian neurons. Neurotrophins are unique in that they use two different receptors, the tropomyosin-related kinase (Trk) receptor and the p75 neurotrophin receptor (p75NTR), a member of the tumor necrosis factor receptor (TNFR) superfamily. The Trk receptors are highly related transmembrane receptor tyrosine kinases (RTKs) that are expressed in discrete neuronal populations and which are bound by specific neurotrophins. Trk A binds preferentially to NGF, Trk B binds BDNF and NT-4/5, and Trk C binds NT-3 (Cordon-Cardo et al., 1991; Ip et al., 1993; Kaplan et al., 1991a; Kaplan et al., 1991b; Klein et al., 1990; Klein et al., 1991a; Klein et al., 1991b; Lamballe et al., 1991; Soppet et al., 1991; Squinto et al., 1991). Activation of Trk receptors by their preferred neurotrophic ligand elicits the well-known survival effects associated with the neurotrophins, as shown in a number of gain and loss of function studies. For instance, ectopic expression of Trk receptors confers neurotrophin-dependent survival and differentiation in many neurons (Allsopp et al., 1993; Barrett and Bartlett, 1994). The physiological importance of the Trks in neuronal survival is most clearly demonstrated in mice with Trk receptor gene deletion, where extensive loss of specific neuronal populations are observed (Snider, 1994). Many studies have shown that Trk activation results in phosphorylation on intracellular residues Tyrosine 490 and Tyrosine 785, which serve as important docking sites for adaptor proteins that in turn activate the Ras, PI-3K and PLCy pathways, leading to modulation of neuronal survival, growth and differentiation (Kaplan and Miller, 2000; Roux and Barker, 2002). While the mechanism of action of the Trks has been well characterized, the roles of p75NTR appear complex and have been much more difficult to ascertain. The remainder of this chapter will focus on the structural and functional aspects of this receptor. p75NTR The pan neurotrophin receptor Early NGF binding studies established that NGF-responsive cells had high affinity and low affinity binding sites, with dissociation constants of ~10"n and ~10"9 M respectively. p75NTR was the first discovered NGF receptor (Chao et al., 1986; Johnson et al., 1986; Radeke et al., 1987), and transfection studies established that p75NTR bound NGF at the lower of these two affinities, thereby earning the name "low affinity NGF receptor". The discovery of the other neurotrophins led to the finding that p75NTR could bind all the neurotrophins with approximately equal affinity in most cells (RodriguezTebar et al., 1990; Rodriguez-Tebar et al., 1992; Squinto et al., 1991). While the equilibrium binding constants are very similar, binding of each of the neurotrophins to p75NTR display markedly different kinetics, suggesting that the binding of individual neurotrophins to p75NTR could serve particular functions in the nervous system (Barrett, 2000). Although p75NTR was the first identified neurotrophin receptor, its physiological function remains poorly understood. Many studies indicate that the effects of p75NTR range from promotion of survival pathways, induction of apoptosis, modulation of cell cycle and differentiation, and facilitation or inhibition of neuritic growth. p75NTR can, under certain conditions, act as a co-receptor to Trk, thereby enhancing or dampening its response to neurotrophins (reviewed by Kaplan and Miller, 2000; Roux and Barker, 2002). p75NTR has also recently been shown to act as a co-receptor for the Nogo receptor, thereby modulating neurite growth inhibition in response to the myelin inhibitory proteins, MAG, OMgP and Nogo (reviewed by Kaplan and Miller, 2003; McKerracher and Winton, 2002). However, p75NTR can also signal autonomously, through ill-defined pathways that regulate growth, survival and death. p75NTR is structurally similar to other TNFR superfamily members p75NTR was the first identified member of the TNF receptor superfamily that now contains approximately 25 receptors, including Tumor Necrosis Factor Receptor 1 (TNFR1) and TNFR2, Fas, RANK and CD40 (Baker and Reddy, 1998). All members of the TNFR superfamily share a common structural cysteine-rich module in their extracellular domain, and do not have any catalytic activity, but sometimes contain a death domain (DD) which can interact with adaptor proteins that link TNFRs to caspase activation. p75NTR is an atypical member of this family for a number of reasons. Firstly p75NTR binds dimeric ligands (the neurotrophins) that are structurally distinct from other TNFR ligands, which are trimeric (Banfield et al., 2001; Robertson et al., 2001; Wiesmann et al, 1999). Secondly, the p75NTR DD has been shown to be significantly differently from the Fas TNFR in the orientation of the first of its six alpha-helices (Huang et al., 1996; Liepinsh et al., 1997). Finally, p75NTR has not been shown to bind the same adaptor proteins that link other pro-apoptotic TNFRs to Caspase-8 activation (reviewed in Wallach et al., 1996). The p75NTR protein is a single Type I transmembrane protein that contains a single asparagine-linked carbohydrate close to its N-terminal and several O-linked carbohydrates in the juxtamembrane domain. The p75NTR extracellular domain (ECD) has four cysteine-rich domains (CRDs) (Baldwin et al., 1992; Yan and Chao, 1991), and several studies indicate that CRD2 to 4 are important for neurotrophin binding (Baldwin et al., 1992; Chapman and Kuntz, 1995; Shamovsky et al., 1999; Yan and Chao, 1991). The first CRD in other TNFRs including Fas, TNFR1, and CD40 has been shown to mediate ligand-independent receptor trimerization (Chan et al., 2000; Siegel et al., 2000), but it is unclear whether CRD1 of p75NTR functions in an analagous manner. The p75NTR intracellular domain (ICD) contains a palmitoylation site on Cysteine 279 (Barker et al., 1994), which may serve to properly distribute p75NTR throughout the cell membrane, and can be phosphorylated on several serine and threonine residues (Grob et al., 1985; Taniuchi et al., 1986). The function of these phosphorylation events has not been well understood, but one recent study suggests that phosphorylation at Serine 304 (within the juxtamembrane linker region of p75NTR) by Protein Kinase A (PKA) is a critical requirement for recruiting p75NTR to lipid rafts, which contain a concentrated pool of downstream signaling molecules that can promote signal transduction (Higuchi et al., 2003). The p75NTR juxtamembrane domain is well conserved between species (Large et al., 1989) and its DD has been shown to be important for some of the protein-protein interactions that are required to transduce its effects. The p75NTR DD contains a ~80 amino-acid association module initially identified in related pro-apoptotic TNFRs, but unlike those TNFRs, the p75NTR DD does not associate with the same adaptor proteins that result in direct activation of caspases (Wallach et al., 1996). As stated above, the structure of the p75NTR DD is significantly different from that of the Fas receptor (Liepinsh et al., 1997), which may help to explain why signaling mediated by p75NTR differs from that of Fas and other related TNFRs. Other p75NTR ligands Neutrophins bind p75NTR with dissociation constants of ~10"9 M, but a recent study indicates that the NGF precursor, pro-NGF, binds p75NTR with much higher affinity than mature NGF, indicating that pro-neurotrophins may be the preferred ligands for p75NTR (Lee et al., 2001). Pro-NGF binding to p75NTR in this study induced significantly higher levels of apoptosis in comparison with the mature, fully processed NGF. These findings may be physiologically significant since neurotrophin precursors are the predominant forms of BNDF and NGF in the brain, and have been shown to be elevated in Alzheimer's disease (Fahnestock et al., 2001). Another recent study has shown that pro-NGF is likely responsible for activating p75NTR-dependent apoptosis in vivo during spinal cord injury, suggesting that the role of the proneurotrophin is to eliminate damaged cells by activating p75NTR apoptotic cascades after injury (Beattie et al., 2002). p75NTR has also been shown to bind the invertebrate snail L. stagnalis ligand cysteine-rich neurotrophic factor (CRNF) with nanomolar affinity (Fainzilber et al., 1996), raising the possibility that CRNF is a member of an as-yet-identified family of p75NTR ligands. In addition, p75NTR has been shown to bind non-neurotrophin ligands, including the A(3-peptide of the amyloid precursor protein (APP) (Kuner et al., 1998; Perini et al., 2002; Yaar, 1997) and the rabies virus, suggesting that p75NTR may facilitate the entry of neurotoxic substances into cells. p75NTR Functions p75NTR is reported to mediate strikingly diverse biological effects which include cell death, survival, neurite outgrowth, positive regulation of developmental myelination (Cosgaya et al., 2002), Schwann cell migration (Anton et al., 1994; Bentley and Lee, 2000), modulation of synaptic transmission and functional regulation of sensory neurons and calcium channels (Stucky and Koltzenburg, 1997). Some of these effects are mediated in concert with other receptors, while others are elicited through p75NTR on its own. I will focus here on the actions of p75NTR in combination with Trk or Nogo receptors, and then focus on p75NTR autonomous signaling that results in survival and apoptosis. p75NTR as a co-receptor for Trk: mediation of Trk-dependent signals Neurotrophins bind their receptors with two different affinities: low-affinity (Ka = 1.7 x 10"9M) and high affinity {KA= 2.3 x 10" M). p75NTR displays the lower affinity when binding each neurotrophin, but in concert with the appropriate Trk, binds with the higher affinity (Hempstead et al., 1991; Mahadeo et al., 1994; Rodriguez-Tebar et al., 1992). Whether p75NTRis required for high affinity binding, or whether Trk alone is sufficient has been somewhat controversial, but it appears that the presence of both are important since co-expression of p75NTR increases the rate of NGF association with TrkA by 25-fold (Mahadeo et al., 1994). In response to low concentrations of neurotrophins, Trk activation is enhanced by the co-expression of p75NTR (Hantzopoulos et al., 1994; Verdi et al., 1994) indicating that p75NTR is important for increased survival responses in low neurotrophin concentrations. p75NTR co-expression with TrkA may therefore be physiologically important in cases where developing neurons must bind neurotrophins that are secreted from target organs at subpicomolar concentrations (Barde, 1989). p75NTR has also been shown to enhance TrkB and TrkC responsiveness at low concentrations of BDNF and NT-3, respectively (Hantzopoulos et al., 1994; Ip et al., 1993). How does p75NTR mediate the increased Trk responsiveness to NGF? Though this question remains unclear, experiments from the Yancopoulos group (Hantzopoulos et al., 1994) show that a mutation within the p75NTR ECD leads to a deficiency in formation of high-affinity neurotrophin binding sites. Further, it has shown that the 10 transmembrane and ICD of p75NTR are required for generation of high-affinity neurotrophin binding sites (Esposito et al., 2001). Additional experiments are needed to address the precise mechanism by which p75NTR facilitates Trk activation. p75NTR can also dampen Trk-mediated survival signals, and this has been shown in several studies of cells co-expressing p75NTR and Trk, where the non-preferred ligands are used to activate Trk. In the presence of p75NTR, NGF readily activates TrkA, but activation by NT-3 and NT-4/5 is greatly reduced (Bibel et al., 1999; Ip et al., 1993; Lee et al., 1994; Mischel et al., 2001). Similarly, BDNF-mediated TrkB activation is not altered in the presence of p75NTR, but TrkB activation by NT-3 and NT-4/5 is reduced by p75NTR co-expression (Bibel et al., 1999). The precise mechanism by which p75NTR reduces Trk activation by non-preferred ligands is also uncertain, but may involve p75NTR-dependent phosphorylation on Trk intracellular domains (Roux and Barker, 2002). p75NTR as a co-receptor for NogoR: mediation of neurite growth inhibition It is well established that while axons in the peripheral nervous system (PNS) can regenerate after injury, those in the central nervous system (CNS) do not (McKerracher and Winton, 2002). In the mature nervous system, a diverse class of myelin-derived neuritogenic inhibitors are largely responsible for the failure of injured CNS neurites to regrow. Recent work has shown that the myelin-inhibitory molecules, which include Nogo, myelin-associated glycoprotein (MAG), and oligodendrocyte myelin-associated glycoprotein (OMgP), all of which bind the Nogo66 Receptor (NgR) (Domeniconi et al., 2002; Fournier et al., 2001; Liu et al., 2002; Wang et al., 2002), require p75NTR to transduce their growth inhibitory effects (Wang et al., 2002; Wong et al., 2002). The precise mechanisms by which p75NTR transduces the growth inhibitory 11 effects of the myelin inhibitory proteins are still unclear, but appear to converge on modulation of RhoA activity (Yamashita et al., 1999). RhoA is a small GTPase that regulates the state of actin polymerization depending on its GTP-bound state: in its active GTP-bound form, RhoA rigidities the actin cytoskeleton, thereby inhibiting growth cone collapse (Davies, 2000; Schmidt and Hall, 2002). Early last year, it was shown that RhoA was modulated in a p75NTR-dependent manner, in response to treatment with the myelin inhibitory protein, MAG (Yamashita et al., 2002), although MAG does not bind directly to p75NTR. A number of subsequent studies showed that the GPI-linked Nogo receptor, NgR, also bound directly to MAG and OMgp with similar affinities (Domeniconi et al., 2002; Liu et al., 2002). Finally, two separate groups showed that p75NTR formed a complex with the NgR in response to treatment with MAG and Nogo, which in turn stimulated RhoA activity (Wang et al., 2002; Wong et al., 2002). There continues to be controversy over the manner in which RhoA is modulated by p75NTR in this model. Previous work using a yeast two-hybrid system had shown that a region within the p75NTR DD bound directly to RhoA (Yamashita et al., 1999). However, another study published early this year has established that the Rho-GDP dissociation inhibitor, Rho-GDI, directly interacts with p75NTR (Yamashita and Tohyama, 2003). Rho-GDI inhibits nucleotide dissociation in addition to shuttling Rho proteins between the cytoplasm and membrane, and can only bind Rho in its GDP-bound, inactive state (Sasaki and Takai, 1998). The study published earlier this year (Yamashita and Tohyama, 2003) showed that Rho-GDI bound directly to p75NTR, and that this interaction was strengthened in the presence of MAG or Nogo. Strengthened interaction between Rho-GDI and p75NTR resulted in displacement of GDP-bound RhoA from Rho-GDI, therein allowing RhoA to become activated through exchange of GDP for GTP. Activated RhoA has been shown to inhibit neuritic outgrowth through pathways that involve suppression of Rho kinase (ROCK) and that ultimately act on the actin cytoskeleton (McKerracher and Winton, 2002; Woolf and Bloechlinger, 2002). 12 In addition to its ability to inhibit neurite outgrowth through a NgR interaction, p75NTR has also been shown to modulate RhoA activity on its own. This work has shown that neurotrophin binding to p75NTR can inactivate RhoA, in turn stimulating neurite outgrowth. The same group that established the direct interaction between RhoGDI and p75NTR also showed that, whereas MAG and Nogo stimulated this interaction, no effect was observed upon neurotrophin stimulation (Yamashita and Tohyama, 2003). Their data suggest that Rho-GDI constitutively sequesters GDP-bound, inactive RhoA in the presence of neurotrophin, thereby stimulating neuritic outgrowth. This idea may be physiologically relevant during development where p75NTR could inactivate RhoA to favour axonal or dendritic outgrowth in areas directly surrounding the target organ secreting neurotrophin. In support of this hypothesis, it has been shown that p75NTR expression is upregulated in sympathetic neurons following arrival at the target organ (Miller et al., 1994). p75NTR autonomous signaling: activation of apoptotic and survival pathways p75NTR is perhaps best known for its ability to induce cell death. Several findings indicate that NGF binding to p75NTR can initiate an apoptotic pathway in neuronal cell types that do not express TrkA. For example, NGF treatment of embryonic retinal cells (Frade et al., 1996) or postnatal oligodendrocytes (Casaccia-Bonnefil et al., 1996) that express p75NTR, but not TrkA, causes apoptosis. The ligand dependency for p75NTR-dependent apoptosis remains controversial, since in some studies, ligand binding was essential for cell death and in others, it was not (reviewed in Roux and Barker, 2002). Nonetheless, the importance of p75NTR in developmental apoptosis is underscored by several in vivo studies. Application of antibodies directed against either NGF or the p75NTR ECD reduces apoptosis in the developing avian retina (Frade et al., 13 1996). Reduction of p75NTR using antisense oligonucleotides on axotomized sensory neurons also resulted in decreased levels of apoptosis (Cheema et al., 1996). In addition p75NTR expression levels are increased after insult to the nervous system, and have been tightly correlated with the induction of apoptosis (Bagum et al., 2001; Casha et al., 2001; Dowling et al., 1999; Kokaia et al., 1998; Martinez-Murillo et al., 1998; Oh et al., 2000; Roux et al., 1999; Syroid et al., 2000; Wang et al., 2000). Activation of cellular apoptosis occurs through two main pathways. The first such pathway is typified by the oligomerization of cell-surface pro-apoptotic TNFRs. In this scheme, ligand activation of the death receptor induces assembly of a death-inducing signaling complex (DISC) in which adaptor proteins TRADD or FADD bind directly to the receptor's death domain (DD), thereby inducing aggregation and activation of caspase-8, with subsequent activation of effector caspases (Strasser et al., 2000). In the alternative "mitochondrial" pathway, pro-apoptotic BH3-domain-only proteins of the Bcl-2 family accumulate at the mitochondria and induce pro-apoptotic Bcl-2 proteins to reduce mitochondrial integrity and cause release of cytochrome C, IAF and Smac/Diablo into the cytoplasm (Anderson and Tolkovsky, 1999; Gross et al., 1999; Harris and Johnson, 2001). Cytochrome C and Smac/Diablo facilitate Caspase-9 activation and thereby initiate the caspase cascade. The two pathways are not mutually exclusive, as Caspase-8 activation can lead to cleavage of Bid, a BH3-domain-only protein, which in turn leads to activation of the mitochondrial death pathway (Zha et al., 2000). There is evidence that p75NTR-dependent apoptosis occurs via the mitochondrial apoptotic pathway. It has been shown that Caspase-9, but not Caspase-8, is induced during p75NTR-dependent apoptosis (Gu et al., 1999; Wang et al., 2001). Further, we 14 have also shown that p75NTR-dependent apoptosis results in mitochondrial cytochrome C release (Bhakar et al., 2003, submitted). Numerous studies of neuronal apoptosis, using models of trophic factor deprivation, suggest that p75NTR-mediated death follows a mitochondrial pathway. In NGF-deprived sympathetic neurons, loss of Trk-mediated survival signals promotes the activation of molecules that result in loss of mitochondrial integrity, activation of caspase-9 and cell death. Early studies from Eugene Johnson's group demonstrated that apoptosis induced by NGF deprivation required both transcription and translation (Martin et al., 1988). More recently, it has been shown that the c-Jun amino-terminal kinase (JNK) cascade and c-Jun-mediated transcription play a crucial role in mitochondrial cytochrome C release, caspase-9 activation and apoptosis in NGF-deprived sympathetic neurons (Bruckner et al., 2001; Deshmukh and Johnson, 1998; Deshmukh et al., 1996; Eilers et al., 2001; Harding et al., 2001; Martinou et al., 1999; Putcha et al., 1999). The upstream signaling leading to JNK activation after neurotrophin withdrawal appear to involve the small GTPases Cdc42 and Racl (Bazenet et al., 1998), which when activated, bind the CRIB motif of MAPKKKs such as GCK, MEKK1-4 and MLK2-3 (Fan et al., 1996; Hirai et al., 1996; Rana et al., 1996; Sakuma et al., 1997; Tibbies et al., 1996). Activated MAPKKKs then phosphorylate and activate MKK4/7 (Xu et al., 2001), MAPKK's that phosphorylate and activate specific JNK isoforms (Bruckner et al., 2001; Sakuma et al., 1997). Once phosphorylated by activated JNK, c-Jun binds the promoters of genes with appropriate AP-1 elements and induces transcription. The precise targets of c-Jun necessary for induction of apoptosis have been the subject of intense interest, and recently, Bim and Hrk/Dp5, both BH3-domain-only proteins, have been identified as 15 pro-apoptotic genes induced by c-Jun in both sympathetic neurons deprived of NGF and in cerebellar granule neurons deprived of KC1 (Harris and Johnson, 2001; Putcha et al., 2001; Whitfield et al., 2001). There is reason to believe that p75NTR is involved in activation of the apoptotic signaling induced by neurotrophin withdrawal. Reduced expression of p75NTR in sensory neurons (Barrett and Bartlett, 1994) or in differentiated PC12 cells (Barrett and Georgiou, 1996) is correlated with reduced apoptosis upon neurotrophin deprivation, whereas increased p75NTR expression levels accelerates death following NGF withdrawal (Barrett, 2000). Recently, it has also been shown that p75NTR facilitates apoptosis in neonatal sympathetic neurons derived from TrkA-/-mice (Majdan et al., 2001), suggesting that p75NTR signals autonomously during neurotrophin withdrawalmediated death. There are several similarities that occur during p75NTR-mediated and trophicfactor-mediated apoptosis. Rac is induced in oligodendrocytes undergoing p75NTRmediated death and dominant-negative Rac blocks this death (Harrington et al., 2002). p75NTR-mediated apoptosis correlates with activation of JNK or c-Jun in oligodendrocytes (Casaccia-Bonnefil et al., 1996; Yoon et al., 1998), sympathetic neurons (Aloyz et al., 1998; Bamji et al., 1998), hippocampal neurons (Friedman, 2000) and PC 12 cells (Roux et al., 2001). Dominant-negative JNK or chemical inhibitors of JNK can block this p75NTR-induced death (Friedman, 2000; Harrington et al., 2002). And finally, as stated above, p75NTR activation results in mitochondrial cytochrome C release and selective activation of Caspase-9 (Bhakar, et al., 2003, submitted; Gu et al., 1999; Wang etal., 2001). 16 Recent work done in the Barker laboratory has examined the signaling pathways activated by the p75NTR interactor, NRAGE (Salehi et al., 2002). This data shows that NRAGE induces apoptosis through a mitochondrial death pathway involving cytochrome C release and activation of Caspase-9, -3 and -7. Further, NRAGE-induced apoptosis correlated with an MLK-independent activation JNK and its downstream target, c-Jun. Blockers of JNK activity or of c-Jun mediated transcription strongly inhibited NRAGEmediated caspase activation and apoptosis. NRAGE is the first reported p75NTRinteracting protein to induce cell death through the activation of JNK. It remains to be defined, however, what links p75NTR- and NRAGE- dependent c-Jun-mediated transcription to mitochondrial cytochrome C release. While p75NTR is well known to initiate cell death pathways, in some cases, it has been shown to promote cell survival. Neurotrophin binding to p75NTR has been reported to promote survival of developing neocortical subplate neurons (DeFreitas et al., 2001), and NGF binding to p75NTR has been shown to promote survival of a Schwannoma cell line (Gentry et al., 2000), sensory neurons (Hamanoue et al., 1999), human breast cancer cells (Descamps et al., 2001) and cultured Schwann cells (Khursigara et al., 2001). In addition, a mutant NGF which bound only p75NTR and not Trk A has been shown to inhibit apoptosis in serum-deprived PC 12 cells (Hughes et al., 2001). The mechanisms by which p75NTR-dependent survival occurs remain poorly understood, but several studies indicate that p75NTR increases cell survival through PI3kinase and Akt activation (DeFreitas et al., 2001; Descamps et al., 2001; Roux et al., 2001). 17 The p75NTR knockouts In mice, the p75NTR gene contains six exons that span 18 kilobases of Chromosome 11 (Radeke et al., 1987). The gene encodes a 3.4 kb mRNA with a 5' untranslated region of about 300 nucleotides, and a ~2000 nucleotide 3' untranslated region that contains a single consensus polyadenylation signal (Johnson et al., 1986). The third exon, encoding CRDs 2 to 4 (the region responsible for neurotrophin binding), and the fourth exon, encoding the stalk region of the extracellular domain and the transmembrane domain, have both been targeted for deletion to create mice that are deficient for p75NTR expression (Lee et al., 1992; von Schack et al., 2001)(see also Figure 2). These mice have been useful for determining aspects of p75NTR function in vivo. p75NTRExonI11 -/- mice In 1992, Lee and colleagues (Lee et al., 1992) constructed a p75NTR knockout mouse in which the third exon of the p75NTR locus was targeted for deletion (p75NTRExonIU -/-). In order to generate these mice, a replacement type targeting vector consisting of a pGK-Neo cassette (a hybrid gene consisting of the phosphoglycerate kinase I promoter driving the neomycin phosphotransferase gene) was inserted into Exon III, and recombined such that the targeted p75NTR gene contained the pGK-Neo cassette in the same direction as the p75NTR gene, and a deleted portion of Exon III. The mutant animals displayed a complex phenotype with deficits in cutaneous innervation and heat sensitivity, that lead to development of ulcers in the distal extremities. Early studies showed that neonatal sympathetic and embryonic sensory neurons derived from these 18 animals had reduced sensitivity to NGF and deficits in developmental and injury-induced apoptosis (Davies et al., 1993; Lee et al., 1994). Despite the neuronal phenotype, recent studies indicate that p75NTRExonI"-/- mice are not fully deficient for p75NTR expression (Dechant and Barde, 1997; von Schack et al., 2001). These studies show that the p75NTR locus produces an alternatively spliced isoform of p75NTR (s-p75NTR) that lacks Exon III. Alternative splicing of Exon III occurs in both wild-type and p75NTRExonln-/- mice, and produces a protein product that lacks the portion of the extracellular domain responsible for neurotrophin binding. Given this recent data, interpretations from studies with the p75NTRExonl"-/- mice should be viewed with caution, in light of the potential signaling capabilities of sp75NTR. Alternatively, there is little data showing that s-p75NTR signals in either wildtype or p75NTRExonI11-/- mice, and the expression of s-p75NTR in a number of neuronal and non-neuronal tissues remains the subject of intense controversy. Only one group has shown the presence of s-p75NTR, and its presence has only been detected in whole brain lysates and in Schwann cell extracts (Naumann et al., 2002; von Schack et al., 2001). However, a multitude of studies have described neuronal and non-neuronal deficits in p75NTRExonI11-/- mice, suggesting that at the very least, neurotrophins binding to p75NTR, or CRDs 2-4, are a critical requirement for its function. I will summarize the data pertaining to p75NTR's interaction with TrkA and NogoR, and its apoptotic potential in the p75NTRExon1"-/- mice in the following paragraphs. One function ascribed to p75NTR is enhancement of NGF binding to TrkA, and several in vitro studies have shown that co-expression of p75NTR with TrkA produces high-affinity NGF binding sites and enhanced TrkA activation (Roux and Barker, 2002). This enhancement of TrkA activation is also observed at low concentrations of NGF (Hantzopoulos et al., 1994; Verdi et al., 1994). This function is purported to be important during development, when subsaturating levels of neurotrophin are required to support 19 survival of neurons are released from target organs. In keeping with this hypothesis, p75NTRExonI11-/- mice have deficits in sensory and sympathetic innervation (Lee et al., 1994; Lee et al., 1992) that correlate with reduced neurotrophin responsiveness to Trk. However, other data indicates that TrkA activation is not substantially altered in sympathetic neurons from either wild-type of p75NTRExonI11-/- mice (Majdan et al, 2001). Since these sympathetic neurons did not appear to express s-p75NTR, the conclusion from these experiments is that p75NTR is not required for optimal TrkA activation. Thus, given the disparity between these results, it is still unclear whether p75NTR is required in vivo to create high-affinity NGF-TrkA binding, and concomitant TrkA activation. Recent reports have shown that p75NTR mediates the growth inhibitory effects of the myelin inhibitory proteins MAG and Nogo through an interaction with the Nogo receptor. Many of these studies have used the p75NTRExonI0-/- mice to show that they do not respond in the same manner as wild-type mice to the myelin inhibitors (Wang et al., 2002; Yamashita et al., 2002; Yamashita and Tohyama, 2003). In the wild-type mice, neurite growth from dissociated postnatal dorsal root ganglia (DRGs) and cerebellar neurons (CGNs) was inhibited upon addition of myelin inhibitors. In contrast, DRGs and CGNs from p75NTRExonI11-/- mice showed no growth inhibition, indicating that FLp75NTR is required for MAG-induced growth inhibition. If these neurons express sp75NTR, the results from these studies also show that CRDs 2-4 are required for the interaction between NgR and p75NTR that mediates the growth inhibition. Would pretreatment with neurotrophins (which also bind p75NTR at CRDs2-4) ablate the interaction with NgR, and subsequent growth inhibition in wild-type mice? Wang et al performed experiments in which high concentrations of NGF and BDNF was added to wild-type DRGs prior to addition of myelin inhibitors (Wang et al., 2002), but there was no effect on growth inhibition in these circumstances. In vitro co-immunoprecipitations of s-p75NTR and NgR may help to resolve this outstanding issue. 20 Nonetheless, the fact that p75NTRexonI"-/- mice showed aberrant neurite outgrowth in response to the myelin inhibitors was in keeping with several groups' findings showing that they also exhibit perturbed developmental axon growth (Lee et al., 1994; Walsh et al., 1999a; Walsh et al., 1999b). One notable study using two lines of transgenic mice overexpressing NGF in CNS astrocytes in the presence and absence of the p75NTRexon111 mutation observed enhanced sympathetic axon growth in the myelinated portions of the cerebellum where NGF was highly expressed only in the p75NTRexonI11 mice (Walsh et al., 1999a). The reasons for this aberrant outgrowth were not immediately apparent, though the authors proposed that p75NTR may directly activate intracellular signaling pathways leading to outgrowth. In support of this hypothesis, Riopelle's group had published seemingly incongruous results demonstrating that injection of a peptide identical to a portion of the p75NTR cytoplasmic domain into embryonic sensory neurons enhanced neurite outgrowth (Dostaler et al., 1996). This peptide was identical to the amphiphilic peptide, mastoparan, a component of wasp venom that was known to activate guanine nucleotide-binding regulatory proteins, including Rho (Koch et al., 1991). This study implicated a role for a highly conserved motif of p75NTR in neurite growth through Rho, and a subsequent yeast-two hybrid study showed that p75NTR interacted with RhoA (Yamashita et al., 1999), though recent data indicates that this is not a direct interaction, as described above (Yamashita and Tohyama, 2003). In addition to their aberrant neuritic growth, p75NTRExonI11-/- mice also display reduced developmental and injury-induced apoptosis. Mice lacking ngf alleles or bearing the p75NTRExonin deletion have reduced apoptosis in the developmental retina and spinal cord, as assessed by TUNEL staining (Frade and Barde, 1999), indicating that a significant proportion of the early cell death observed in these tissues are mediated by NGF acting through p75NTR. p75NTRExonin -/- mice also have supernumerary sympathetic neurons during the neonatal period (Bamji et al., 1998), indicating that 21 p75NTR mediates cell death in vivo in these developing neurons. Further, it has been shown that p75NTRExonin deletion leads to small but statistically significant increases in the number of basal forebrain cholinergic neurons (Naumann et al., 2002), though the effect is highly dependent on different mice strains, which appear to differentially express s-p75NTR. p75NTR expression levels increase after nervous system injury in a manner that is correlated with increased apoptosis (Roux and Barker, 2002), and p75NTRExonI11 -/mice have been found to have reduced apoptosis following injury in many experimental models (Beattie et al., 2002; Ferri and Bisby, 1999; Ferri et al., 1998). To summarize, p75NTRExonI"-/- mice are not fully deficient for p75NTR expression, though they exhibit a number of aberrant characteristics with regards to neurite outgrowth and developmental and injury-induced apoptosis. Determining the temporal and spatial expression pattern of s-p75NTR in these mice remains a crucial requirement for not only assigning a function to s-p75NTR but also for interpreting results obtained using p75NTRExon111-/- mice. A mouse that is fully deficient for p75NTR is a absolute prerequisite for understanding the functions of this receptor. 22 p75NTRExonIV -/- mice To produce animals that were fully deficient for p75NTR expression, von Schack and colleagues targeted the fourth exon of the p75NTR locus to generate p75NTRExonIV-/mice (von Schack et al., 2001). Disruption of the reading frame was achieved by insertion of the pGK-Neo cassette in the reverse orientation to the p75NTR locus in an AatH restriction site at the 5' end of Exon IV. These animals produce neither full-length p75NTR (FL-p75NTR) nor s-p75NTR and exhibited more severe nervous system defects than p75NTRExon1"-/- mice. These defects included a larger reduction in the number of DRG neurons and Schwann cells compared with p75NTRExonI11-/- mice, though no aberrant phenotype was described for the sympathetic nervous system. Targeting of the p75NTR locus in Exon IV lead to reduced body size and hind limb ataxia (due to decreased sensory innervation). About 40% of p75NTRExonIV-/- mice do not survive beyond the perinatal period, and this was attributed to severe vascular defects, including aortic wall ruptures. This was the first report suggesting that p75NTR was important for the development of vascular tissues. The same group that created the p75NTRExonIV-/- mice went on to study the number of basal forebrain cholinergic neurons in comparison with p75NTRExonI11-/- mice. This study found that the p75NTRExonIH mice, which could express s-p75NTR, lead to a moderate increase in the number these neurons, while the p75NTRExonIV mutation, which prevents expression of both FL p75NTR and s-p75NTR, resulted in a more substantial increase in basal forebrain cholinergic neurons compared to wild-type mice (Naumann et al., 2002). The inference was that FL-p75NTR expression normally mediates developmental apoptosis in this neuronal population and that loss of FL-p75NTR results 23 in less cell death with subsequent increases in the number of these neurons. This study also suggested that s-p75NTR could partially compensate for loss of FL-p75NTR, although the authors never showed that s-p75NTR was expressed in the basal forebrain cholinergic neurons. Statements of projects/hypothesis I pursued two distinct projects in my M.Sc. research. Firstly, I examined the transcriptional activation of genes downstream of c-Jun during p75NTR-dependent apoptosis. Two pieces of evidence suggested that p75NTR-mediated death results in transcriptional activation of BH3-domain-only genes. Firstly, the transcription factor cJun is activated during p75NTR-dependent cell death in many cell types (Aloyz et al., 1998; Bamji et al., 1998; Casaccia-Bonnefil et al., 1996; Friedman, 2000; Roux et al., 2001; Yoon et al., 1998) and secondly, it has been shown that c-Jun can mediate transcription of BH3-domain-only protein Bim and Hrk in neurons undergoing apoptosis induced by trophic factor deprivation (Harris and Johnson, 2001; Putcha et al., 2001; Whitfield et al, 2001). Given these data, I hypothesized that distinct BH3-domain-only genes were transcriptionally activated during p75NTR-mediated apoptosis. Using a gainof-function approach in which adenovirus expressing p75NTR was infected into different neuronal cell types to constitutively activate p75NTR pathways, my specific aim was to determine by RT-PCR the specific BH3-domain-only genes transcribed as a function of p75NTR-dependent JNK activation. My second project was to examine the recently created p75NTRExonIV-/- mice for full deletion of all p75NTR gene products. It had previously been shown that targeting 24 Exon III of p75NTR for deletion resulted in a mouse that continued to express a p75NTR gene product, through endogenous splicing of Exonlll (von Schack et al., 2001). In order to verify that the p75NTRExonlv-/- mice were fully deficient for p75NTR expression, I used immunoblotting and RT-PCR techniques to analyse whether portions of the extracellular or intracellular domains of p75NTR were maintained in these newly created p75NTRExonlv-/- mice. 25 Preface to Chapter 2 A multitude of in vitro and in vivo studies support a role for p75NTR in both developmental and injury-induced apoptosis, though the signals involved in p75NTRmediated cell death are uncertain. p75NTR-dependent apoptosis is associated with an increase in Rac and JNK activity and recent work from our laboratory has shown that the p75NTR interactor, NRAGE, activates a mitochondrial death pathway involving JNKdependent cytochrome C release and activation of Caspase-9, Caspase-7 and Caspase-3. Despite this progress, several important details of p75NTR apoptotic signaling remain unknown. In particular, the targets of p75NTR-dependent JNK activation that result in mitochondrial cytochrome C release remain uncertain. BH3-domain-only proteins are members of the Bcl-2 family that induce the association of Bax and Bak which in turn facilitate release of Cytochrome c into the cytosol. Transcriptional activation of BH3domain-only proteins through c-Jun or p53 dependent pathways mediates Cytochrome C release in some neuronal models of apoptosis. In this chapter, I examined whether p75NTR-induced apoptosis was correlated with accumulation of BH3-domain-only gene products. U373 cells and cortical neurons were infected with LacZ or p75NTR adenovirus and alterations in mRNA levels of BH3-domain-only family members Bim, Bmf, Hrk, Bik, Puma, and Noxa were examined by RT-PCR. The results from these experiments showed that p75NTR-dependent apoptosis did not result in BH3-domainonly gene transcription. Further studies in our laboratory have subsequently established that the BH3-domain-only protein, Bad, is phosphorylated on Serine 128 in a JNKdependent manner, and that this phosphorylation is a critical component of p75NTRdependent apoptosis. 26 Chapter 2: p75NTR does not transcriptionally activate BH3-only proteins 27 Literature Review: the BH3-domain-only proteins Studies over the last six years have identified the BH3-domain-only proteins as key initiators of apoptosis (Huang and Strasser, 2000). These members of the Bcl-2 protein family are crucial regulators of caspase activation, which function by inducing the release of cytochrome C and Smac/Diablo from the mitochondria, an event that preceeds Caspase-9 activation. Bcl-2 family members are defined functionally as either proapoptotic or anti-apoptotic based on their ability to kill or protect cells in vivo or in culture (Strasser et al., 2000). The anti-apoptotic Bcl-2 proteins include mammalian Bcl2, Bcl-w, Bcl-XL and CED-9, the Bcl-2 homolog in C. Elegans, and generally contain four Bcl-2 Homology domains, BH1-4. Proapoptotic Bcl-2 proteins can be divided into two groups: the multidomain Bcl-2 proteins and the BH3-domain-only proteins. The multidomain pro-apoptotic proteins include mammalian Bax, Bak and Bod, and contain BH1-3. To date, eight mammalian BH3-domain-only proteins have been identified, mainly through protein interaction assays with Bcl-2 or Bcl-XL, and include Bik/NBK, Bad, Bid, Hrk/Dp5, Bim, Bmf, PUMA, NOXA/bbc3 and EGL-1 in C. Elegans. Each contain the third BH domain and most contain a mitochondrial targeting motif near the Cterminus . The amphipathic a-helix formed by the BH3 domain of both the BH3domain-only and the "Bax-like" multidomain Bcl-2 proteins can bind to an elongated cleft formed by BH domains 1-3 of the anti-apoptotic Bcl-2 proteins. It is this interaction between the BH3-domain-only proteins with anti-apoptotic Bcl-2 proteins that sequesters these latter molecules, and then allows pro-apoptotic Bcl-2 proteins to multimerize and facilitate cytochrome C release (Nicholson and Thornberry, 1997). The pro-apoptotic activity of the BH3-domain-only proteins is regulated by both 28 transcriptional and post-translational mechanisms that work to prevent inappropriate cell death. Transcriptional control-Some of the BH3-domain-only proteins have been shown to be trancriptionally upregulated during apoptosis. A subset of these include PUMA/bbc3 (Yu et al., 2001) and NOXA (Oda et al, 2000), which have been identified as target genes for p53, a transcription factor that mediates apoptosis in response to stimuli including DNA damage, and which has also been reported to be necessary for p75NTR-dependent apoptosis in sympathetic neurons (Aloyz et al., 1998). The mRNA for these genes has been shown to be upregulated when exposed to death stimuli known to induce p53, and both genes have potential p53-recognition sequences within the promoter region (Huang and Strasser, 2000). Other BH3-domain-only proteins have been shown to be transcriptionally upregulated specifically during neuronal apoptosis. For instance, Hrk/Dp5 is upregulated in rat sympathetic neurons deprived of NGF (Imaizumi et al., 1997), and in rat cortical neurons exposed to amyloid |3-protein (Imaizumi et al., 1999). Bim is also trancriptionally upregulated during neuronal apoptosis. Rodent sympathetic neurons deprived of NGF (Eilers et al., 2001; Putcha et al., 2001) and cerebellar granule neurons deprived of KC1 (Harris and Johnson, 2001) all display increased Bim mRNA and protein levels. This process involves c-Jun and its upstream regulatory pathway, JNK, which can act to induce transcription of Bim and Hrk/Dp5 genes in neurons undergoing apoptosis as a result of growth factor deprivation (Harris and Johnson, 2001; Whitfield et al, 2001). The regulation of BH3-domain-only proteins during neuronal apoptosis induced by trophic factor deprivation appears complex, especially in light of a number of several 29 recent studies (Harris and Johnson, 2001; Putcha et al., 2001; Whitfield et al., 2001). As stated, the BH3-domain-only proteins Bim and Hrk are transcriptionally upregulated in neurons undergoing trophic factor deprivation and this event is partially mediated by the JNK pathway. A handful of recent studies show that JNK may also regulate BH3-onlyproteins Bim, Bad and Bmf by phosphorylation during neuronal apoptosis (Biswas and Greene, 2002; Donovan et al., 2002; Lei et al., 2002; Putcha et al., 2003), suggesting that c-Jun may be only one of a number of JNK targets. Since p75NTR-mediated apoptosis correlates with a number of the same molecules as those activated during trophic factor deprivation (discussed in Chapter 1), it is possible that p75NTR regulates the BH3domain-only proteins in much the same way as that described above. Post-translational control-Some BH3-domain-only proteins are maintained in an inactive form, but become activated following apoptotic stimuli. For example, Bad is maintained in a hyperphosphorylated form in healthy cells, where it is sequestered by the scaffold protein, 14-3-3 (Zha et al., 1996). Prosurvival stimuli such as neurotrophins and growth factors trigger phosphorylation of Bad at Serines 112 and 126, thereby inducing sequestration of Bad with 14-3-3 (Blume-Jensen et al., 1998; Datta et al., 1997; del Peso et al., 1997; Zha et al., 1997). However, upon apoptotic stimuli, Bad is phosphorylated at an additional site, Serine 128, a crucial step in its dissociation from 14-3-3 and subsequent translocation to the mitochondria (Konishi et al., 2002). Both Bim and Bmf are controlled post-translationally. Both of these BH3-only proteins are normally associated with the cytoskeleton, Bim interacting with the LC8 cytoplasmic dynein light chain (Puthalakath et al., 1999) and Bmf interacting with myosin V (Puthalakath et al., 2001). Upon different apoptotic stimuli, these proteins 30 dissociate from their cytoskeletal partner and translocate to the mitochondria. Recent work also shows that phosphorylation of Bim and Bmf potentiates their apoptotic ability (Biswas and Greene, 2002; Lei and Davis, 2003; Putcha et al., 2003). Finally Bid, which normally resides in the cytosol, is activated by Caspase-8 cleavage in a Fas-mediated pathway (Li et al., 1998; Luo et al., 1998; Wang et al., 1996). This cleavage generates a 15kDa C-terminal fragment, termed tBid, which becomes N-myristolated and can then translocate to the mitochondria (Zha et al, 2000). This latter pathway may amplify rather than initiate the caspase cascade. Statements of projects/hypothesis Given the similarities between apoptotic signals induced by trophic factor deprivation in neurons and p75NTR activation (discussed in Chapter 1), it is possible that BH3-domain-only proteins are transcriptionally activated through the JNK pathway during p75NTR-mediated apoptosis. I hypothesize that p75NTR apoptotic signaling leads to increases in mRNA and proteins levels of specific BH3-domain only proteins. Further, I hypothesize that transcription of these BH3-domain-only proteins requires JNK activity and c-Jun mediated transcription. In order to test these hypotheses, an adenoviral system was used in which p75NTR was reproducibly introduced into a variety of heterologous cells to constitutively activate p75NTR apoptotic signaling pathways. 31 Materials and Methods Cell culture and infection. The human glioma (U373) cell line was provided by Dr. R. Del Maestro and maintained in 5% C0 2 at 37° C in either Dulbecco's modified Eagle's medium (DMEM) or RPMI medium and supplemented with 10% fetal calf serum (FCS, Clontech), 2 mM L-glutamine, 100 jig/ml penicillin/streptomycin. The rat pheochromocytoma cell line, PC 12, was maintained as previously described (Roux et al., 2001) and the PC12rtTa cell line (PC 12) was purchased from Clontech and maintained in 10% C0 2 at 37° C in DMEM supplemented with 10% FCS, 5% horse serum, 2 mM Lglutamine, 100 pg/ml penicillin/streptomycin and 100 pg/ml G418. Cell lines were plated 18 to 24 hours prior to infection and harvested 24 hours after infection. Primary cortical cultures were prepared from E14-16 CD1 mouse telencephalon as described previously (Bhakar et al., 2002). Neuronal cultures were infected prior to plating and then maintained in vitro for 24 hours in Neurobasal media (Life Technologies) supplemented with IX B27 supplement (Life Technologies), 2mM L-glutamine, and 100 u.g/ml penicillin/streptomycin. Semiquantitative R T-PCR. 450,000 U373 cells or primary cortical neurons were infected with virus and 24 hours later mRNA was isolated using the RNEasy Mini kit according to the manufacturer's instructions (Qiagen). cDNA was generated using the Omniscript RT kit (Qiagen) and random hexamers (Roche) as primers. PCR was performed for 30 cycles using 300 nM of the following primers for U373 cells: (3-actin sense, 5'CACCACTTTCTACAATGAGC; antisense, 5'03Cn?CAC<jATCITCATGAGG; hBIMEL sense, 5'TGGCAAACCAAa^ITCTGATG; antisense, 5'AGTCGTAAGATAA(XATTU3TGGG; 32 hBMF sense, 5'(HTC<nxnOGCTGACCTGTTTG; antisense, 5'AAGCa}ATAGCCAGCATTGC; hHrk/Dp5 sense, 5'TCGGCAC<jCC<3AACrTGTAG; antisense, 5'GCKJTATGTAAATAGCATTGGGGTG; hBIK sense, 5'AACCCCGAGATAGTGCTGGAAC; antisense, 5'GCTGGAAACCAACATTTTATTGAGC; hPUMA sense, 5'ACTGTGAATCCTGTGCIXTGCC; antisense, 5'ACCCCCCAAATGAATGCCAG; hNOXA sense, 5'CCAAACTCTTCTGCTCAGGAACC; antisense, 5'COJrAATCITCGGCAAAAACAC For mouse cortical neurons, PCR was performed using the same conditions as above using the following primers for certain human sequences: mBimEL sense, 5'CCCCTACCTCCCTACAGACAGAA; antisense, 5'CCAGACGGAAGATAAAGCGTAACAG; mBMF antisense, 5'GTTGCGTATGAAGCCGATGG; mHrk/Dp5 sense, 5'TGGAAACACAGACAGAGGAAGCC; antisense, 5'AAAGGAAAGGGACCACCACG; mBIK sense, 5'TCACCAACCTCAGGGAAAACATC; antisense, 5'AGCAGGGGTCAAGAGAAGAAGG; mNOXA sense, 5'TGATGTGATGAGAGAAA(DGCTCG; antisense, 5'AAAC<:AATCCCAAACGACTGCC; p75NTR sense, 5'TGAATTCTGGAACAGCTGCAAAC; antisense, 5'CCTTAAGT<^CACTGGGGATGTG; NRAGE sense, 5'GCACCCCCTAATGTGClXTrcA(XTAATC^ antisense, 5'GAACKnGCAGTCCAGTC. For PCR analysis, 5% of the cDNA prepared was used in a 25ul PCR reaction; all of the reaction was separated on a 10% polyacrylamide gel, and PCR products were visualized under UV light. 33 Results Transcriptional activation of BH3-domain-only genes through JNK- and p53dependent pathways is involved in apoptosis in neuronal and non-neuronal models and we therefore tested whether p75NTR-induced apoptosis was correlated with accumulation of BH3-domain-only gene products. To induce p75NTR-dependent apoptosis, a gain-of-function approach was used in which recombinant adenovirus expressing p75NTR was introduced into a variety of cell lines. Primary mouse cortical neurons, Pheochromocytoma PC 12 cells and U343 and U373 glioma cells all showed reductions in viability as assessed by MTT survival assay when infected with p75NTR adenovirus, whereas infection with control adenovirus expressing (3-galactosidase (LacZ) had no significant effect (Figure I, Appendix). Cortical neurons and U373 cells were infected with either p75NTR or control adenovirus (LacZ or GFP) and alterations in mRNA levels of the BH3-domain-only family members Bim, Bmf, Hrk, Bik, Puma, and Noxa were determined by RT-PCR. mRNA corresponding to each of these family members were readily detected in both U373 cells (Figure 1A) and in cortical neurons (Figure IB). However, p75NTRdependent alterations in mRNA levels of the BH3-domain-only family were not detected (Figure 1A & B). These results indicated that p75NTR apoptotic signaling occurs in the absence of BH3-domain-only transcriptional activation, and suggests that alternate pathways lead to p75NTR-induced mitochondrial cytochrome C release and caspase activation (Figure 2, Appendix). 34 Closing Remarks BH3-domain-only proteins inhibit the action of anti-apoptotic Bcl-2 family members such as Bcl-2 and Bcl-XL and facilitate the release of cytochrome C, a prerequisite for caspase activation in the mitochondrial apoptotic cascade. The regulation of these proteins is now recognized as a crucial step in the apoptotic pathway. In sympathetic neurons and cerebellar granule neurons, JNK activation results in phosphorylation of c-Jun which in turn results in transcription of the BH3-domain only family members Bim and Hrk (Harris and Johnson, 2001; Putcha et al., 2001; Whitfield et al., 2001), whereas in other systems, p53 activation results in transcription of BH3domain-only family members, Noxa and Puma (Oda et al., 2000; Yu et al., 2001). It was hypothesized that p75NTR-dependent apoptosis, which results in JNK activation, involved transcriptional regulation of the BH3-domain only family members. However, although p75NTR induced JNK-dependent apoptosis in the cell types analyzed, we found no evidence for transcriptional regulation of BH3-domain only family members. Some BH3-domain-only proteins are contitutively expressed, but are inactive due to sequestration by other proteins. For example, the BH3-domain-only protein Bad binds to scaffold protein, 14-3-3, and Bim and Bmf are sequestered to components of the cytoskeleton (Puthalakath et al., 1999; Puthalakath et al., 2001; Zha et al., 1996). Antiapoptotic stimuli, such as growth factors and neurotrophins can render constitutively expressed BH3-domain-only family members inactive by promoting these protein-protein interactions (Datta et al., 1997; del Peso et al., 1997). Recent findings have also demonstrated that the sequestration of Bim, Hrk and Bad can be negatively regulated by JNK (Biswas and Greene, 2002; Donovan et al., 2002; Lei and Davis, 2003; Putcha et al., 35 2003). JNK-dependent phosphorylation of Bad on Serine 128 allows it to dissociate from 14-3-3 and contribute to apoptosis (Donovan et al., 2002). Similarly, UV irradiation of HEK293 cells results in JNK-dependent phosphorylation of Bmf and Bim releasing these proteins from their cytoskeletal binding partners and allowing them to exert their function at the mitochondria (Lei and Davis, 2003). While BH3-domain-only proteins do not appear to be subject to transcriptional regulation during apoptosis induced by p75NTR, subsequent work in our laboratory established that p75NTR-mediated death correlated with the phosphorylation and accumulation of a higher molecular weight species of the BH3-domain-only protein, Bad (Figure 8, Appendix). This product was cross-reactive with Bad antibodies raised against two distinct epitopes as well as the anti-pSerine 128 Bad and therefore likely represents phospho-Serinel28-Bad within a stable oligomeric complex. Further work established that JNK activity contributes to this p75NTR-dependent Bad phosphorylation, since infection of PC 12 cells with adenovirus expressing both p75NTR and a dominantnegative JNK contruct (encoding the JNK-binding domain of JIP) prevented formation of the Bad oligomeric complex (Figure 8, Appendix). Finally, PC 12 cells transfected with a dominant negative Bad Serine 128 construct that was previously described (Konishi et al., 2002), and then infected with p75NTR, were significantly protected from p75NTRinduced apoptosis (Figure 9, Appendix), indicating that the JNK-Bad pathway is important for p75NTR-induced death. Our data show that p75NTR induces JNK-dependent phosphorylation and oligomerization of Bad. Furthermore, loss-of-function experiments using dominant negatives and RNA interference demonstrated a role for Bad in p75NTR-induced 36 apoptosis. These findings link cell surface receptor activation to the post-translational regulation of BH3-domain-only family members and indicate how p75NTR-dependent JNK activation can contribute to apoptosis. 37 Figure Legends Figure 1. p75NTR does not transcriptionally regulate BH3-domain-only proteins. A. Cortical neurons were infected with 0, 50, or 200 MOI of adenovirus encoding figalactosidase (LacZ) or p75NTR (p75) and 24 hours later mRNA was isolated as described in Materials and Methods. cDNA was generated and then PCR was performed using primers directed against Bim, Bmf, Hrk, Bik, Puma, Noxa, p75NTR and Actin as indicated. The multiple bands in the Bim RT-PCR reflect different isoforms, BimEL, BimL and Bims. B. Human glioma U373 cells were infected with 0 or 100 MOI of adenovirus encoding Green Fluorescent Protein (GFP) or p75NTR (p75) and analysed as described above. p75NTR expression in these experiments was verified by immunoblot (data not shown). 38 LacZ p75 B GFP p75 0 100 100 0 50 200 50 200 Bim Bmf W^^^W • ^ • ' V (PtawP M*V Hrk kW Uw i,J LJ Bik **w kari Iw4 * w Puma Puma Noxa ^;..|r^ ^ J p75NTR Actin Figure 1 39 Preface to Chapter 3 p75NTR functions include enhancing Trk receptor signaling, interacting with the Nogo receptor to mediate neuritic growth inhibition, and initiating autonomous signaling cascades that regulate growth, survival and apoptosis. The generation of animals that lack p75NTR expression has been a critical advance in understanding the in vivo role of this receptor. Recent studies have indicated that disruption of Exon IV produces a null mouse lacking all p75NTR gene products (p75NTRExonlv-/-) whereas mice containing a disruption of Exon III (p75NTRExonI11-/-) show no full-length p75NTR expression yet maintain expression of an alternatively spliced form of p75NTR (s-p75NTR)(von Schack etal.,2001). In this chapter, our initial characterization of the p75NTRExonIV-/- mice revealed that they express a p75NTR gene product that encodes a truncated protein containing the extracellular stalk region together with the entire transmembrane and intracellular domains. The gene product is initiated from a cryptic Kozak consensus/initiator ATG sequence within a region of Exon IV located 3' to the pGK-Neo insertion site, likely as a result of enhancer elements within the inserted pGK-Neo cassette. Characterization of the protein product indicated that it was localized to the plasma membrane. Overexpression of this fragment in heterologous cells resulted in activation of JNK and cleavage of Procaspase 3, indicating that it can mediate pro-apoptotic effects in vivo. These results indicate that aspects of the p75NTRExonIV/"phenotype may reflect a gain-offunction mutation rather than a loss of p75NTR function. 40 Chapter 3: A pro-apoptotic fragment of the p75 neurotrophin receptor is expressed in P75NTRExonJV null mice 41 A pro-apoptotic fragment of the pir5 neurotrophin receptor is expressed in p75NTRExonIV null mice Christine E. Paul and Philip A. Barker Centre for Neuronal Survival, Montreal Neurological Institute, McGill University, 3801 University Ave, Montreal, Quebec, H3A 2B4 Running title: Aberrantp75NTR expression inp75NTRExmUV-/-mice Number of text pages: 16 Number of words: Abstract: 131 Introduction: 464 Discussion: 421 Total characters: 25,626 Number of figures: 3 Correspondence: Philip A. Barker Montreal Neurological Institute McGill University 3801 University Ave Montreal, Quebec, Canada, H3A 2B4 Phone:(514)-398-3064 Fax: (514)-398-5214 Email: [email protected] 42 Acknowledgements We gratefully acknowledge the technical assistance of Genevieve Dorval, Kathleen Dickson and Asha Barker in colony maintenance, genotyping, tissue dissection, and subcloning, and thank Wayne Sossin for helpful comments on the manuscript. The p75NTRExonlv-/- mice were a kind gift of Georg Dechant (University of Innsbruck). This work was supported by grants from the Canadian Institutes of Health Research (PAB). CEP is supported by a Natural Sciences and Engineering Research Council scholarship and PAB is a Scientist of the Canadian Institutes of Health Research. 43 Abstract The p75 neurotrophin receptor (p75NTR) binds members of the neurotrophin family and regulates neuronal survival, apoptosis and growth during development and after nervous system injury. Recent studies have indicated that disruption of p75NTR Exon IV in mice results in a p75NTR null strain gene whereas mice lacking Exon III are hypomorphs that express a p75NTR splice variant. We report that p75NTRExonlv -/- mice produce a p75NTR gene product that encodes a truncated protein containing the extracellular stalk region together with the entire transmembrane and intracellular domains. Expression of this fragment activates pro-apoptotic signaling cascades that result in cleavage of Procaspase 3, indicating that it can mediate pro-apoptotic effects in vivo. These results indicate that aspects of the p75NTRExonIV -/- phenotype may reflect a gain-of-function mutation rather than a loss of p75NTR function. 44 Introduction p75NTR is a receptor for the neurotrophins, a family of growth factors that includes nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and neurotrophin-4/5 (NT-4/5). Along with the Trk tyrosine kinase receptors, p75NTR mediates the diverse functions of the neurotrophins. The Trk receptors show neurotrophin binding specificity and are generally associated with regulation of neuronal growth, differentiation and survival. p75NTR binds all neurotrophins with approximately equal affinity and its functions include enhancing Trk receptor signaling and initiating autonomous signaling cascades that regulate growth, survival and apoptosis (Barrett, 2000; Roux and Barker, 2002). Recent work also indicates that p75NTR is a component of a receptor complex that mediates growth inhibition in response to myelin inhibitory proteins, MAG and Nogo (Kaplan and Miller, 2003; McKerracher and Winton, 2002). To address the in vivo role of p75NTR, Lee and colleagues (Lee et al., 1992) constructed a p75NTR knockout mouse in which Exon III of the p75NTR locus was targeted for deletion (p75NTRExonI11-/-). This mouse exhibited profound deficits in the peripheral nervous system, and neonatal sympathetic and embryonic sensory neurons derived from these animals showed reduced sensitivity to NGF and deficits in developmental and injury-induced apoptosis (Davies et al., 1993; Lee et al., 1994). However, recent studies indicate that the p75NTR locus produces an alternatively spliced isoform of p75NTR (s-p75NTR) that lacks Exon III (von Schack et al., 2001). This transcript, which is present in both wild type and p75NTRExonin-/- mice, produces a protein product that lacks the portion of the extracellular domain responsible for neurotrophin binding. To produce animals deficient in p75NTR expression, von Schack and colleagues targeted the fourth exon of the p75NTR gene to generate p75NTRExonIV-/- 45 mice (von Schack et al., 2001). These animals produce neither full-length p75NTR nor sp75NTR and exhibit severe nervous system and vascular system defects. About 40% of p75NTRExonlv-/- mice do not survive beyond the perinatal period. Here we report that the p75NTRExonIV-/- mice express a p75NTR gene product. This fragment has an apparent molecular weight of 26 kDa and is not observed in wildtype animals, shows moderate expression in heterozygotes and is most highly expressed in p75NTRExonIV-/- animals. RT-PCR analysis revealed that this protein expression pattern correlates with the aberrant expression of a p75NTR mRNA that is initiated 3' to the inserted pGK-neo cassette. The resulting protein encodes a portion of the extracellular stalk region, and the entire transmembrane and intracellular domains. This fragment is likely produced through utilization of an enhancer sequence within the pGK-Neo cassette inserted into Exon IV. When overexpressed, the p75NTRExon IV gene product activates p75NTR signaling cascades that result in JNK phosphorylation and Procaspase 3 cleavage. The signaling properties of this p75NTR fragment suggest that some of the phenotypes observed within the p75NTRExonIV-/- mouse may be due to gainof-function rather than loss-of-function mutations. 46 Materials and Methods Materials-Cell culture reagents were purchased from BioWhittaker unless otherwise indicated. The JNK antibody (C-17, cat #sc-474) was purchased from Santa Cruz Biotechnology and the Bcl-2 antibody (cat #6620) was purchased from BD Biosciences. Cleaved caspase-3 (Aspl75; cat #9661), phospho-Thrl83/Tyrl85 JNK (G9, cat #9255), phospho-Thr69/71 ATF-2 (cat #9225S), ATF-2 (cat #9222), and IKB (cat #9242) specific antibodies were purchased from Cell Signaling Technology. All other reagents were from Sigma or ICN Biochemicals unless otherwise indicated. Animal colonies and genotyping-The p75NTRExonI" mutation was generated as described previously (Lee et al., 1992) and mice bearing this mutation were obtained from the Jackson Laboratories and interbred on a C57BL/6 background via heterozygous matings. Genotyping for the p75NTRExonin mice was done on tail genomic DNA by PCR with primers within Intron II (p75-lntll, 5'-(XATGCrCCTATGGCTACTA), Intron III (p75IntIII, 5'-(XTCCCATTCC<JCGTCAGCC) and the pGK-Neo cassette inserted in Exon III (pGK, 5'-GGGAAClTCCTGACTAGGGG). PCR parameters were 94°C for 150 s; 94°C followed by 30 cycles at for 1 min, 60°C for 1 min, and 72°C for 1 min. The p75NTRExonIV mutation was generated as previously described (von Schack et al., 2001) and mice bearing this mutation were obtained from the lab of Georg Dechant (University of Innsbruck) and maintained on a C57BL/6 background. Genotyping for the p75NTRExonIV mice was performed on tail genomic DNA by PCR using primers directed to Exon IV and to the inserted neo cassette as described (von Schack et al., 2001). 47 Tissue processing and immunoblotting- PI brain, cerebellum and heart tissues were lysed in Nonidet P-40 lysis buffer (lOmM Tris, pH 8.0, 150 mM NaCl, 10% glycerol, 1% Nonidet P-40, 1 protease inhibitor cocktail tablet (Roche, Cat No 1836153) dissolved in 10 ml buffer), subjected to 30 seconds of high-speed homogenization, followed by centrifugation at 15,000 rpm for 15 min at 4°C and removal of pelleted material. Protein concentrations were determined using the BCA assay kit from Pierce. 25-50 ixg of protein was solubilized in Laemmli sample buffer, separated by SDS-polyacrylamide gel electrophoresis, and electroblotted onto nitrocellulose. p75NTR immunoreactivity was detected using a rabbit polyclonal antibody (p75NTR-Pl) raised against amino acids 276425 of rat p75NTR-ICD, as previously described (Barker and Shooter, 1994) or an antibody directed against human p75NTR ICD (Promega cat #G3231). Blocking and antibody incubations of immunoblots were performed in Tris-buffered saline/Tween (lOmM Tris, pH 7.4, 150 mM NaCl and 0.2% Tween) supplemented with 5% (w/v) dried skim milk powder, except for those involving phospho-specific antibodies which were performed in Tris-buffered saline/Tween supplemented with 2% (w/v) bovine serum albumin. Horseradish peroxidase conjugated donkey anti-IgGs (Jackson Immunoresearch Laboratories, Inc) were used at a dilution of 1:5000. Immunoreactive bands were detected using enhanced chemiluminescence (PerkinElmer Life Sciences) according to the manufacturer's instructions. Reverse transcription-PCR analysis- mRNA was isolated from PI brain using the Qiagen RNEasy Mini kit according to the manufacturer's instructions. cDNA was generated using the Qiagen Omniscript RT kit and random hexamers (Roche) as primers. PCR was 48 performed for 30 cycles (94°C for 1 min, 58°C for 1 min, 72°C for 1 min) using 300 nM (final concentration) of the following primers: (3-actin sense, 5' CA(XACITTCTACAATGAGC; (3-actin antisense, 5'-03GTCAC<}ATCTTCATGAGG; p75NTR-ICD sense, 5'-CCAGCAGACCCACACACAGACTG; p75NTR-ICD antisense, 5'CCCTACACAGAGATCOCGGTTC; p75NTR-Exon IV (791-813) sense, 5'- CACCACCTCCAGAGCGAGACCTCATAG; p75NTR ExonVI (1467-1448) antisense, 5'GAACATCAGCGGTCGGAATG. PCR was performed using primers directed against Exon I and Exon III for a total of 30 cycles (94°C for 1 min, 4 cycles of 68 °C for 1 min, 8 cycles of 68 °C for 1 min ramping down by 1 °C each cycle, 18 cycles of 60 °C for 1 min, extension for each cycle was 72°C for 1 min) using the following primers: p75NTR-Exon I sense, 5'-ACOiCCATCGGTCCGCAG; p75NTR Exon III antisense, 5'TCATCTGAGTATGTGOXTCKJG. 20 LII of the reaction products were separated on a 1% agarose gel, and PCR products were visualized under UV light. Construction of mammalian expression vector - To clone the p75NTRExonIV construct into a mammalian expression vector, an RT-PCR reaction was prepared using primers directed against mouse p75NTR Exon IV-IV (bp 791-1467 within mouse p75NTR cDNA (gi 23468246)). The PCR reaction product was gel purified using a Qiaquick Gel Extraction kit, ligated into pENTR/D-TOPO vector (Invitrogen) and sequenced (Bio S&T, Montreal, QC). The cDNA was then ligated into the GATEWAY pDEST12.2 mammalian expression vector in a recombination reaction that made use of the attLl and attL2 sites within both the pENTR/D-TOPO and the pDEST12.2 vectors according to the manufacturer's instructions (Invitrogen). 49 Cell culture and transfection - HEK293T cells and COS-7 cells were maintained in 5% C0 2 at 37°C in Dulbecco's modified Eagle's medium containing 10% bovine serum (BCS), 2 mM L-glutamine and 100 ug/ml penicillin/streptomycin. The rat pheochromocytoma cell line PC 12 was maintained in 10% C0 2 in Dulbecco's modified Eagle's medium with 5% BCS, 5% horse serum, 2 mM L-glutamine and 100 ug/ml penicillin/streptomycin. 350,000 PC 12 or 293T cells plated onto a 6-well plate were transfected using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instructions and were subsequently lysed in Laemmli sample buffer and analyzed by SDS-PAGE and immunoblotting. Subcellular fractionation - All manipulations were performed at 4°C. PI brain tissues were lysed in homogenization buffer (20 mM Hepes, pH 7.4, 1 mM EDTA, 255 mM sucrose, 1 protease inhibitor cocktail tablet (Roche, Cat No 1836153)) and then centrifuged at 600g for 5 min. The supernatant was centrifuged at 10,000g and the pellet obtained was designated heavy membrane. The supernatant was centrifuged at 100,000g and the pellet was designated light membrane and the resulting supernatant, designated cytosol. Immunocytochemistry- 25,000 COS-7 cells were plated onto coverslips in wells of a 24well plate, transfected as above, then fixed for 30 minutes in 2% PFA in PBS supplemented with 10 mM MgCl2. Coverslips were incubated in 2% donkey and 0.2% Triton X-100 in PBS for 60 min, followed by overnight incubation at 4°C with polyclonal antibodies directed against p75NTR (p75NTR-Pl, 1:1000) and with monoclonal 50 antibodies directed against nucleolin (1:1000). Primary antibodies were diluted in PBS containing 2% donkey serum. Cells were then rinsed three times with PBS, followed by incubation for 60 min at room temperature in Cy3-labeled anti-rabbit IgG (1:1000; Jackson Laboratories), FITC-labeled anti-mouse IgG (1:1000; Jackson Laboratories) and Hoescht 33258 (1:10,000; Molecular Probes). Stained cells were analyzed on a Zeiss 510 confocal microscope. 51 Results A fragment ofp75NTR is expressed in p75NTRExon,v-l- mice Expression analysis of p75NTR in mice bearing mutations within Exon III or Exon IV of the p75NTR locus was performed. As expected, PI brain lysates of p75NTRExonI11-/- mice contained no full-length p75NTR (Figure 2A, lane 3) and PI brain lysates from p75NTRExonIV/-mice also lacked full-length p75NTR (Figure 2A, lane 6). Surprisingly, we found that mice bearing either one or two copies of the p75NTRExonIV mutation contained a 26 kDa protein that was immunoreactive with two distinct antibodies directed against the p75NTR intracellular domain (Figure 2A, lanes 5 and 6). This 26 kDa band was not present in wild-type mice, nor was it detected in mice with p75NTRExonUI mutations (Figure 2A, lanes 1-4). The genotype-specific expression profile of the 26 kDa band was also observed in lysates derived from cerebellum and heart of PI p75NTRExonIV wild-type, heterozygous and null littermates (Figure 2B, lanes 2,3 and lanes 5,6). In heart lysates from wild-type mice, full-length p75NTR was present at low levels and the 26 kDa species was not detected. However, the 26 kDa protein was relatively abundant in heterozygote and null mice in the same litter. To determine if the increase in the 26kDa protein reflected an increase in transcription of p75NTR, RT-PCR was performed on PI brain cDNAs derived from p75NTRExonIV wild-type, heterozygous and null littermates, using primers directed to ExonV and ExonVI of the p75NTR locus (which encode the portion of the intracellular domain indicated in Figure 2C). This fragment of the p75NTR mRNA was transcribed at higher levels in mice bearing the p75NTRExonIV mutant allele (Figure 2D) than in wild-type littermates whereas levels of fj-actin mRNA were maintained across all genotypes. Collectively, these data indicated 52 that a truncated p75NTR gene product is produced as both mRNA and protein in p75NTRExonIV-/- mice. Transcription of the transmembrane and intracellular domains of p75NTR in p75NTRExonlv -I- mice is the result ofpGK-Neo cassette insertion To generate the p75NTRExonIV-/- mice, von Schack and colleagues inserted a pGKNeo cassette into an Aatll restriction site within Exon IV of mouse p75NTR (von Schack et al., 2001). Several studies indicate that the retention of this selectable marker (a hybrid gene consisting of the phosphoglycerate kinase I promoter driving the neomycin phosphotransferase gene) in targeted loci of "knockout" mice can cause unexpected phenotypes due to effects on flanking genes (Olson et al., 1996; Pham et al., 1996) and we reasoned that pGK-Neo may lead to aberrant expression of 3' gene products in the p75NTR locus. To determine whether the inserted pGK-Neo cassette affected the transcription of p75NTR in p75NTRExonIV-/- mice, we designed primers to amplify cDNA produced upstream and downstream of the pGK-Neo cassette placed within the p75NTR gene (shown schematically in Figure 3A), and performed RT-PCR on PI brain mRNA from p75NTRExonIV wildtype, heterozygous and null littermates. Figure 3A shows that levels of p75NTR mRNA derived from a portion of the p75NTR locus located 5' to the pGK-Neo insertion site were significantly reduced in brains from PI mice bearing the p75NTRExonIV mutation, likely due to mRNA instability due to absence of a polyA tail on the 3' end of mRNAs driven off the endogenous p75NTR promoter. In contrast, levels of p75NTR mRNA derived from a portion of the gene located 3' to the pGK-Neo insertion site was significantly enhanced in these same brains, suggesting that enhancer sequences 53 within the pGK-Neo cassette are responsible for transcription of 3' fragments of the p75NTR gene in p75NTRExonIV-/- mice. We next tried to identify the fragment of p75NTR expressed in the p75NTRExonIV -/- mice. Direct cloning by RACE-PCR was unsuccessful due to the presence of a strong reverse transcription stop within the cDNA that invariably produced truncated products (data not shown). We therefore scanned the sequence 3' to the pGK-neo insertion site to identify in-frame ATG codons that were flanked by potential cryptic Kozak consensus sequences. One candidate (nt 846-848) was identified as the ATG codon closest to the pGK-Neo insertion site (nt 760), and RT-PCR was used to determine if cDNA containing this putative start site could be directly cloned from PI brains of p75NTRExonIV-/- mice. Figure 3B shows the sequence of the 676 bp cDNA containing nucleotides 791-1467 that was cloned from the p75NTRExonIV-/- mice. The predicted protein encoded by this fragment will produce a 187 amino-acid fragment of p75NTR containing a small portion of the extracellular stalk together with the entire transmembrane and intracellular domains of the receptor (shown schematically in Figure 3C). To confirm that this fragment could mediate protein expression, the p75NTRExonIV-/- cDNA was subcloned into a mammalian expression vector and transfected into HEK293 cells. Figure 3D shows that the p75NTRExonIV-/- cDNA directed abundant expression of a p75NTR fragment that perfectly co-migrates with the protein product identified within p75NTRExonIV-/- brain lysates. 54 Recombinant p75NTRExonlvprotein expression induces Caspase 3 cleavage The p75NTR fragment produced in the p75NTRExonIV-/- mouse lacks the signal sequence necessary for membrane insertion, but retains the hydrophobic transmembrane domain. To determine if the p75NTRExonIV product is membrane-associated, PI brains from p75NTRExon 1V heterozygote and null littermates were subjected to subcellular fractionation. Figure 4A shows that the 26 kDa p75NTRExon IV protein is lacking in cytosolic fractions, but is enriched in heavy and light membrane fractions, similar to the distribution of full-length p75NTR. To further characterize the subcellular localization of the p75NTRExon IV product, COS-7 cells were transiently transfected with the p75NTRExonIV-/- cDNA and immunocytochemistry was performed using antibodies directed against p75NTR and nucleolin, used a a nuclear marker. Figure 4B shows that p75NTRExon lv protein is excluded from the nucleus but is detected at the plasma membrane and within the cytosol, where it is presumably associated with intracellular membranes. Together these results indicate that the p75NTRExonIV fragment is a membrane-associated protein. We have previously shown that the p75NTR intracellular domain can initiate p75NTR signaling events when produced as a truncated protein (Majdan et al., 1997; Roux et al., 2001) and therefore we tested the possibility that the p75NTRExonIV protein can similarly activate p75NTR signaling cascades. Figure 4C shows that expression of the p75NTRExonIV protein in PC 12 cells induced Procaspase-3 cleavage that was reduced by co-expression of Bcl-2, indicating that p75NTRExonIV protein can induce activation of the intrinsic death pathway. Similar results were obtained in 293T cells that do not express endogenous p75NTR (data not shown), indicating that p75NTRExonIV protein can elicit these signals regardless of the presence of full-length p75NTR. Several reports show that p75NTR apoptotic signals involves activation of the c-Jun kinase pathway (Friedman, 2000; Harrington et al., 2002) and Figure 4D shows that expression of the p75NTRExonIV protein in PC 12 cells induced JNK phosphorylation as well as 55 phosphorylation of ATF-2, a well characterized JNK target (Eilers et al., 2001; van Dam et al., 1995). The phosphorylation of these molecules was increased somewhat by coexpression of Bcl-2, likely due to Bcl-2-dependent suppression of caspase-dependent death in transfected cells. Together, these data show that overexpression of the p75NTRExonlv protein is capable of activating p75NTR signaling cascades. 56 Discussion Our results show that p75NTRExonlv-/- mice express a fragment of the p75NTR protein that contains a portion of the extracellular domain and the complete transmembrane and intracellular domains. The genotype-specific expression profile of this fragment is consistent with the hypothesis that the pGK-Neo cassette inserted into Exon IV of the p75NTR gene is responsible for this expression pattern. When expressed in heterologous cells, this p75NTR fragment is membrane-associated where it may activate p75NTR signaling cascades that include JNK activation and Procaspase-3 cleavage. The PGK-1 promoter and enhancer sequence functions in an orientation and a position-independent manner (McBurney et al., 1991) and several groups have demonstrated that retention of the pGK-Neo cassette in targeted loci can profoundly influence the expression of surrounding genes upstream and downstream from the cassette (Olson et al., 1996; Pham et al., 1996). Our results suggest that the pGK-Neo cassette placed within Exon IV of p75NTR results in aberrant transcription of the adjacent 3' portion of the gene which, due to the presence of a cryptic Kozak consensus sequence in Exon IV, results in production of the p75NTRExon IV protein product. Initial characterization of the p75NTRExonIV-/- mice revealed severe peripheral neuron loss as well as dilation and ruptures within large blood vessel (von Schack et al., 2001). We have demonstrated that the p75NTRExon IV protein was highly expressed in heart lysates of PI p75NTRExonIV/"mice and have shown that the p75NTRExon IV protein product can activate p75NTR signaling cascades that result in Procaspase-3 cleavage. Our previous studies have shown that expression of the p75NTR intracellular domain 57 within neurons of transgenic mice can induce apoptosis of peripheral and central neurons in vivo (Majdan et al., 1997) and together, these findings raise the possibility that some characteristics of the p75NTRExon IV mouse are due to gain-of-function mutations rather than loss of p75NTR function. At a minimum, the presence of the p75NTRExonlv protein product in these animals indicate that the cellular basis for observed phenotypes should be interpreted with caution. Although p75NTR was the founding member of the TNF receptor superfamily and was the first identified neurotrophin receptor, its physiological function has not been completely elucidated. Recent findings indicate roles that range from promotion of survival pathways, induction of apoptosis, effects on cell cycle and differentiation, and facilitation or inhibition of growth (Barrett, 2000; Kaplan and Miller, 2003; McKerracher and Winton, 2002; Roux and Barker, 2002). Generation of strains of mice that are rendered null for p75NTR gene products remains an important requirement for the elucidation of its biological activities. 58 Figure Legends Figure 2. A portion of p75NTR is expressed and transcribed in p75NTRExonIV' mice. A, PI brain lysates from p75NTRExonI" and p75NTRExonIV wild-type (+/+), heterozygous (+/-) and null (-/-) littermates were separated on a 15% SDS-PAGE gel, followed by immunoblotting with two antibodies specific to the p75NTR-ICD (see Materials and Methods). Arrowheads indicate full-length p75NTR and a ~26 kDa band present in lysates from mice bearing the p75NTRExonIV mutant allele. Blots were reprobed for (3IIItubulin to verify equal loading. B, PI cerebellar and heart lysates from p75NTRExonIV wild-type (+/+), heterozygous (+/-) and null (-/-) littermates were prepared and subjected to SDS-PAGE and immunoblotting as described above. C, Schematic diagram showing the genomic structure of the mouse p75NTR locus and corresponding protein domains. D, RNA was isolated from PI brain lysates of p75NTRExonIV wild-type (+/+), heterozygous (+/-) and null (-/-) littermates. cDNA was prepared in the presence and absence of reverse transcriptase (+ and - RT), followed by RT-PCR using primers for (3-actin and for p75NTR-ICD. Arrows in Panel C indicate location of primers used for this analysis. Experiments in Panels A, B and D were repeated 3 times with identical results. 59 Figure 3. Transcription of p75NTR fragment in p75NTRExonIV mice is the result of pGK-Neo cassette insertion into the p75NTRExonIV targeting vector. A, cDNA from PI brain lysates of p75NTRExonlv wild-type (+/+), heterozygous (+/-) and null (-/-) littermates prepared as described in Fig 1, followed by RT-PCR using primers for |3-actin or regions of p75NTR upstream or downstream of the pGK-Neo cassette insertion in the p75NTRExonIV targeting vector. The schematic diagram shows the p75NTR open reading frame with arrows indicating location of primers used for RT-PCR analysis. B, Alignment of mouse p75NTR (p75) cDNA sequence with p75NTR transcript cloned from p75NTRExonIV/" mice. The putative start codon is underlined and putative Kozak sequence boxed. Vertical lines indicate Exon IV-V and Exon V-VI junctions and boxes underneath the sequence denote protein domains. C, Schematic diagram showing the protein domains of mouse p75NTR and p75NTRExonIV proteins. D, Recombinant p75NTRExonIV protein co-migrates with ~26 kDa protein present in PI brain lysates from p75NTRExonIV null (-/-) mice. PI brain lysates from p75NTRExonIV wild-type (+/+), heterozygous (+/-) and null (-/-) littermates were separated on a 15% SDS-PAGE gel alongside lysates from 293T cells transiently transfected with plasmids encoding p75NTRExonlv (Exon IV) or the parental vector (Mock). Immunoblotting was performed as described in Fig 1 using a-p75NTR-Pl. Arrowheads indicate FL-p75NTR (upper) and p75NTRExonIV (lower). Experiments in Panels A and D were repeated 3 times with identical results. 60 Figure 4. p75NTRExonIV is membrane-associated and induces caspase zymogen cleavage and JNK phosphorylation. A, PI brains from p75NTRExonIV heterozygote (ExonlV +/-) and null (Exon IV -/-) littermates were subjected to subcellular fractionation and fractions were analyzed by immunoblot. C denotes cytosolic fractions, Ml denotes heavy membrane fraction and M2 denotes light membrane fraction. B, COS-7 cells were transiently transfected for twenty-four hours with plasmids encoding either p75NTRExonIV or encoding the p75NTR intracellular domain tagged with a myristoylation sequence, which is targeted to the plasma membrane (Roux et al., 2001). The cells were subsequently fixed and stained with a-p75NTR-Pl and ct-nucleolin, a nuclear marker. Left-hand panels show p75NTR staining using a Cy3-labeled donkey-anti-rabbit secondary antibody, middle panels show nucleolin staining using a FITC-labeled donkeyanti-mouse secondary antibody, and right-hand panels show merged images. C, p75NTRExonIV protein expression induces caspase zymogen cleavage. PC 12 cells were transfected with control plasmid (pDEST 12.2) or plasmid expressing p75NTRExonlv (Exon IV), in the presence or absence of plasmid expressing Bcl-2. Cells were lysed forty-eight hours after transfection and analyzed by immunoblot to detect p75NTR and Bcl-2 and, using cleavage-specific antibodies, to detect active caspase-3. IKBCX levels were analyzed by immunoblot to confirm equal loading between lanes. Staurosporine treatment was used as a positive control for caspase cleavage. D, p75NTRExonIV protein expression induces phosphorylation of Jun kinase and ATF-2. PC 12 cells were left untransfected or were transfected with 2 ug of plasmids encoding a control plasmid (pcDNA3), or a clone of p75NTRExonIV protein (Exon IV) in the presence and absence of 2 ug of plasmid encoding Bcl-2. Cells were lysed twenty-four hours after transfection and 61 analyzed for levels of phospho-Thrl83/Tyrl85-JNK and total JNK, or phosphoThr69/71-ATF-2 and total ATF-2. Panels A, B, and C were repeated 3 times with identical results. 62 Exon B Exon IV Cerebellum +/+ +/- -/- +/+ +/- -/- +/+ +/- -/- Heart +/+ +/- -/- | 83 — 62 — 83 — 62 — a-P1 33— I a-P1 33 — 25 — 25 — 17 — 17 — • 83 — 62 — 83 — 62 — a-p75NTR 33 — 25 — 25 — 17 — 17 — 48 — - - a-p75NTR 33 — a - p i l l tubulin 48 — a-p||| tubulin 452 bp I - li H V V - IV rn - VI V V — V V Cysteine-Rich Domains 1 • 2 TM- • ICD Neurotrophin binding + RT +/+ +/- -/500 bp 300 bp -RT +/+ +/- -/- •3HHHH 9^^E^H ACTIN p75NTR-ICD Figure 2 63 + RT +/+ +/- •/• +/+ +/- -/ACTIN Exon IV-VI (676 bp) Exon l-lll (540 bp) B p75 ExonlV 7 8 1 AGCCGGAGGCACCTCCAGAGCGAGACCTCATAGCCAGCACAGTGGCCGATACGGTGACCA 1 ACCTCCAGAGCGAGACCTCATAGCCAGCACAGTGGCCGATACGGTGACCA 840 50 p75 ExonlV 8 4 1 CT GTGATGG KAGCTCCCAGCCTGTAGTGACCCGAGGCACCGCTGACAACCTCATTCCTG 5 1 CliGTGATGGPCAGCTCCCAGCCTGTAGTGACCCGAGGCACCGCTGACAACCTCATTCCTG I Stalk II I 900 110 p75 ExonlV 9 0 1 TCTATTGCTCCATCTTGGCTGCTGTGGTTGTGGGCCTTGTGGCCTATATTGCTTTCAAGA 1 1 1 TCTATTGCTCCATCTTGGCTGCTGTGGTTGTGGGCCTTGTGGCCTATATTGCTTTCAAGA Transmembrane domain 960 170 p75 ExonlV 961 GAlTGGAACAGCTGCAAGCAAAATAAACAAGGAGCCAACAGCCGGCCGGTGAACCAGACAC 171 GAlTGGAACAGCTGCAAGCAAAATAAACAAGGAGCCAACAGCCGGCCGGTGAACCAGACAC 1020 230 J El CvtoDlasrtuc domain 1021 CCCCACCAGAGGGAGAGAAACTGCACAGCGACAGCGGCATCTCTGTGGACAGCCAGAGCC p75 ExonlV 231 CCCCACCAGAGGGAGAGAAACTGCACAGCGACAGCGGCATCTCTGTGGACAGCCAGAGCC 1080 290 1081 TGCACGACCAGCAGACCCACACACAGACTGCCTCAGECCAAGCCCTCAAGGGTGATGGCA p75 ExonlV 291 TGCACGACCAGCAGACCCACACACAGACTGCCTCAGCCCAAGCCCTCAAGGGTGATGGCA 1140 350 1141 ACCTCTACAGTAGCCTGCCCCTGACCAAGCGTGAGGAGGTCGAGAAGCTGCTCAATG6TG P75 ExonlV 351 ACCTCTACAGTAGCCTGCGCCTGACCAAGCGTGAGGAGGTCGAGAAGCTGCTCAATGGTG 1200 410 1201 ACACCTGGCGACATCTGGCAGGCGAGCTGGGCTACCAGCCGGAGCATATAGACTCCTTTA p75 ExonlV 411 ACACCTGGCGACATCTGGCAGGCGAGCTGGGCTACCAGCCGGAGCATATAGACTCCTTTA Death domain 1260 470 1261 CCCACGAGGCCTGCCCAGTCCGAGCCCTGCTGGCCAGCTGGGGTGCCCAGGACAGCGCGA 471 CCCACGAGGCCTGCCCAGTCCGAGCCCTGCTGGCCAGCTGGGGTGCCCAGGACAGCGCGA 1320 530 1321 CGCTCGATGCCCTTTTAGCCGCCCTGCGACGCATCCAGAGAGCTGACATTGTGGAGAGCC p75 ExonlV 531 CGCTCGATGCCCTTTTAGCCGCCCTGCGACGCATCCAGAGAGCTGACATTGTGGAGAGCC 1380 590 1381 TGTGCAGCGAGTCCACTGCCACGTCCCCTGTGTGAGCTCACCGACTGGGAGCCCCTGTCC p75 ExonlV 591 TGTGCAGCGAGTCCACTGCCACGTCCCCTGTGTGAGCTCACCGACTGGGAGCCCCTGTCC 1440 650 1441 TGTCCCACATTCCGACCGCTGATGTTCTAGCCCCCACAGAGCCGCCCCCCTCTCCCTTGG p75 ExonlV 651 TGTCCCACATTCCGACCGCTGATGTTC 1500 677 P 75 ExonlV Brain +/- Cysleine-Rich Domains 1 2 3 4 TM ICD p75NTR ICD p75NTR e Neurotrophin binding Figure 3 293 T -/- ExonlV Mock a-P1 64 Exon IV +/C M1 M2 Exon IV -/C M1 M2 83 — -FL 62 — - ^ " ~ 33 — _ _ _ ~ 25 — B 1 Cy3 = p75NTR - ExonlV - FITC Merged p75NTR-mlCD p75NTR a 8 2 Q Q. & & Cvi O X UJ o X UJ 25- 62- Cleaved Caspase-3 17- 48 • &• mm - p 4 6 | ^ 62- - p55 4883 • 62 • p75NTR — 25 — 83 — -pATF-2 -ExonlV 17 .ATF-2 — • Bcl-2 83 • 62 • 25 JNK •FL 33 25 - p46 — -FL p75NTR ; . IKBO 3325 • -ExonlV 17 2517- Figure 4 • Bcl-2 65 Closing Remarks p75NTR plays an important role in the regulation of neuronal survival, apoptosis and growth during both development and after injury in the adult nervous system, and the signal transduction mechanisms that regulate these events are beginning to emerge. In the first part of this thesis, I addressed an aspect of p75NTR-dependent apoptotic signaling, in which the transcriptional events following JNK phosphorylation induced by p75NTR activation were analyzed. In neurons deprived of trophic factor, JNK activation results in phosphorylation of c-Jun which in turn promotes transcription of the BH3domain-only family members Bim and Hrk, proteins that facilitate Cytochrome C release from the mitochondria (Harris and Johnson, 2001; Putcha et al., 2001; Whitfield et al., 2001). Given these data, it was hypothesized that p75NTR-dependent apoptosis induced transcription of distinct BH3-domain only proteins. However, although p75NTR induced JNK-dependent apoptosis in the cell types analyzed, no evidence for transcriptional regulation of BH3-domain only family members was observed. While BH3-domain-only proteins do not appear to be subject to transcriptional regulation during apoptosis induced by p75NTR, subsequent work in our laboratory established that p75NTR-mediated death correlated with the phosphorylation on Serine 128 of BH3-domain-only family member, Bad. This work established that JNK is responsible for this p75NTR-dependent Bad phosphorylation, since JNK inhibition reduced the phosphorylation of Bad. Further, use of a dominant negative Bad Serine 128 significantly protected cells infected with p75NTR from p75NTR-induced apoptosis, indicating that the JNK-Bad pathway is important for p75NTR-induced death. Future 66 studies using cultured neurons from Bad -/- mice will lend in vivo weight to the argument that Bad is an important component of p75NTR-dependent cell death signaling. During the second part of my M.Sc, I showed that p75NTRExonIV-/- mice express a fragment of the p75NTR protein that contains a portion of the extracellular domain and the complete transmembrane and intracellular domains. The genotype-specific expression profile of this fragment is consistent with the hypothesis that the pGK-Neo cassette inserted into Exon IV of the p75NTR gene is responsible for this expression pattern. When expressed in heterologous cells, this p75NTR fragment is membraneassociated where it may activate p75NTR signaling cascades that include JNK activation and Procaspase-3 cleavage. These results reverse the conclusions made by the Dechant group (von Schack et al., 2001) that the p75NTRExonIV-/- mice represent a "complete" knockout in comparison with the earlier p75NTRExonI11-/- mice (Lee et al., 1992). Evidence for this is based on RTPCR results using primers directed against the p75NTR intracellular domain, where it was shown that mRNAs derived from this portion of p75NTR was increased as a function of p75NTRExonIV mutant alleles. Immunoblots using two different antibodies directed against the p75NTR intracellular domain also showed the same genotype-specific profile. While there is some concern that the 26 kDa protein observed in mice with p75NTRExonIV mutations might reflect cross-reaction of p75NTR antibodies with proteins that bear homology to p75NTR such as PLAIDD (Frankowski et al., 2002), the RT-PCR data provides compelling evidence that the intracellular domain of p75NTR is aberrantly produced in the p75NTRExonIV-/- mice. 67 Our results suggest that the pGK-Neo cassette placed within Exon IV of p75NTR results in aberrant transcription of the adjacent 3' portion of the gene which, due to the presence of a cryptic Kozak consensus sequence in Exon IV, results in production of the p75NTRExon IV protein product. The PGK-1 promoter and enhancer sequence functions in an orientation and a position-independent manner (McBurney et al., 1991) and several groups have demonstrated that retention of the pGK-Neo cassette in targeted loci can profoundly influence the expression of surrounding genes upstream and downstream from the cassette (Olson et al., 1996; Pham et al., 1996). One study examined targeted mutations in two multigene clusters, the granzyme B locus and the (3-like globin gene cluster and found that the pGK-Neo insertion abrogated the expression of multiple genes both upstream and downstream from the cassette (Pham et al., 1996). Other examples of this phenomenon have also been suggested in mice with targeted mutations of the myogenic basis helix-loop-helix gene MRF4, the Igk light chain intronic enhancer, and individual genes in the Hox gene clusters (Horan et al., 1995; Horan et al., 1994; Jeannotte et al., 1993; Kostic and Capecchi, 1994; Ramirez-Solis et al., 1993; Zhang et al., 1995). Our results are novel in that they suggest that retention of pGK-Neo effectively induces rather than abrogates transcription of an adjacent portion of p75NTR, and we cannot rule out the possibility that nearby genes are also affected. Our findings, along with others, underscore the unpredictable phenotypes that can result from retained pGK-Neo cassettes. Initial characterization of the p75NTRExonlv-/- mice revealed severe peripheral neuron loss as well as dilation and ruptures within large blood vessel (von Schack et al, 2001). We have demonstrated that the p75NTRExon IV protein was highly expressed in 68 heart lysates of PI p75NTRExonlv/-mice and have shown that the p75NTRExon ,v protein product can activate p75NTR signaling cascades that result in Procaspase-3 cleavage. Our previous studies have shown that expression of the p75NTR intracellular domain within neurons of transgenic mice can induce apoptosis of peripheral and central neurons in vivo (Majdan et al., 1997) and together, these findings raise the possibility that some characteristics of the p75NTRExon IV mouse are due to gain-of-function mutations rather than loss of p75NTR function. At a minimum, the presence of the p75NTRExonIV protein product in these animals indicates that previously observed phenotypes should be interpreted with caution. In particular, the increased number of basal forebrain cholinergic neurons in p75NTRExonIV/" mice warrants re-interpretation (Naumann et al., 2002). The actions of p75NTR are complex and reports from ourselves and several other groups have shown that p75NTR can, in some circumstances, induce a survival response, through activation of Akt (DeFreitas et al., 2001; Descamps et al., 2001; Roux et al., 2001). We have tested whether the aberrant p75NTR product detected in the p75NTRExonIV-/- is capable of activating survival pathways and observed increased phosphorylation of Akt in PC 12 and HEK293 cells transfected with the p75NTRExonIV protein product (data not shown). Thus, the aberrant p75NTR product is capable of activating antagonistic pathways similar to those elicited by the intact receptor and this suggests that the effects of aberrant p75NTR product will vary as a function of tissue-specific expression levels and with specific cellular contexts. The Dechant group showed increased survival of basal forebrain cholinergic neurons of p75NTRExonIV-/- mice (Naumann et al., 2002) and, when coupled with our data, two possibilities emerge. First, these neurons may express little or no 69 truncated p75NTR and this phenotype may reflect a bona fide p75NTR loss of function phenotype. Alternatively, increased survival of basal forebrain cholinergic neurons observed in the p75NTRExonIV -/- mice may reflect a survival gain-of-function effect due to the activation of Akt induced by expression of the aberrant p75NTR product. Further analysis of the p75NTRExonlv expression in the basal forebrain cholinergic neurons of p75NTRExonIV -/- mice would help to resolve this issue. Although p75NTR was the first discovered member of the TNF receptor superfamily and was the first identified neurotrophin receptor, its physiological function has not been completely elucidated. Recent findings indicate roles that range from promotion of survival pathways, induction of apoptosis, effects on cell cycle and differentiation, and facilitation or inhibition of growth (Barrett, 2000; Kaplan and Miller, 2003; McKerracher and Winton, 2002; Roux and Barker, 2002). Generation of strains of mice that are rendered null for p75NTR gene products remains an absolute requirement for the elucidation of its biological activities. 70 Bibliography Allsopp, T.E., Robinson, M., Wyatt, S. and Davies, A.M. (1993) Ectopic trkA expression mediates a NGF survival response in NGF-independent sensory neurons but not in parasympathetic neurons. J Cell Biol, 123, 1555-1566. Aloyz, R.S., Bamji, S.X., Pozniak, CD., Toma, J.G., Atwal, J., Kaplan, D.R. and Miller, F.D. (1998) p53 is essential for developmental neuron death as regulated by the TrkA and p75 neurotrophin receptors. J Cell Biol, 143, 1691-1703. Anderson, C.N. and Tolkovsky, A.M. (1999) A role for MAPK/ERK in sympathetic neuron survival: protection against a p53-dependent, JNK-independent induction of apoptosis by cytosine arabinoside. J Neurosci, 19, 664-673. Anton, E.S., Weskamp, G., Reichardt, L.F. and Matthew, W.D. (1994) Nerve growth factor and its low-affinity receptor promote Schwann cell migration. Proc Natl Acad Sci US A, 91, 2795-2799. Bagum, M.A., Miyamoto, O., Toyoshima, T., Masada, T., Nagahata, S. and Itano, T. (2001) The contribution of low affinity NGF receptor (p75NGFR) to delayed neuronal death after ischemia in the gerbil hippocampus. Acta Med Okayama, 55, 19-24. Baker, S.J. and Reddy, E.P. (1998) Modulation of life and death by the TNF receptor superfamily. Oncogene, 17, 3261-3270. Baldwin, A.N., Bitler, CM., Welcher, A.A. and Shooter, E.M. (1992) Studies on the structure and binding properties of the cysteine-rich domain of rat low affinity nerve growth factor receptor (p75NGFR). J Biol Chem, 267, 8352-8359. Bamji, S.X., Majdan, M., Pozniak, CD., Belliveau, D.J., Aloyz, R., Kohn, J., Causing, C.G. and Miller, F.D. (1998) The p75 neurotrophin receptor mediates neuronal apoptosis and is essential for naturally occurring sympathetic neuron death. J Cell Biol, 140, 911-923. Banfield, M.J., Naylor, R.L., Robertson, A.G., Allen, S.J., Dawbarn, D. and Brady, R.L. (2001) Specificity in Trk receptor:neurotrophin interactions: the crystal structure of TrkB-d5 in complex with neurotrophin-4/5. Structure (Camb), 9, 1191-1199. Barde, Y.A. (1989) Trophic factors and neuronal survival. Neuron, 2, 1525-1534. 71 Barker, P.A., Barbee, G., Misko, T.P. and Shooter, E.M. (1994) The low affinity neurotrophin receptor, p75LNTR, is palmitoylated by thioester formation through cysteine 219. J Biol Chem, 269, 30645-30650. Barker, P.A. and Shooter, E.M. (1994) Disruption of NGF binding to the low affinity neurotrophin receptor p75LNTR reduces NGF binding to TrkA on PC 12 cells. Neuron, 13, 203-215. Barrett, G.L. (2000) The p75 neurotrophin receptor and neuronal apoptosis. Prog Neurobiol, 61, 205-229. Barrett, G.L. and Bartlett, P.F. (1994) The p75 nerve growth factor receptor mediates survival or death depending on the stage of sensory neuron development. Proc Natl Acad Sci US A, 91, 6501-6505. Barrett, G.L. and Georgiou, A. (1996) The low-affinity nerve growth factor receptor p75NGFR mediates death of PC 12 cells after nerve growth factor withdrawal. J Neurosci Res, 45, 117-128. Bazenet, C.E., Mota, M.A. and Rubin, L.L. (1998) The small GTP-binding protein Cdc42 is required for nerve growth factor withdrawal-induced neuronal death. Proc Natl Acad Sci USA, 95, 3984-3989. Beattie, M.S., Harrington, A.W., Lee, R., Kim, J.Y., Boyce, S.L., Longo, F.M., Bresnahan, J.C, Hempstead, B.L. and Yoon, S.O. (2002) ProNGF induces p75mediated death of oligodendrocytes following spinal cord injury. Neuron, 36, 375-386. Bentley, C.A. and Lee, K.F. (2000) p75 is important for axon growth and Schwann cell migration during development. J Neurosci, 20, 7706-7715. Bhakar, A.L., Tannis, L.L., Zeindler, C, Russo, M.P., Jobin, C , Park, D.S., MacPherson, S. and Barker, P.A. (2002) Constitutive nuclear factor-kappa B activity is required for central neuron survival. J Neurosci, 22, 8466-8475. Bibel, M., Hoppe, E. and Barde, Y.A. (1999) Biochemical and functional interactions between the neurotrophin receptors trk and p75NTR. Embo J, 18, 616-622. Biswas, S.C and Greene, L.A. (2002) Nerve growth factor (NGF) down-regulates the Bcl-2 homology 3 (BH3) domain-only protein Bim and suppresses its proapoptotic activity by phosphorylation. J Biol Chem, 277, 49511-49516. 72 Blume-Jensen, P., Janknecht, R. and Hunter, T. (1998) The kit receptor promotes cell survival via activation of PI 3-kinase and subsequent Akt-mediated phosphorylation of Bad on Serl36. Curr Biol, 8, 779-782. Bruckner, S.R., Tammariello, S.P., Kuan, C.Y., Flavell, R.A., Rakic, P. and Estus, S. (2001) JNK3 contributes to c-Jun activation and apoptosis but not oxidative stress in nerve growth factor-deprived sympathetic neurons. / Neurochem, 78, 298-303. Casaccia-Bonnefil, P., Carter, B.D., Dobrowsky, R.T. and Chao, M.V. (1996) Death of oligodendrocytes mediated by the interaction of nerve growth factor with its receptor p75. Nature, 383, 716-719. Casha, S., Yu, W.R. and Fehlings, M.G. (2001) Oligodendroglial apoptosis occurs along degenerating axons and is associated with FAS and p75 expression following spinal cord injury in the rat. Neuroscience, 103, 203-218. Chan, F.K., Chun, H.J., Zheng, L., Siegel, R.M., Bui, K.L. and Lenardo, M.J. (2000) A domain in TNF receptors that mediates ligand-independent receptor assembly and signaling. Science, 288, 2351-2354. Chao, M.V., Bothwell, M.A., Ross, A.H., Koprowski, H., Lanahan, A.A., Buck, C.R. and Sehgal, A. (1986) Gene transfer and molecular cloning of the human NGF receptor. Science, 232, 518-521. Chapman, B.S. and Kuntz, I.D. (1995) Modeled structure of the 75-kDa neurotrophin receptor. Protein Sci, 4, 1696-1707. Cheema, S.S., Barrett, G.L. and Bartlett, P.F. (1996) Reducing p75 nerve growth factor receptor levels using antisense oligonucleotides prevents the loss of axotomized sensory neurons in the dorsal root ganglia of newborn rats. J Neurosci Res, 46, 239-245. Cordon-Cardo, C , Tapley, P., Jing, S.Q., Nanduri, V., O'Rourke, E., Lamballe, F., Kovary, K., Klein, R., Jones, K.R., Reichardt, L.F. and et al. (1991) The trk tyrosine protein kinase mediates the mitogenic properties of nerve growth factor and neurotrophin-3. Cell, 66, 173-183. Cosgaya, J.M., Chan, J.R. and Shooter, E.M. (2002) The neurotrophin receptor p75NTR as a positive modulator of myelination. Science, 298, 1245-1248. 73 Datta, S.R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y. and Greenberg, M.E. (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell, 91, 231-241. Davies, A.M. (2000) Neurotrophins: neurotrophic modulation of neurite growth. Curr Biol, 10, R198-200. Davies, A.M., Lee, K.F. and Jaenisch, R. (1993) p75-deficient trigeminal sensory neurons have an altered response to NGF but not to other neurotrophins. Neuron, 11, 565574. Dechant, G. and Barde, Y.A. (1997) Signalling through the neurotrophin receptor p75NTR. Curr Opin Neurobiol, 7, 413-418. DeFreitas, M.F., McQuillen, P.S. and Shatz, C.J. (2001) A novel p75NTR signaling pathway promotes survival, not death, of immunopurified neocortical subplate neurons. J Neurosci, 21, 5121-5129. del Peso, L., Gonzalez-Garcia, M., Page, C , Herrera, R. and Nunez, G. (1997) Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt. Science, 278, 687-689. Descamps, S., Toillon, R.A., Adriaenssens, E., Pawlowski, V., Cool, S.M., Nurcombe, V., Le Bourhis, X., Boilly, B., Peyrat, J.P. and Hondermarck, H. (2001) Nerve growth factor stimulates proliferation and survival of human breast cancer cells through two distinct signaling pathways. J Biol Chem, 276, 17864-17870. Deshmukh, M. and Johnson, E.M., Jr. (1998) Evidence of a novel event during neuronal death: development of competence-to-die in response to cytoplasmic cytochrome c. Neuron, 21, 695-705. Deshmukh, M., Vasilakos, J., Deckwerth, T.L., Lampe, P.A., Shivers, B.D. and Johnson, E.M., Jr. (1996) Genetic and metabolic status of NGF-deprived sympathetic neurons saved by an inhibitor of ICE family proteases. J Cell Biol, 135, 13411354. Domeniconi, M., Cao, Z., Spencer, T., Sivasankaran, R., Wang, K., Nikulina, E., Kimura, N., Cai, H., Deng, K., Gao, Y., He, Z. and Filbin, M. (2002) Myelin-associated glycoprotein interacts with the Nogo66 receptor to inhibit neurite outgrowth. Neuron, 35, 283-290. 74 Donovan, N., Becker, E.B., Konishi, Y. and Bonni, A. (2002) JNK phosphorylation and activation of BAD couples the stress-activated signaling pathway to the cell death machinery. J Biol Chem, 277, 40944-40949. Dostaler, S.M., Ross, G.M., Myers, S.M., Weaver, D.F., Ananthanarayanan, V. and Riopelle, R.J. (1996) Characterization of a distinctive motif of the low molecular weight neurotrophin receptor that modulates NGF-mediated neurite growth. Eur J Neurosci, 8, 870-879. Dowling, P., Ming, X., Raval, S., Husar, W., Casaccia-Bonnefil, P., Chao, M., Cook, S. and Blumberg, B. (1999) Up-regulated p75NTR neurotrophin receptor on glial cells in MS plaques. Neurology, 53, 1676-1682. Eilers, A., Whitfield, J., Shah, B., Spadoni, C , Desmond, H. and Ham, J. (2001) Direct inhibition of c-Jun N-terminal kinase in sympathetic neurones prevents c-jun promoter activation and NGF withdrawal-induced death. J Neurochem, 76, 14391454. Ernfors, P., Ibanez, C.F., Ebendal, T., Olson, L. and Persson, H. (1990) Molecular cloning and neurotrophic activities of a protein with structural similarities to nerve growth factor: developmental and topographical expression in the brain. Proc Natl Acad Sci USA, 87, 5454-5458. Esposito, D., Patel, P., Stephens, R.M., Perez, P., Chao, M.V., Kaplan, D.R. and Hempstead, B.L. (2001) The cytoplasmic and transmembrane domains of the p75 and Trk A receptors regulate high affinity binding to nerve growth factor. J Biol Chem, 276, 32687-32695. Fahnestock, M., Michalski, B., Xu, B. and Coughlin, M.D. (2001) The precursor pronerve growth factor is the predominant form of nerve growth factor in brain and is increased in Alzheimer's disease. Mol Cell Neurosci, 18, 210-220. Fainzilber, M., Smit, A.B., Syed, N.I., Wildering, W.C., Hermann, van der Schors, R.C, Jimenez, C , Li, K.W., van Minnen, J., Bulloch, A.G., Ibanez, CF. and Geraerts, W.P. (1996) CRNF, a molluscan neurotrophic factor that interacts with the p75 neurotrophin receptor. Science, 274, 1540-1543. 75 Fan, G., Merritt, S.E., Kortenjann, M., Shaw, P.E. and Holzman, L.B. (1996) Dual leucine zipper-bearing kinase (DLK) activates p46SAPK and p38mapk but not ERK2. J Biol Chem, 111, 24788-24793. Ferri, C.C. and Bisby, M.A. (1999) Improved survival of injured sciatic nerve Schwann cells in mice lacking the p75 receptor. Neurosci Lett, 272, 191-194. Ferri, C.C, Moore, F.A. and Bisby, M.A. (1998) Effects of facial nerve injury on mouse motoneurons lacking the p75 low-affinity neurotrophin receptor. J Neurobiol, 34, 1-9. Fournier, A.E., GrandPre, T. and Strittmatter, S.M. (2001) Identification of a receptor mediating Nogo-66 inhibition of axonal regeneration. Nature, 409, 341-346. Frade, J.M. and Barde, Y.A. (1999) Genetic evidence for cell death mediated by nerve growth factor and the neurotrophin receptor p75 in the developing mouse retina and spinal cord. Development, 126, 683-690. Frade, J.M., Rodriguez-Tebar, A. and Barde, Y.A. (1996) Induction of cell death by endogenous nerve growth factor through its p75 receptor. Nature, 383, 166-168. Frankowski, H., Castro-Obregon, S., del Rio, G., Rao, R.V. and Bredesen, D.E. (2002) PLAIDD, a type II death domain protein that interacts with p75 neurotrophin receptor. Neuromolecular Med, 1, 153-170. Friedman, W.J. (2000) Neurotrophins induce death of hippocampal neurons via the p75 receptor. J Neurosci, 20, 6340-6346. Gentry, J.J., Casaccia-Bonnefil, P. and Carter, B.D. (2000) Nerve growth factor activation of nuclear factor kappaB through its p75 receptor is an anti-apoptotic signal in RN22 schwannoma cells. J Biol Chem, 275, 7558-7565. Ghosh, A., Carnahan, J. and Greenberg, M.E. (1994) Requirement for BDNF in activitydependent survival of cortical neurons. Science, 263, 1618-1623. Grob, P.M., Ross, A.H., Koprowski, H. and Bothwell, M. (1985) Characterization of the human melanoma nerve growth factor receptor. J Biol Chem, 260, 8044-8049. Gross, A., McDonnell, J.M. and Korsmeyer, S.J. (1999) BCL-2 family members and the mitochondria in apoptosis. Genes Dev, 13, 1899-1911. Gu, C , Casaccia-Bonnefil, P., Srinivasan, A. and Chao, M.V. (1999) Oligodendrocyte apoptosis mediated by caspase activation. J Neurosci, 19, 3043-3049. 76 Hamanoue, M., Middleton, G., Wyatt, S., Jaffray, E., Hay, R.T. and Davies, A.M. (1999) p75-mediated NF-kappaB activation enhances the survival response of developing sensory neurons to nerve growth factor. Mol Cell Neurosci, 14, 28-40. Hantzopoulos, P.A., Suri, C , Glass, D.J., Goldfarb, M.P. and Yancopoulos, G.D. (1994) The low affinity NGF receptor, p75, can collaborate with each of the Trks to potentiate functional responses to the neurotrophins. Neuron, 13, 187-201. Harding, T.C., Xue, L., Bienemann, A., Haywood, D., Dickens, M., Tolkovsky, A.M. and Uney, J.B. (2001) Inhibition of JNK by overexpression of the JNL binding domain of JIP-1 prevents apoptosis in sympathetic neurons. J Biol Chem, 276, 4531-4534. Harrington, A.W., Kim, J.Y. and Yoon, S.O. (2002) Activation of Rac GTPase by p75 is necessary for c-jun N-terminal kinase-mediated apoptosis. J Neurosci, 22, 156166. Harris, C.A. and Johnson, E.M., Jr. (2001) BH3-only Bcl-2 family members are coordinately regulated by the JNK pathway and require Bax to induce apoptosis in neurons. J Biol Chem, 276, 37754-37760. Hempstead, B.L., Martin-Zanca, D., Kaplan, D.R., Parada, L.F. and Chao, M.V. (1991) High-affinity NGF binding requires coexpression of the trk proto-oncogene and the low-affinity NGF receptor. Nature, 350, 678-683. Higuchi, H., Yamashita, T., Yoshikawa, H. and Tohyama, M. (2003) PKA phosphorylates the p75 receptor and regulates its localization to lipid rafts. Embo J, 22, 1790-1800. Hirai, S., Izawa, M., Osada, S., Spyrou, G. and Ohno, S. (1996) Activation of the JNK pathway by distantly related protein kinases, MEKK and MUK. Oncogene, 12, 641-650. Hohn, A., Leibrock, J., Bailey, K. and Barde, Y.A. (1990) Identification and characterization of a novel member of the nerve growth factor/brain-derived neurotrophic factor family. Nature, 344, 339-341. Horan, G.S., Kovacs, E.N., Behringer, R.R. and Featherstone, M.S. (1995) Mutations in paralogous Hox genes result in overlapping homeotic transformations of the axial skeleton: evidence for unique and redundant function. Dev Biol, 169, 359-372. 77 Horan, G.S., Wu, K., Wolgemuth, D.J. and Behringer, R.R. (1994) Homeotic transformation of cervical vertebrae in Hoxa-4 mutant mice. Proc Natl Acad Sci US A, 91, 12644-12648. Huang, B., Eberstadt, M., Olejniczak, E.T., Meadows, R.P. and Fesik, S.W. (1996) NMR structure and mutagenesis of the Fas (APO-1/CD95) death domain. Nature, 384, 638-641. Huang, D.C and Strasser, A. (2000) BH3-Only proteins-essential initiators of apoptotic cell death. Cell, 103, 839-842. Huang, E.J. and Reichardt, L.F. (2001) Neurotrophins: roles in neuronal development and function. Annu Rev Neurosci, 24, 677-736. Hughes, A.L., Messineo-Jones, D., Lad, S.P. and Neet, K.E. (2001) Distinction between differentiation, cell cycle, and apoptosis signals in PC 12 cells by the nerve growth factor mutant delta9/13, which is selective for the p75 neurotrophin receptor. J Neurosci Res, 63, 10-19. Imaizumi, K., Morihara, T., Mori, Y., Katayama, T., Tsuda, M., Furuyama, T., Wanaka, A., Takeda, M. and Tohyama, M. (1999) The cell death-promoting gene DP5, which interacts with the BCL2 family, is induced during neuronal apoptosis following exposure to amyloid beta protein. J Biol Chem, 274, 7975-7981. Imaizumi, K., Tsuda, M., Imai, Y., Wanaka, A., Takagi, T. and Tohyama, M. (1997) Molecular cloning of a novel polypeptide, DP5, induced during programmed neuronal death. J Biol Chem, 272, 18842-18848. Ip, N.Y., Stitt, T.N., Tapley, P., Klein, R., Glass, D.J., Fandl, J., Greene, L.A., Barbacid, M. and Yancopoulos, G.D. (1993) Similarities and differences in the way neurotrophins interact with the Trk receptors in neuronal and nonneuronal cells. Neuron, 10, 137-149. Jacobson, M.D., Weil, M. and Raff, M.C (1997) Programmed cell death in animal development. Cell, 88, 347-354. Jeannotte, L., Lemieux, M., Charron, J., Poirier, F. and Robertson, E.J. (1993) Specification of axial identity in the mouse: role of the Hoxa-5 (Hoxl.3) gene. Genes Dev, 7, 2085-2096. 78 Johnson, D., Lanahan, A., Buck, C.R., Sehgal, A., Morgan, C , Mercer, E., Bothwell, M. and Chao, M. (1986) Expression and structure of the human NGF receptor. Cell, 47, 545-554. Kaplan, D.R., Hempstead, B.L., Martin-Zanca, D., Chao, M.V. and Parada, L.F. (1991a) The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science, 252, 554-558. Kaplan, D.R., Martin-Zanca, D. and Parada, L.F. (1991b) Tyrosine phosphorylation and tyrosine kinase activity of the trk proto-oncogene product induced by NGF. Nature, 350, 158-160. Kaplan, D.R. and Miller, F.D. (2000) Neurotrophin signal transduction in the nervous system. Curr Opin Neurobiol, 10, 381-391. Kaplan, D.R. and Miller, F.D. (2003) Axon growth inhibition: signals from the p75 neurotrophin receptor. Nat Neurosci, 6, 435-436. Khursigara, G., Bertin, J., Yano, H., Moffett, H., DiStefano, P.S. and Chao, M.V. (2001) A prosurvival function for the p75 receptor death domain mediated via the caspase recruitment domain receptor-interacting protein 2. J Neurosci, 21, 58545863. Klein, R., Conway, D., Parada, L.F. and Barbacid, M. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell, 61, 647-656. Klein, R., Jing, S.Q., Nanduri, V., O'Rourke, E. and Barbacid, M. (1991a) The trk protooncogene encodes a receptor for nerve growth factor. Cell, 65, 189-197. Klein, R., Nanduri, V., Jing, S.A., Lamballe, F., Tapley, P., Bryant, S., Cordon-Cardo, C , Jones, K.R., Reichardt, L.F. and Barbacid, M. (1991b) The trkB tyrosine protein kinase is a receptor for brain-derived neurotrophic factor and neurotrophin-3. Cell, 66, 395-403. Koch, G., Haberman, B., Mohr, C , Just, I. and Aktories, K. (1991) Interaction of mastoparan with the low molecular mass GTP-binding proteins rho/rac. FEBS Lett, 291, 336-340. 79 Kokaia, Z., Andsberg, G., Martinez-Serrano, A. and Lindvall, O. (1998) Focal cerebral ischemia in rats induces expression of P75 neurotrophin receptor in resistant striatal cholinergic neurons. Neuroscience, 84, 1113-1125. Konishi, Y., Lehtinen, M., Donovan, N. and Bonni, A. (2002) Cdc2 phosphorylation of BAD links the cell cycle to the cell death machinery. Mol Cell, 9, 1005-1016. Kostic, D. and Capecchi, M.R. (1994) Targeted disruptions of the murine Hoxa-4 and Hoxa-6 genes result in homeotic transformations of components of the vertebral column. Mech Dev, 46, 231-247. Kuner, P., Schubenel, R. and Hertel, C (1998) Beta-amyloid binds to p57NTR and activates NFkappaB in human neuroblastoma cells. J Neurosci Res, 54, 798-804. Lamballe, F., Klein, R. and Barbacid, M. (1991) trkC, a new member of the trk family of tyrosine protein kinases, is a receptor for neurotrophin-3. Cell, 66, 967-979. Large, T.H., Weskamp, G., Helder, J.C., Radeke, M.J., Misko, T.P., Shooter, E.M. and Reichardt, L.F. (1989) Structure and developmental expression of the nerve growth factor receptor in the chicken central nervous system. Neuron, 2, 11231134. Lee, K.F., Davies, A.M. and Jaenisch, R. (1994) p75-deficient embryonic dorsal root sensory and neonatal sympathetic neurons display a decreased sensitivity to NGF. Development, 120, 1027-1033. Lee, K.F., Li, E., Huber, L.J., Landis, S.C, Sharpe, A.H., Chao, M.V. and Jaenisch, R. (1992) Targeted mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits in the peripheral sensory nervous system. Cell, 69, 737-749. Lee, R., Kermani, P., Teng, K.K. and Hempstead, B.L. (2001) Regulation of cell survival by secreted proneurotrophins. Science, 294, 1945-1948. Lei, K. and Davis, R.J. (2003) JNK phosphorylation of Bim-related members of the Bcl2 family induces Bax-dependent apoptosis. Proc Natl Acad Sci USA, 100, 24322437. Lei, K., Nimnual, A., Zong, W.X., Kennedy, N.J., Flavell, R.A., Thompson, C.B., BarSagi, D. and Davis, R.J. (2002) The Bax subfamily of Bcl2-related proteins is essential for apoptotic signal transduction by c-Jun NH(2)-terminal kinase. Mol Cell Biol, 22, 4929-4942. 80 Levi-Montalcini, R. (1987) The nerve growth factor: thirty-five years later. Biosci Rep, 1, 681-699. Li, H., Zhu, H., Xu, C.J. and Yuan, J. (1998) Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell, 94, 491-501. Liepinsh, E., Hag, L.L., Otting, G. and Ibanez, CF. (1997) NMR structure of the death domain of the p75 neurotrophin receptor. Embo J, 16, 4999-5005. Liu, B.P., Fournier, A., GrandPre, T. and Strittmatter, S.M. (2002) Myelin-associated glycoprotein as a functional ligand for the Nogo-66 receptor. Science, 297, 11901193. Luo, X., Budihardjo, I., Zou, H., Slaughter, C and Wang, X. (1998) Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell, 94, 481-490. Mahadeo, D., Kaplan, L., Chao, M.V. and Hempstead, B.L. (1994) High affinity nerve growth factor binding displays a faster rate of association than pl40trk binding. Implications for multi-subunit polypeptide receptors. J Biol Chem, 269, 68846891. Majdan, M., Lachance, C , Gloster, A., Aloyz, R., Zeindler, C , Bamji, S., Bhakar, A., Belliveau, D., Fawcett, J., Miller, F.D. and Barker, P.A. (1997) Transgenic mice expressing the intracellular domain of the p75 neurotrophin receptor undergo neuronal apoptosis. J Neurosci, 17, 6988-6998. Majdan, M., Walsh, G.S., Aloyz, R. and Miller, F.D. (2001) TrkA mediates developmental sympathetic neuron survival in vivo by silencing an ongoing p75NTR-mediated death signal. J Cell Biol, 155, 1275-1285. Martin, D.P., Schmidt, R.E., DiStefano, P.S., Lowry, O.H., Carter, J.G. and Johnson, E.M., Jr. (1988) Inhibitors of protein synthesis and RNA synthesis prevent neuronal death caused by nerve growth factor deprivation. J Cell Biol, 106, 829844. Martinez-Murillo, R., Fernandez, A.P., Bentura, M.L. and Rodrigo, J. (1998) Subcellular localization of low-affinity nerve growth factor receptor-immunoreactive protein in adult rat purkinje cells following traumatic injury. Exp Brain Res, 119, 47-57. 81 Martinou, I., Desagher, S., Eskes, R., Antonsson, B., Andre, E., Fakan, S. and Martinou, J.C (1999) The release of cytochrome c from mitochondria during apoptosis of NGF- deprived sympathetic neurons is a reversible event. J Cell Biol, 144, 883889. McBurney, M.W., Sutherland, L.C, Adra, C.N., Leclair, B., Rudnicki, M.A. and Jardine, K. (1991) The mouse Pgk-1 gene promoter contains an upstream activator sequence. Nucleic Acids Res, 19, 5755-5761. McKerracher, L. and Winton, M.J. (2002) Nogo on the go. Neuron, 36, 345-348. Miller, F.D., Speelman, A., Mathew, T.C, Fabian, J., Chang, E., Pozniak, C. and Toma, J.G. (1994) Nerve growth factor derived from terminals selectively increases the ratio of p75 to trkA NGF receptors on mature sympathetic neurons. Dev Biol, 161, 206-217. Mischel, P.S., Smith, S.G., Vining, E.R., Valletta, J.S., Mobley, W.C and Reichardt, L.F. (2001) The extracellular domain of p75NTR is necessary to inhibit neurotrophin-3 signaling through TrkA. / Biol Chem, 276, 11294-11301. Mowla, S.J., Pareek, S., Farhadi, H.F., Petrecca, K., Fawcett, J.P., Seidah, N.G., Morris, S.J., Sossin, W.S. and Murphy, R.A. (1999) Differential sorting of nerve growth factor and brain-derived neurotrophic factor in hippocampal neurons. J Neurosci, 19, 2069-2080. Naumann, T., Casademunt, E., Hollerbach, E., Hofmann, J., Dechant, G., Frotscher, M. and Barde, Y.A. (2002) Complete deletion of the neurotrophin receptor p75NTR leads to long-lasting increases in the number of basal forebrain cholinergic neurons. J Neurosci, 22, 2409-2418. Nicholson, D.W. and Thornberry, N.A. (1997) Caspases: killer proteases. Trends Biochem Sci, 22, 299-306. Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., Taniguchi, T. and Tanaka, N. (2000) Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science, 288, 10531058. 82 Oh, J.D., Chartisathian, K., Chase, T.N. and Butcher, L.L. (2000) Overexpression of neurotrophin receptor p75 contributes to the excitotoxin-induced cholinergic neuronal death in rat basal forebrain. Brain Res, 853, 174-185. Olson, E.N., Arnold, H.H., Rigby, P.W. and Wold, B.J. (1996) Know your neighbors: three phenotypes in null mutants of the myogenic bHLH gene MRF4. Cell, 85, 14. Oppenheim, R.W. (1991) Cell death during development of the nervous system. Annu Rev Neurosci, 14, 453-501. Perini, G., Della-Bianca, V., Politi, V., Delia Valle, G., Dal-Pra, I., Rossi, F. and Armato, U. (2002) Role of p75 neurotrophin receptor in the neurotoxicity by beta-amyloid peptides and synergistic effect of inflammatory cytokines. J Exp Med, 195, 907918. Pettmann, B. and Henderson, CE. (1998) Neuronal cell death. Neuron, 20, 633-647. Pham, C.T., Maclvor, D.M., Hug, B.A., Heusel, J.W. and Ley, T.J. (1996) Long-range disruption of gene expression by a selectable marker cassette. Proc Natl Acad Sci US A, 93, 13090-13095. Purves, D., Snider, W.D. and Voyvodic, J.T. (1988) Trophic regulation of nerve cell morphology and innervation in the autonomic nervous system. Nature, 336, 123128. Putcha, G.V., Deshmukh, M. and Johnson, E.M., Jr. (1999) BAX translocation is a critical event in neuronal apoptosis: regulation by neuroprotectants, BCL-2, and caspases. J Neurosci, 19, 7476-7485. Putcha, G.V., Le, S., Frank, S., Besirli, C.G., Clark, K., Chu, B., Alix, S., Youle, R.J., LaMarche, A., Maroney, A.C. and Johnson, E.M. (2003) JNK-Mediated BIM Phosphorylation Potentiates BAX-Dependent Apoptosis. Neuron, 38, 899-914. Putcha, G.V., Moulder, K.L., Golden, J.P., Bouillet, P., Adams, J.A., Strasser, A. and Johnson, E.M. (2001) Induction of BIM, a proapoptotic BH3-only BCL-2 family member, is critical for neuronal apoptosis. Neuron, 29, 615-628. Puthalakath, H., Huang, D.C, O'Reilly, L.A., King, S.M. and Strasser, A. (1999) The proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein motor complex. Mol Cell, 3, 287-296. 83 Puthalakath, H., Villunger, A., O'Reilly, L.A., Beaumont, J.G., Coultas, L., Cheney, R.E., Huang, D.C and Strasser, A. (2001) Bmf: a proapoptotic BH3-only protein regulated by interaction with the myosin V actin motor complex, activated by anoikis. Science, 293, 1829-1832. Radeke, M.J., Misko, T.P., Hsu, C , Herzenberg, L.A. and Shooter, E.M. (1987) Gene transfer and molecular cloning of the rat nerve growth factor receptor. Nature, 325, 593-597. Ramirez-Solis, R., Zheng, H., Whiting, J., Krumlauf, R. and Bradley, A. (1993) Hoxb-4 (Hox-2.6) mutant mice show homeotic transformation of a cervical vertebra and defects in the closure of the sternal rudiments. Cell, 73, 279-294. Rana, A., Gallo, K., Godowski, P., Hirai, S., Ohno, S., Zon, L., Kyriakis, J.M. and Avruch, J. (1996) The mixed lineage kinase SPRK phosphorylates and activates the stress-activated protein kinase activator, SEK-1. J Biol Chem, 271, 1902519028. Robertson, A.G., Banfield, M.J., Allen, S.J., Dando, J.A., Mason, G.G., Tyler, S.J., Bennett, G.S., Brain, S.D., Clarke, A.R., Naylor, R.L., Wilcock, G.K., Brady, R.L. and Dawbarn, D. (2001) Identification and structure of the nerve growth factor binding site on TrkA. Biochem Biophys Res Commun, 282, 131-141. Rodriguez-Tebar, A., Dechant, G. and Barde, Y.A. (1990) Binding of brain-derived neurotrophic factor to the nerve growth factor receptor. Neuron, 4, 487-492. Rodriguez-Tebar, A., Dechant, G., Gotz, R. and Barde, Y.A. (1992) Binding of neurotrophin-3 to its neuronal receptors and interactions with nerve growth factor and brain-derived neurotrophic factor. Embo J, 11, 917-922. Roux, P.P. and Barker, P.A. (2002) Neurotrophin signaling through the p75 neurotrophin receptor. Prog Neurobiol, 67, 203-233. Roux, P.P., Bhakar, A.L., Kennedy, T.E. and Barker, P.A. (2001) The p75 neurotrophin receptor activates Akt (protein kinase B) through a phosphatidylinositol 3-kinasedependent pathway. J Biol Chem, 276, 23097-23104. Roux, P.P., Colicos, M.A., Barker, P.A. and Kennedy, T.E. (1999) p75 neurotrophin receptor expression is induced in apoptotic neurons after seizure. / Neurosci, 19, 6887-6896. 84 Sakuma, H., Ikeda, A., Oka, S., Kozutsumi, Y., Zanetta, J.P. and Kawasaki, T. (1997) Molecular cloning and functional expression of a cDNA encoding a new member of mixed lineage protein kinase from human brain. J Biol Chem, 272, 2862228629. Salehi, A.H., Xanthoudakis, S. and Barker, P.A. (2002) NRAGE, a p75 neurotrophin receptor-interacting protein, induces caspase activation and cell death through a JNK-dependent mitochondrial pathway. J Biol Chem, 277, 48043-48050. Sasaki, T. and Takai, Y. (1998) The Rho small G protein family-Rho GDI system as a temporal and spatial determinant for cytoskeletal control. Biochem Biophys Res Commun, 245, 641-645. Schmidt, A. and Hall, A. (2002) Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes Dev, 16, 1587-1609. Shamovsky, I.L., Ross, G.M., Riopelle, R.J. and Weaver, D.F. (1999) The interaction of neurotrophins with the p75NTR common neurotrophin receptor: a comprehensive molecular modeling study. Protein Sci, 8, 2223-2233. Siegel, R.M., Frederiksen, J.K., Zacharias, D.A., Chan, F.K., Johnson, M., Lynch, D., Tsien, R.Y. and Lenardo, M.J. (2000) Fas preassociation required for apoptosis signaling and dominant inhibition by pathogenic mutations. Science, 288, 23542357. Snider, W.D. (1994) Functions of the neurotrophins during nervous system development: what the knockouts are teaching us. Cell, 11, 627-638. Soppet, D., Escandon, E., Maragos, J., Middlemas, D.S., Reid, S.W., Blair, J., Burton, L.E., Stanton, B.R., Kaplan, D.R., Hunter, T. and et al. (1991) The neurotrophic factors brain-derived neurotrophic factor and neurotrophin-3 are ligands for the trkB tyrosine kinase receptor. Cell, 65, 895-903. Squinto, S.P., Stitt, T.N., Aldrich, T.H., Davis, S., Bianco, S.M., Radziejewski, C , Glass, D.J., Masiakowski, P., Furth, M.E., Valenzuela, D.M. and et al. (1991) trkB encodes a functional receptor for brain-derived neurotrophic factor and neurotrophin-3 but not nerve growth factor. Cell, 65, 885-893. Strasser, A., O'Connor, L. and Dixit, V.M. (2000) Apoptosis signaling. Annu Rev Biochem, 69, 217-245. 85 Stucky, CL. and Koltzenburg, M. (1997) The low-affinity neurotrophin receptor p75 regulates the function but not the selective survival of specific subpopulations of sensory neurons. J Neurosci, 17, 4398-4405. Syroid, D.E., Maycox, P.J., Soilu-Hanninen, M., Petratos, S., Bucci, T., Burrola, P., Murray, S., Cheema, S., Lee, K.F., Lemke, G. and Kilpatrick, T.J. (2000) Induction of postnatal Schwann cell death by the low-affinity neurotrophin receptor in vitro and after axotomy. J Neurosci, 20, 5741-5747. Taniuchi, M., Johnson, E.M., Jr., Roach, P.J. and Lawrence, J.C, Jr. (1986) Phosphorylation of nerve growth factor receptor proteins in sympathetic neurons and PC 12 cells. In vitro phosphorylation by the cAMP-independent protein kinase FA/GSK-3. J Biol Chem, 261, 13342-13349. Tibbies, L.A., Ing, Y.L., Kiefer, F., Chan, J., Iscove, N., Woodgett, J.R. and Lassam, N.J. (1996) MLK-3 activates the SAPK/JNK and p38/RK pathways via SEK1 and MKK3/6. Embo J, 15, 7026-7035. van Dam, H., Wilhelm, D., Herr, I., Steffen, A., Herrlich, P. and Angel, P. (1995) ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents. Embo J, 14, 1798-1811. Verdi, J.M., Birren, S.J., Ibanez, C.F., Persson, H., Kaplan, D.R., Benedetti, M., Chao, M.V. and Anderson, D.J. (1994) p75LNGFR regulates Trk signal transduction and NGF-induced neuronal differentiation in MAH cells. Neuron, 12, 733-745. von Schack, D., Casademunt, E., Schweigreiter, R., Meyer, M., Bibel, M. and Dechant, G. (2001) Complete ablation of the neurotrophin receptor p75NTR causes defects both in the nervous and the vascular system. Nat Neurosci, 4, 977-978. Wallach, D., Boldin, M., Goncharov, T., Goltsev, Y., Mett, I., Malinin, N., Adar, R., Kovalenko, A. and Varfolomeev, E. (1996) Exploring cell death mechanisms by analyzing signaling cascades of the TNF/NGF receptor family. Behring Inst Mitt, 144-155. Walsh, G.S., Krol, K.M., Crutcher, K.A. and Kawaja, M.D. (1999a) Enhanced neurotrophin-induced axon growth in myelinated portions of the CNS in mice lacking the p75 neurotrophin receptor. J Neurosci, 19, 4155-4168. 86 Walsh, G.S., Krol, K.M. and Kawaja, M.D. (1999b) Absence of the p75 neurotrophin receptor alters the pattern of sympathosensory sprouting in the trigeminal ganglia of mice overexpressing nerve growth factor. J Neurosci, 19, 258-273. Wang, K., Yin, X.M., Chao, D.T., Milliman, CL. and Korsmeyer, S.J. (1996) BID: a novel BH3 domain-only death agonist. Genes Dev, 10, 2859-2869. Wang, K.C, Kim, J.A., Sivasankaran, R., Segal, R. and He, Z. (2002) P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature, 420, 7478. Wang, S., Bray, P., McCaffrey, T., March, K., Hempstead, B.L. and Kraemer, R. (2000) p75(NTR) mediates neurotrophin-induced apoptosis of vascular smooth muscle cells. Am J Pathol, 157, 1247-1258. Wang, X., Bauer, J.H., Li, Y., Shao, Z., Zetoune, F.S., Cattaneo, E. and Vincenz, C. (2001) Characterization of a p75(NTR) apoptotic signaling pathway using a novel cellular model. J Biol Chem, 276, 33812-33820. Whitfield, J., Neame, S.J., Paquet, L., Bernard, O. and Ham, J. (2001) Dominant-negative c-Jun promotes neuronal survival by reducing BIM expression and inhibiting mitochondrial cytochrome c release. Neuron, 29, 629-643. Wiesmann, C , Ultsch, M.H., Bass, S.H. and de Vos, A.M. (1999) Crystal structure of nerve growth factor in complex with the ligand-binding domain of the TrkA receptor. Nature, 401, 184-188. Wong, ST., Henley, J.R., Kanning, K.C, Huang, K.H., Bothwell, M. and Poo, M.M. (2002) A p75(NTR) and Nogo receptor complex mediates repulsive signaling by myelin-associated glycoprotein. Nat Neurosci, 5, 1302-1308. Woolf, C.J. and Bloechlinger, S. (2002) Neuroscience. It takes more than two to Nogo. Science, 297, 1132-1134. Xu, Z., Maroney, A.C., Dobrzanski, P., Kukekov, N.V. and Greene, L.A. (2001) The MLK family mediates c-Jun N-terminal kinase activation in neuronal apoptosis. Mol Cell Biol, 21, 4713-4724. Yaar, I. (1997) Computing normative ranges without recruiting normal subjects. Muscle Nerve, 20, 1510-1514. 87 Yamashita, T., Higuchi, H. and Tohyama, M. (2002) The p75 receptor transduces the signal from myelin-associated glycoprotein to Rho. J Cell Biol, 157, 565-570. Yamashita, T. and Tohyama, M. (2003) The p75 receptor acts as a displacement factor that releases Rho from Rho-GDI. Nat Neurosci, 6, 461-467. Yamashita, T., Tucker, K.L. and Barde, Y.A. (1999) Neurotrophin binding to the p75 receptor modulates Rho activity and axonal outgrowth. Neuron, 24, 585-593. Yan, H. and Chao, M.V. (1991) Disruption of cysteine-rich repeats of the p75 nerve growth factor receptor leads to loss of ligand binding. J Biol Chem, 266, 1209912104. Yoon, S.O., Casaccia-Bonnefil, P., Carter, B. and Chao, M.V. (1998) Competitive signaling between TrkA and p75 nerve growth factor receptors determines cell survival. J Neurosci, 18, 3273-3281. Yu, J., Zhang, L., Hwang, P.M., Kinzler, K.W. and Vogelstein, B. (2001) PUMA induces the rapid apoptosis of colorectal cancer cells. Mol Cell, 1, 673-682. Zha, J., Harada, H., Osipov, K., Jockel, J., Waksman, G. and Korsmeyer, S.J. (1997) BH3 domain of BAD is required for heterodimerization with BCL-XL and proapoptotic activity. J Biol Chem, 272, 24101-24104. Zha, J., Harada, H., Yang, E., Jockel, J. and Korsmeyer, S.J. (1996) Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell, 87, 619-628. Zha, J., Weiler, S., Oh, K.J., Wei, M.C. and Korsmeyer, S.J. (2000) Posttranslational Nmyristoylation of BID as a molecular switch for targeting mitochondria and apoptosis. Science, 290, 1761-1765. Zhang, W., Behringer, R.R. and Olson, E.N. (1995) Inactivation of the myogenic bHLH gene MRF4 results in up-regulation of myogenin and rib anomalies. Genes Dev, 9, 1388-1399. 88 Appendix 89 Section Editor: Gary Westbrook Senior Editor: David Ginty Apoptosis Induced by p75NTR Requires Jun Kinase-dependent Phosphorylation of Bad. Asha L. Bhakar1, Jenny L. Howell1, Christine E. Paul1, Amir H. Salehi1, Esther B. E. Becker2, Farid Said3, Azad Bonni2 and Philip A. Barker1. 'Centre for Neuronal Survival, Montreal Neurological Institute, McGill University, 3801 University Avenue, Montreal, Quebec, Canada, H3A 2B4. department of Pathology, Harvard Medical School, Boston, Massachusetts, USA. 02115 3 Aegera Therapeutics Inc., 810 Golf Street, Montreal, Quebec Canada, H3E 1A8 Running title: p75NTR activates Bad to induce apoptosis Number of text pages: 28 Number of words: Abstract: Introduction: Discussion: Number of figures: 163 498 1097 9 Correspondence: Philip A. Barker Montreal Neurological Institute McGill University 3801 University Avenue Montreal, Quebec, Canada, H3A 2B4 Phone: (514) 398-3064, Fax: (514) 398-5214 Email: [email protected] ACKNOWLEDGEMENTS: We are grateful to David Kaplan and Mathieu Boudreau for providing the MLK3 adenovirus, to Aviva Tolkovsky for providing the truncated-JIP1 adenovirus, to Ze'ev Ronai for providing phospho-specific antibodies to Threonine 81 in p53, to Mohanish Deshmukh for advice on cleaved Caspase-3 immunostaining and to Genevieve Dorval for technical assistance in titrating adenovirus. This work was supported by grant MOP37850 from the Canadian Institute of Health Research (CIHR; to PAB) and by NIH grant RO1-NS41021-01 (to AB). ALB was supported by a studentship from the CIHR, JLH is supported by a Jean Timmons Costello Foundation studentship, CEP is supported by a Natural Science and Engineering Research Centre studentship, AHS is supported by a National Cancer Institute of Canada studentship, and EB is supported by the Boehringer Ingelheim Fonds. PAB is Scientist of the Canadian Institute of Health Research. Keywords: neurotrophin, BH3-domain only, JNK, trk, cell death 90 ABSTRACT The p75 neurotrophin receptor (p75NTR), a member of the TNF receptor superfamily, facilitates apoptosis during development and following injury to the central nervous system. The signaling cascades activated by p75NTR that result in apoptosis remain poorly understood. In this study, we show that activation of p75NTR in primary cortical neurons, in PC 12 cells and in glioma cells results in activation of Jun kinase (JNK), accumulation of Cytochrome C within the cytosol, and activation of Caspases 9, 6 and 3. To link p75NTR-dependent JNK activation to mitochondrial Cytochrome C release, regulation of BH3-domain-only family members was examined. Transcription of BH3domain-only family members was not induced by p75NTR but p75NTR-dependent JNK activation resulted in phosphorylation and oligomerization of the BH3-domain-only family member, Bad. Loss of function experiments using Bad dominant negatives or RNA interference demonstrated a requirement for Bad in p75NTR-induced apoptosis. Together, these studies provide the first data linking apoptosis induced by cell surface receptor activation to the post-translational regulation of BH3-domain-only family members. 91 INTRODUCTION The four mammalian neurotrophins comprise a family of related growth factors required for differentiation, survival, development, and death of specific populations of neurons and non-neuronal cells. The effects of the neurotrophins are mediated by binding to cell surface TrkA, TrkB and TrkC tyrosine-kinase receptors and to the p75 neurotrophin receptor (p75NTR). Roles for Trk receptors in neurotrophin action in neuronal survival, growth and synaptic modulation are now well established (Kaplan and Miller, 2000; Patapoutian and Reichardt, 2001). The functions of the p75NTR receptor are complex and have been more difficult to ascertain (Dechant and Barde, 2002; Roux and Barker, 2002). It is clear that p75NTR functions as a Trk co-receptor that increases neurotrophin binding affinity (Barker and Shooter, 1994; Ryden et al., 1997; Esposito et al., 2001) and recent studies suggest that it may be a critical element in a receptor complex that responds to myelin-based growth inhibitory signals (Wang et al., 2002; Wong et al., 2002) and regulates myelination (Cosgaya et al., 2002). p75NTR also has autonomous signaling roles, particularly in facilitating apoptosis. In vitro analyses have shown that p75NTR induces cell death in primary trigeminal (Davies et al., 1993), hippocampal (Friedman, 2000; Brann et al., 2002), and sympathetic neurons (Lee et al., 1994; Bamji et al., 1998), as well as retinal precursor (Frade et al., 1996; Frade and Barde, 1998), Schwann (Soilu-Hanninen et al., 1999; Syroid et al., 2000; Petratos et al., 2003), oligodendrocyte (Casaccia-Bonnefil et al., 1996; Yoon et al., 1998) and neuroblastoma cells (Bunone et al., 1997). In vivo, p75NTR plays a prominent role in apoptosis that occurs in glia and neurons following traumatic injury to the spinal cord (Casha et al., 2001; Beattie et al., 2002) or brain (Roux et al., 1999; Troy et al., 2002) and has been implicated in developmental apoptosis in somites, (Cotrina et al., 2000) retina and spinal cord (Frade and Barde, 1999) and in the peripheral nervous system (Bamji et al., 1998). The signaling events that link p75NTR activation to apoptosis are beginning to emerge and p75NTR-dependent apoptosis is associated with an increase in Rac and Jun kinase (JNK) activity and Caspase activation (Tournier et al., 2000; Harrington et al., 2002). The precise ligand requirements for p75NTR apoptotic signaling are not clear but recent studies have shown that unprocessed NGF (proNGF) is a more efficacious p75NTR 92 ligand than mature NGF (Lee et al., 2001; Beattie et al., 2002). A plethora of p75NTR interacting proteins have been identified (Roux and Barker, 2002) and some of these, including NRAGE (Salehi et al., 2000), NRIF (Casademunt et al., 1999) and NADE (Mukai et al., 2000), facilitate p75NTR-dependent apoptosis. We have recently shown that NRAGE activates a mitochondrial death pathway involving JNK-dependent Cytochrome C release and the activation of Caspases (Salehi et al., 2002) but establishing the precise roles of each of the cytosolic interactors of p75NTR remains a significant challenge. Despite this progress, several important questions remain unresolved. The proximal elements that connect p75NTR to apoptotic pathways remain uncertain and it is not clear whether JNK activation is a prerequisite for p75NTR-induced apoptosis in all responsive cells. Further, the mechanisms employed by p75NTR to induce mitochondrial Cytochrome C release and Caspase activation are unknown. In this report, we addressed the mechanism of p75NTR-induced apoptosis in primary mouse cortical neurons and in pheochromacytoma, glioma, neuroblastoma and medulloblastoma cells. Our findings reveal that activated p75NTR invariably causes JNK activation, mitochondrial Cytochrome C release and Caspase 9, 6 and 3 activation. We show that JNK activation is necessary for p75NTR-dependent Caspase cleavage in all responsive cell types. To link p75NTR-induced JNK activation to mitochondrial dysfunction, we examined the ability of p75NTR to increase expression of BH3-domain-only proteins but found that p75NTR did not activate transcription of BH3-domain-only genes. Instead, we demonstrate that p75NTR activation results in JNK-dependent phosphorylation of the BH3-domain-only protein Bad and show that Bad is required for p75NTR-induced apoptosis. 93 MATERIALS AND METHODS Materials. Cell culture reagents were purchased from BioWhittaker, unless otherwise indicated. The p75NTR antibody aPl and the phospho-Serl28 antibody have been previously described (Roux et al., 1999). The phospho-Thr83 p53 antibody was a kind gift of Ze'ev Ronai. The JNK1 antibody (C-17, cat# sc-474), the two Bad antibodies (C20, cat# sc-943 and N-19 cat# sc-6542) and the actin antibody (C-2, cat#sc-8432) were purchased from Santa Cruz Biotechnology. Anti-Flag antibody (M2, cat# F-3165) was obtained from Sigma, Cytochrome C antibody was purchased from Pharmingen (cat# 556433), b-galactosidase (LacZ) antibody was purchased from Promega (cat# 23781) and anti-HA antibody (12CA5, cat# 1583816) was purchased from Roche. PhosphoThr183/Tyr185 JNK (G9, cat# 9255), phospho-Ser63 c-Jun (cat# 9261), phospho-Ser73 c-Jun (cat# 9164S), c-Jun (cat# 9162), Caspase-9 (cat# 9502), cleaved Caspase-3 (Aspl75, cat# 9661), cleaved Caspase-6 (Aspl98; cat# 9761S), and cleaved PARP (Asp214; cat# 9541) specific antibodies were obtained from Cell Signaling Technology. Horseradish peroxidase-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Laboratories. Immunoreactive bands were detected using enhanced chemiluminescence purchased from Perkin Elmer Life Sciences. All other reagents were from Sigma, Calbiochem, or ICN Biochemicals, unless otherwise indicated. Plasmids and recombinant adenovirus. Preparation of recombinant adenovirus expressing enhanced green fluorescence protein (AdGFP), b-galactosidase (AdLacZ), full-length p75NTR (Adp75NTR) , the Flag-tagged JNK-binding domain of JIP1 (AdJBD) and HA-epitope tagged MLK-3 (adMLK3) have been previously described (Roux et al., 2002). All adenoviruses were amplified in 293A cells and purified on a sucrose gradient, as previously described (Roux et al., 2002). Viruses were titered by optical density and using the tissue culture infectious dose 50 (TCID) assay in 293A cells. Titers are expressed in term of plaque forming units. The Bad dominant negative plasmid consisting of GFP fused to a Bad nonapeptide in which Serl28 was substituted by Ala and the parental GFP vector have both been previously described (Konishi et al., 2002). The Bad RNAi construct was generated as previously described (Gaudilliere et al., 2002). 94 Cell culture, infection and transfection. Human glioma (U343, U373, U87, and U251) and medulloblastoma (UW228-1, UW228-3, UW228-3, and Daoy) cell lines were provided by Dr. Roland Del Maestro (McGill University) and maintained in 5% C0 2 at 37° C in either Dulbecco's modified Eagle's medium (DMEM) or RPMI medium and supplemented with 10% fetal calf serum (FCS, Clontech), 2 mM L-glutamine, 100 ug/ml penicillin/streptomycin. Neuroblastoma cell lines (SY5Y, SKNAS, 15N, and NGP) were provided by Dr. David Kaplan and maintained as above. The rat pheochromocytoma cell line, PC 12, was maintained as previously described (Roux et al., 2001) and the PC12rtTA cell line (PC 12) was purchased from Clontech and maintained in 10% C0 2 at 37° C in DMEM supplemented with 10% FCS, 5% horse serum, 2 mM L-glutamine, 100 ug/ml penicillin/streptomycin and 100 ug/ml G418. Cell lines were plated 18 to 24 hours prior to transfection and typically harvested 24 to 48 hours after infection. Primary cortical cultures were prepared from El4-16 CD1 mouse telencephalon as described previously (Bhakar et al., 2002). Neuronal cultures were infected prior to plating and then maintained in vitro for 2 days in Neurobasal media (Life Technologies) supplemented with IX B27 supplement (Life Technologies), 2mM L-glutamine, and 100 ug/ml penicillin/streptomycin. PC 12 cells were plated on poly-L-lysine coated plates and transfected using Lipofectamine2000 as directed by the manufacturer (Invitrogen). Cells lines were infected with adenovirus 24 hours after plating. Cytochrome C release assay. Cytosol enriched subcellular fractions were prepared as described in (Salehi et al., 2002). In brief, five million cells were harvested, washed once in Tris-buffered saline (10 mM Tris (pH 8.0), 150 mM NaCl), once in Buffer A (100 mM sucrose, 1 mM EGTA, 20 mM MOPS (pH 7.4)), and then resuspended in 500 ul Buffer B (Buffer A plus 5% Percoll, 0.01% digitonin, 1 ug/ml aprotinin, 1 ug/ml leupeptin, 1 ug/ml pepstatin, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride). A sample of this suspension was retained as total cell lysate. The remainder was incubated on ice for 15 minutes and then centrifuged at 2500 g for 10 minutes to remove intact cells and nuclei. The supernatant was then centrifuged at 15 000 g for 15 min to pellet mitochondria. The final supernatant was designated cytosol. 95 Immunoblotting. Cells were lysed in RIPA buffer (10 mM Tris (pH 8.0), 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 1 ug/ml Aprotinin, 1 ug/ml leupeptin, 1 ug/ml pepstatin, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride) and analyzed for protein content using the BCA assay (Pierce). Samples were normalized for protein content, suspended in Laemmli sample buffer, separated by SDSpolyacrylamide gel electrophoresis, and electroblotted onto nitrocellulose. Blocking and secondary antibody incubations of immunoblots were performed in Tris-buffered saline/Tween (10 mM Tris (pH 8.0), 150 mM NaCl, 0.2% Tween 20) supplemented with 5% (w/v) dried skim milk powder or 5% (w/v) bovine serum albumin (BSA) (Pierce). All primary antibody incubations were performed in the blocking solution, except for those involving phospho-specific antibodies which were performed in Tris-buffered saline/Tween supplemented with 5% BSA. Immunoreactive bands were detected by chemiluminescence (Perkin Elmer Life Sciences), according to the manufacturer's instructions. Survival assay. Analysis of cell survival was performed by MTT assay using 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), which was added at a final concentration of 1 mg/ml for the last four hours of a 48 hour infection. The reaction was ended by the addition of one volume of solubilization buffer (20% SDS, 10% dimethylformamide, and 20% acetic acid). After overnight solubilization, specific and non-specific absorbencies were read at 570 and 690 nm, respectively. Each data point was performed in triplicate or quadruplicate, and experimental results were analyzed by multiple analyses of variance with statistical probabilities assigned using the Tukey test for multiple comparisons. Each experiment was performed independently at least three times. RT-PCR. 450,000 U373 cells or primary cortical neurons were infected with virus and 24 hours later mRNA was isolated using the RNEasy Mini kit according to the manufacturer's instructions (Qiagen). cDNA was generated using the Omniscript RT kit 96 (Qiagen) and random hexamers (Roche) as primers. PCR was performed for 30 cycles using 300 nM of the following primers for U373 cells: actin hBIMEL hBMF hHrk/Dp5 hBIK hPUMA hNOXA sense, 5' CACCACTTTCTACAATGAGC antisense, 5' sense, 5' TGGCAAAGCAACCTTCTGATG antisense, 5' sense, 5' CTTGCTCTCTGCTGACCTGTTTG antisense, 5' sense, 5' TCGGCAGGCGGAACTTGTAG antisense, 5' sense, 5' AACCCCGAGATAGTGCTGGAAC antisense, 5' sense, 5' ACTGTGAATCCTGTGCTCTGCC antisense, 5' sense, 5' CCAAACTCTTCTGCTCAGGAACC antisense, 5' CGGTCAGGATCTTCATGAGG AGTCGTAAGATAACCATTCGTGGG AAGCCGATAGCCAGCATTGC GCTGTATGTAAATAGCATTGGGGTG GCTGGAAACCAACATTTTATTGAGC ACCCCCCAAATGAATGCCAG CGGTAATCTTCGGCAAAAACAC For mouse cortical neurons, PCR was performed using the same conditions as above using the following primers: mBimEL mBMF mHrk/Dp5 mBIK mNOXA p75NTR sense, 5' CCCCTACCTCCCTACAGACAGAA antisense, 5* sense, 5' CTTGCTCTCTGCTGACCTCTTTG antisense, 5' sense, 5' TGGAAACACAGACAGAGGAAGCC antisense, 5' sense, 5' TCACCAACCTCAGGGAAAACATC antisense, 5' sense, 5' TGATGTGATGAGAGAAACGCTCG antisense, 5' sense, 5' TGAATTCTGGAACAGCTGCAAAC antisense, 5' CCAGACGGAAGATAAAGCGTAACAG GTTGCGTATGAAGCCGATGG AAAGGAAAGGGACCACCACG AGCAGGGGTCAAGAGAAGAAGG AAAGCAATCCCAAACGACTGCC CCTTAAGTCACACTGGGGATGTG 97 5% of the cDNA prepared was used in a 25ul PCR reaction and the reaction product was separated on an 8% polyacrylamide gel, stained with ethidium bromide and visualized under UV light. Single Cell Caspase-3 Activation Assay. PC 12 cells were transfected with plasmids encoding either GFP alone, GFP fused to a dominant interfering Bad nonapeptide, or GFP plasmid and pU6/BS-Bad RNA interference plasmid at a 1:2 ratio. Cells were infected with either adLacZ or with adp75NTR 48 hours after transfection and fixed 24 hours later using 4% paraformaldehyde (PFA) in PBS. Cells were blocked in TBS supplemented with 5% donkey serum and 0.3% Triton-xlOO for 30 minutes and then incubated for 18 hours at 4°C with control rabbit sera or with antibodies directed against cleaved Caspase 3. Secondary antibodies (donkey anti-rabbit conjugated Cy3) and Hoescht 33248 were applied for 2 hours at 4° C. GFP-positive cells were scored for the presence of activated Caspase 3 by a blinded observer, with 300 cells counted per condition. This experiment was repeated three times and the composite data was analyzed for statistical significance by ANOVA (Tukey HDS multiple comparison). 98 RESULTS The physiological conditions that result in activation of p75NTR apoptotic pathways are complex and likely regulated by multiple ligands and co-receptors. We have previously shown that recombinant adenovirus expressing full-length p75NTR or the p75NTR intracellular domain efficiently induces apoptosis in the absence of added ligand (Roux et al., 2001) and this approach was used to define apoptotic signaling pathways activated by p75NTR. We began by testing cell lines and primary cell types for susceptibility to p75NTR-induced death. Figure 1 shows that primary mouse cortical neurons, PC 12 pheochromacytoma cells and U343 and U373 glioma lines all showed reduced viability when infected with adenovirus expressing p75NTR whereas infection with control adenovirus expressing b-galactosidase (LacZ) had no significant effect. Other lines tested, including other glioma lines (U251 and U87), various medulloblastoma lines (Daoy, UW288-1, UW288-2, and UW288-3), and neuroblastoma lines (SY5Y, 15N, NGP, and SKNAS) were resistant to p75NTR-induced apoptosis in this assay (data not shown). For the remainder of this study, we focused our attention on p75NTR-dependent apoptosis in primary mouse cortical neurons, rat PC 12 cells and human U343 and U373 glioma lines. Activation of the extrinsic apoptotic pathway by death receptors that are structurally related to p75NTR results in autocleavage and activation of Caspase 8. Activation of the intrinsic apoptotic pathway results in release of mitochondrial contents and activation of Caspase 9. We therefore determined the activation status of apical Caspases 8 and 9 and effector Caspases 3 and 6 during p75NTR-induced apoptosis. Expression of p75NTR resulted in a reduction in levels of full-length Caspase 9, a corresponding increase in activated Caspase 9, Caspase 3, and Caspase 6 and accumulation of the cleaved form of PARP, a Caspase 3 substrate (Figure 2A-B). In contrast, p75NTR-dependent Caspase 8 cleavage was not observed in any of the cell types examined (data not shown). p75NTRdependent Caspase activation was not due to adenoviral toxicity since cells infected with comparable quantities of LacZ adenovirus did not exhibit Caspase activation. These data indicate that p75NTR-induced apoptosis occurs primarily through an intrinsic death pathway that involves release of mitochondrial contents and activation of Caspase 9. 99 Caspase 9 activation requires formation of an apoptosome complex consisting of Caspase 9, Apaf-1 and cytosolic Cytochrome C. Release of Cytochrome C from mitochondria into the cytosol is a key regulatory step in this process. To determine if Cytochrome C is released during p75NTR-induced apoptosis, cells were left uninfected or were infected with p75NTR or a control adenovirus, then lysed, subjected to subcellular fractionation and cytosolic fractions were analyzed for Cytochrome C levels by immunoblot. Figure 2C shows that Cytochrome C was not detected in the cytosol of uninfected cells or in cells infected with control adenovirus whereas cytosolic Cytochrome C was readily detected in the cytosol of cells expressing p75NTR. Thus, p75NTR induces Cytochrome C release from mitochondria of multiple cell types. Activation of the JNK pathway is an important regulator of apoptotic events in several neuronal death paradigms and JNK can be activated by p75NTR in several cell types. Consistent with this, we found that p75NTR expression in primary mouse cortical neurons and in PC 12 and U373 cells consistently resulted in phosphorylation of JNK (Figure 3A-B) or induced a dose-responsive increase in the phosphorylation of c-Jun, a JNK target, (Figure 3C). These results indicate that 75NTR-induced JNK activation is a consistent feature of a variety of p75NTR-responsive cell types. To begin to address the role of the JNK pathway in p75NTR-induced apoptosis, we tested the effect of CEP1347, a MAP3K inhibitor that exhibits anti-apoptotic effects in several neuronal and non-neuronal systems (Saporito et al., 2002). We first tested the ability of CEP 1347 to block c-Jun phosphorylation in PC 12 cells overexpressing MLK3, a MAP3K identified as a target of CEP1347. Figure 4A shows that the compound almost completely blocked the robust c-Jun phosphorylation induced by this kinase. We next examined whether CEP 1347 reduced c-Jun phosphorylation or Caspase 3 activation which was induced by p75NTR. CEP 1347 did indeed reduce p75NTR-dependent c-Jun phosphorylation and Caspase 3 activation but only at high concentrations (500-1000 nM; Figure 4B-C; data not shown). These findings indicate that reductions in MAP3K and 100 JNK signaling attenuates apoptosis induced by p75NTR yet suggest that blockade of a non-preferred target of CEP 1347 is required for this effect. To directly assess the role of JNK activity in p75NTR-induced death, an adenovirus expressing the JNK binding domain of the JIP scaffolding molecule (AdJBD) was used to inhibit JNK activity in vivo. This JIP fragment is believed to sequester JNK and thus acts as an effective dominant inhibitor of JNK signaling (Harding et al., 2001). We first confirmed that AdJBD is capable of blocking JNK-dependent target phosphorylation by demonstrating that it blocked c-Jun phosphorylation induced by TNFa, a well characterized JNK pathway inducer (Figure 5A). Subsequent studies established that AdJBD was equally effective in blocking c-Jun phosphorylation induced by p75NTR expression (Figure 5B). To determine if JNK inhibition blocked apoptotic signaling induced by p75NTR, cells were infected with p75NTR in the absence or presence of AdJBD and assessed for Caspase 3 activation. Expression of AdJBD effectively blocked Caspase 3 activation in all responsive cell types, indicating a crucial role for JNK activation in p75NTR-induced apoptosis (Figure 5C and data not shown). These data demonstrate that JNK activation is a prerequisite for p75NTR-induced apoptosis but substrates of JNK that play a role in p75NTR-induced apoptosis are unknown. To begin to characterize targets of JNK involved in p75NTR-induced death, we first compared c-Jun phosphorylation induced by p75NTR or MLK3, a potent inducer of JNK activity (see above). Figure 6A shows that p75NTR and MLK3 induced robust phosphorylation of JNK. However, there was considerable discordance between the JNK activation, c-Jun phosphorylation and Caspase-3 activation induced by p75NTR versus MLK3. p75NTR and MLK3 induced comparable JNK phosphorylation but only MLK3 produced a substantial increase in c-Jun phosphorylation whereas only p75NTR induced substantial cleavage of Caspase 3. To determine if our experimental design may have missed an early peak in p75NTR-induced c-Jun phosphorylation, JNK activation and cJun phosphorylation were examined at 12, 18, 24 and 30 hours after adenovirus infection. Figure 6B shows that phosphorylated JNK was first detected 18 hours after p75NTR infection and increased further by 24 and 30 hours. Cleaved Caspase 3 was detectable 24 101 hours after infection but c-Jun phosphorylation showed a significant lag, and an elevation in phospho-Jun levels were detected only after 30 hours infection. These data show that JNK activation correlates with p75NTR-induced death and suggests that c-Jun is not a preferred substrate of the JNK complex which is activated by p75NTR. BH3-domain-only proteins directly and indirectly induce the association of Bax and Bak, which in turn facilitates release of mitochondrial proteins such as Cytochrome C into the cytosol. Transcriptional activation of BH3-domain-only genes through c-Jun or p53 dependent pathways is important in apoptosis in several neuronal and non-neuronal settings. We therefore examined whether p75NTR-induced apoptosis correlated with accumulation of BH3-domain-only gene products. PC 12 and U373 cells and cortical neurons were infected with LacZ or p75NTR adenovirus and alterations in mRNA levels of the BH3-domain-only family members Bim, Bmf, Hrk, Bik, Puma, and Noxa were determined by RT-PCR. mRNA corresponding to each of these family members were readily detected in both cell types examined but p75NTR-dependent increases in their levels were not detected (Figure 7 and data not shown). This indicates that JNK activation induced by p75NTR does not induce transcription of BH3-domain-only genes and suggests that alternate pathways are responsible for p75NTR-induced Cytochrome C release and Caspase 3 activation. BH3-domain-only proteins can, in some instances, be regulated by post-translational mechanisms. Akt-dependent phosphorylation of Bad on Serl 12 and Serl36 allows it to associate with 14-3-3 proteins and thereby suppresses its pro-apoptotic activity. Apoptotic kinases including JNK directly activate the cell death machinery by phosphorylating Bad at Serine 128 (Donovan et al., 2002). The phosphorylation of Bad at this residue disrupts the interaction of Bad with 14-3-3 proteins thus allowing Bad to induce apoptosis (Konishi et al., 2002). We therefore determined if p75NTR activation resulted in phosphorylation of Bad on Serl28. PC 12 and U373 cells were infected with LacZ or p75NTR adenovirus and alterations in Bad phosphostatus was examined by immunoblot. Figures 8A and 8B show that p75NTR expression had little effect on the levels or phosphostatus of monomeric Bad (~25 kD) but rather induced the accumulation 102 of a higher molecular weight species (~75 kD). This product was detected by two antibodies directed against distinct epitopes in Bad (N19, C20) as well as by a phosphospecific antibody directed against the JNK phosphorylation site within Bad. The 75 kDa product therefore appears to represent a stable oligomeric complex containing Bad phosphorylated on Serine 128. To determine if JNK activity contributes to p75NTRdependent Bad phosphorylation and oligomerization, PC 12 cells were infected with adenovirus expressing p75NTR in the absence or presence of AdJBD, lysed and examined by Bad immunoblot. Figure 8C shows that inhibiting JNK activity with AdJBD prevented formation of the Bad complex, indicating that JNK activity is required for p75NTR-dependent Bad phosphorylation and oligomerization. To determine if phosphorylation of Serine 128 within Bad is necessary for p75NTRinduced apoptosis, PC 12 cells were transfected with a dominant negative Bad serine 128 mutant allele (Konishi et al., 2002) and then infected with p75NTR or control virus. The ability of the dominant negative Bad construct to inhibit p75NTR-dependent Caspase 3 activation was assessed after twenty-four hours of virus infection by scoring transfected cells for the presence of cleaved Caspase 3. Figure 9 shows that expression of the dominant negative Bad serine 128 mutant allele confers significant protection from p75NTR-induced apoptosis, indicating that Bad phosphorylation is necessary for p75NTR-induced apoptosis. To confirm that Caspase 3 cleavage induced by p75NTR requires Bad, p75NTR-induced apoptosis was assessed in cells in which the endogenous level of Bad were reduced using RNA interference. The ability of the RNAi construct to reduce Bad levels was first validated in 293 cells (Supplementary Figure 1) and then used to reduce Bad levels in PC 12 cells. PC 12 cells were transfected with GFP alone or with GFP together with the Bad-RNAi plasmid and, 48 hours later, were infected with either p75NTR or LacZ adenovirus for 24 hours. Figure 9 shows that PC 12 cells transfected with Bad-RNAi are highly resistant to p75NTR-induced apoptosis, indicating a crucial role for Bad in the p75NTR apoptotic pathway. 103 DISCUSSION The mechanisms utilized by p75NTR to induce apoptosis are unique and bear little similarity to cell death signaling pathways employed by other pro-apoptotic members of the TNF receptor superfamily. In this report, we show that p75NTR-induced death correlates with cytosolic accumulation of Cytochrome C and activation of Caspase 9 and Caspase 3. Using the JNK binding domain of JIP as a dominant suppressor of JNK activity, we show that JNK is required for p75NTR-induced Caspase 3 activation. Under conditions in which p75NTR induces JNK phosphorylation and death, p75NTR does not increase mRNA levels of BH3-domain-only family members that are transcriptionally regulated by c-Jun or p53. Instead, we demonstrate that p75NTR specifically increases phosphorylation and oligomerization of Bad and show that Bad plays a crucial role in p75NTR-induced death. Ligand binding to cell surface apoptotic receptors such as Fas and DR3 induces cell death by initiating formation of a DISC complex that facilitates FADD-dependent Caspase 8 aggregation and activation. Other death stimuli induce apoptosis primarily via Cytochrome C-dependent activation of Caspase 9 (Shi, 2002). Activation of Caspase 8 versus Caspase 9 is therefore a distinguishing regulatory event that provides insight into the precise apoptotic pathways invoked by an extracellular stimulus. We have found that in glioma cells, PC 12 cells and primary cortical neurons, p75NTR-induced apoptosis is invariably accompanied by the activation of Caspase 9, Caspase 6, and Caspase 3. p75NTR-dependent Caspase 8 activation was never observed. This suggests that activation of the intrinsic death pathway is crucial for p75NTR-induced apoptosis and indicates that cytosolic mitochondrial Cytochrome C accumulation is an important regulatory step in p75NTR-induced death. These findings are in substantial agreement with other studies examining p75NTR-dependent Caspase activation and are consistent with a recent study showing that blockade of Caspase 9 activity significantly attenuates p75NTR-induced apoptosis (Gu et al., 1999; Wang et al., 2001; Troy et al., 2002). Together, these results show that p75NTR induces apoptosis through an intrinsic death pathway that results in mitochondrial Cytochrome C release and Caspase 9 activation. 104 The JNK signaling cascade plays a crucial role in apoptosis induced by a variety of stimuli (Kuranaga and Miura, 2002). We examined the role of JNK in p75NTR-induced apoptotic signaling by expressing a fragment of the JIP scaffolding molecule that directly binds to JNK and thus acts as a dominant JNK suppressor. This approach revealed that JNK signaling is a critical prerequisite for p75NTR-dependent Caspase activation in all cell types examined. We also report that CEP1347 reduces p75NTR-dependent death but only at high concentrations, suggesting that inhibition of p75NTR-induced death by CEP 1347 likely results from blockade of a non-preferred target distinct from MLK3. Together with other recent studies (Friedman, 2000; Harrington et al., 2002), these data therefore indicate a crucial role for JNK activation in p75NTR-induced apoptosis in all cell types examined to date and raises the possibility that enzymes in the JNK pathway may provide feasible targets for inhibiting p75NTR-induced apoptosis following traumatic CNS injury. BH3-domain-only family members inhibit the action of anti-apoptotic Bcl-2 family members such as Bcl-2 and Bcl-xL and facilitate the action of Bax and Bak at the mitochondria (Letai et al., 2002). The regulation of BH3-domain-only proteins is a key step linking proximal signaling events to the induction of cell death (Huang and Strasser, 2000). In sympathetic neurons, JNK activation results in phosphorylation of c-Jun which in turn results in transcription of the BH3-domain-only family members Bim and Hrk (Harris and Johnson, 2001; Putcha et al., 2001; Whitfield et al., 2001). In other systems, p53 activation results in transcription of Noxa and Puma, also pro-apoptotic BH3domain-only family members (Wu and Deng, 2002). We therefore hypothesized that p75NTR-dependent apoptosis was associated with transcription of known BH3-domainonly family members. However, p75NTR does not appear to enhance transcription of BH3-domain-only family members, suggesting that alternative pathways are responsible. BH3-domain-only family members are present in normal cells in the absence of apoptotic stimuli and must be rendered inactive to prevent apoptosis. One mechanism that accomplishes this is their sequestration through protein-protein interactions. For example, the BH3-domain-only protein Bad is bound to 14-3-3 (Zha et al., 1996; Datta et al., 2000) 105 and Bim and Bmf can be sequestered in the cytosol by binding to dynein light chain or myosin V (Puthalakath et al., 1999; Puthalakath et al., 2001). Significantly, recent findings have revealed that the sequestration of these three BH3-domain-only proteins can be negatively regulated by JNK. UV irradiation of HEK293 cells results in JNKdependent phosphorylation of Bmf and Bim, releasing these proteins from their sequestration and allowing them to contribute to the apoptotic cascade (Lei and Davis, 2003). The Serine 128 phosphorylation of BAD activates BAD specifically by inhibiting the interaction of Serine 136-phosphorylated BAD with 14-3-3 proteins (Konishi et al. 2002). Serine 136 is a target of survival factor-induced kinases including Akt in neurons. That p75NTR induces cell death in part by inducing the phosphorylation of BAD at Serine 128 suggests that p75NTR promotes apoptosis by opposing survival factor signals that suppress the cell death machinery. Further, p75NTR activation results in the oligomerization of Bad through a JNK-dependent pathway. Aside from Bad itself, the components of this stable oligomeric complex remain unknown but may include antiapoptotic proteins such as Bcl-2 and Bcl-Xl (Letai et al., 2002). These findings provide the first data linking cell surface receptor activation to the post-translational regulation of BH3-domain-only family members and indicate that p75NTR regulates apoptosis through a JNK pathway that is independent of transcription. Palmada et al (2002) have recently found that c-Jun is not required for p75NTR-induced cell death. Consistent with this, our data show that levels of c-Jun phosphorylation induced by p75NTR are modest and do not induce transcription of c-Jun targets that include Bim and Hrk. Thus, although c-Jun phosphorylation is a useful surrogate to assess JNK activation, it does not appear to play a significant role in p75NTR-induced apoptosis. However, alternative JNK-dependent pathways may contribute to p75NTRdependent apoptosis. One candidate pathway involves p53, which can be activated by direct JNK phosphorylation and has been implicated in p75NTR-induced apoptosis in one study (Aloyz et al., 1998). However, and p75NTR readily induces apoptosis in cells lacking functional p53 (eg. U373 cells, Figure 1) and phosphospecific antibodies directed against Thr 81, a JNK target residue in p53 (Buschmann et al., 2001), or against Serl5 or Ser20 (Dumaz et al., 2001) did not reveal significant p75NTR-dependent phosphorylation 106 of p53 (data not shown). Nonetheless, we cannot rule out the possibility that p53 or related family members may play a role in p75NTR-induced apoptosis in specific circumstances. Further examination of transcriptional pathways in p75NTR action is warranted. p75NTR plays a prominent role in nervous system apoptosis, particularly following trauma, and a detailed picture of the pro-apoptotic signal transduction mechanisms activated by the receptor is required. In this study, we show that p75NTR-dependent JNK activation is invariably required for Caspase activation and find that p75NTR-dependent JNK activation induces phosphorylation and activation of the BH3-domain-only protein Bad and that Bad is required for p75NTR-induced apoptosis. 107 REFERENCES Aloyz RS, Bamji SX, Pozniak CD, Toma JG, Atwal J, Kaplan DR, Miller FD (1998) p53 is essential for developmental neuron death as regulated by the TrkA and p75 neurotrophin receptors. J Cell Biol 143:1691-1703. Bamji SX, Majdan M, Pozniak CD, Belliveau DJ, Aloyz R, Kohn J, Causing CG, Miller FD (1998) The p75 neurotrophin receptor mediates neuronal apoptosis and is essential for naturally occurring sympathetic neuron death. J Cell Biol 140:911923. Barker PA, Shooter EM (1994) Disruption of NGF binding to the low affinity neurotrophin receptor p75LNTR reduces NGF binding to trkA on PC 12 cells. Neuron 13:203-215. Beattie MS, Harrington AW, Lee R, Kim JY, Boyce SL, Longo FM, Bresnahan JC, Hempstead BL, Yoon SO (2002) ProNGF induces p75-mediated death of oligodendrocytes following spinal cord injury. Neuron 36:375-386. Bhakar AL, Tannis LL, Zeindler C, Russo MP, Jobin C, Park DS, MacPherson S, Barker PA (2002) Constitutive nuclear factor-kappa B activity is required for central neuron survival. J Neurosci 22:8466-8475. Brann AB, Tcherpakov M, Williams IM, Futerman AH, Fainzilber M (2002) Nerve growth factor-induced p75-mediated death of cultured hippocampal neurons is age-dependent and transduced through ceramide generated by neutral sphingomyelinase. J Biol Chem 277:9812-9818. Bunone G, Mariotti A, Compagni A, Morandi E, Delia VG (1997) Induction of apoptosis by p75 neurotrophin receptor in human neuroblastoma cells. Oncogene 14:14631470. Buschmann T, Potapova O, Bar-Shira A, Ivanov VN, Fuchs SY, Henderson S, Fried VA, Minamoto T, Alarcon-Vargas D, Pincus MR, Gaarde WA, Holbrook NJ, Shiloh Y, Ronai Z (2001) Jun NH2-terminal kinase phosphorylation of p53 on Thr-81 is important for p53 stabilization and transcriptional activities in response to stress. Mol Cell Biol 21:2743-2754. Casaccia-Bonnefil P, Carter BD, Dobrowsky RT, Chao MV (1996) Death of oligodendrocytes mediated by the interaction of nerve growth factor with its receptor p75. Nature 383:716-719. Casademunt E, Carter BD, Benzel I, Frade JM, Dechant G, Barde YA (1999) The zinc finger protein NRIF interacts with the neurotrophin receptor p75(NTR) and participates in programmed cell death. Embo J 18:6050-6061. Casha S, Yu WR, Fehlings MG (2001) Oligodendroglial apoptosis occurs along degenerating axons and is associated with FAS and p75 expression following spinal cord injury in the rat. Neuroscience 103:203-218. Cosgaya JM, Chan JR, Shooter EM (2002) The neurotrophin receptor p75NTR as a positive modulator of myelination. Science 298:1245-1248. Cotrina ML, Gonzalez-Hoyuela M, Barbas J A, Rodriguez-Tebar A (2000) Programmed cell death in the developing somites is promoted by nerve growth factor via its p75(NTR) receptor. Dev Biol 228:326-336. Datta SR, Katsov A, Hu L, Petros A, Fesik SW, Yaffe MB, Greenberg ME (2000) 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell 6:41-51. 108 Davies AM, Lee KF, Jaenisch R (1993) p75-deficient trigeminal sensory neurons have an altered response to NGF but not to other neurotrophins. Neuron 11:565-574. Dechant G, Barde YA (2002) The neurotrophin receptor p75(NTR): novel functions and implications for diseases of the nervous system. Nat Neurosci 5:1131-1136. Donovan N, Becker EB, Konishi Y, Bonni A (2002) JNK phosphorylation and activation of BAD couples the stress-activated signaling pathway to the cell death machinery. J Biol Chem 277:40944-40949. Dumaz N, Milne DM, Jardine LJ, Meek DW (2001) Critical roles for the serine 20, but not the serine 15, phosphorylation site and for the polyproline domain in regulating p53 turnover. Biochem J 359:459-464. Esposito D, Patel P, Stephens RM, Perez P, Chao MV, Kaplan DR, Hempstead BL (2001) The cytoplasmic and transmembrane domains of the p75 and Trk A receptors regulate high affinity binding to nerve growth factor. J Biol Chem 276:32687-32695. Frade JM, Barde YA (1998) Microglia-derived nerve growth factor causes cell death in the developing retina. Neuron 20:35-41. Frade JM, Barde YA (1999) Genetic evidence for cell death mediated by nerve growth factor and the neurotrophin receptor p75 in the developing mouse retina and spinal cord. Development 126:683-690. Frade JM, Rodriguez-Tebar A, Barde YA (1996) Induction of cell death by endogenous nerve growth factor through its p75 receptor. Nature 383:166-168. Friedman WJ (2000) Neurotrophins induce death of hippocampal neurons via the p75 receptor. J Neurosci 20:6340-6346. Gaudilliere B, Shi Y, Bonni A (2002) RNA interference reveals a requirement for myocyte enhancer factor 2A in activity-dependent neuronal survival. J Biol Chem 277:46442-46446. Gu C, Casaccia-Bonnefil P, Srinivasan A, Chao MV (1999) Oligodendrocyte apoptosis mediated by caspase activation. J Neurosci 19:3043-3049. Harding TC, Xue L, Bienemann A, Haywood D, Dickens M, Tolkovsky AM, Uney JB (2001) Inhibition of JNK by overexpression of the JNL binding domain of JIP-1 prevents apoptosis in sympathetic neurons. J Biol Chem 276:4531-4534. Harrington AW, Kim JY, Yoon SO (2002) Activation of Rac GTPase by p75 is necessary for c-jun N-terminal kinase-mediated apoptosis. J Neurosci 22:156-166. Harris CA, Johnson EM, Jr. (2001) BH3-only Bcl-2 family members are coordinately regulated by the JNK pathway and require Bax to induce apoptosis in neurons. J Biol Chem 276:37754-37760. Huang DC, Strasser A (2000) BH3-Only proteins-essential initiators of apoptotic cell death. Cell 103:839-842. Kaplan DR, Miller FD (2000) Neurotrophin signal transduction in the nervous system. Curr Opin Neurobiol 10:381-391. Konishi Y, Lehtinen M, Donovan N, Bonni A (2002) Cdc2 phosphorylation of BAD links the cell cycle to the cell death machinery. Mol Cell 9:1005-1016. Kuranaga E, Miura M (2002) Molecular genetic control of caspases and JNK-mediated neural cell death. Arch Histol Cytol 65:291-300. 109 Lee K-F, Davies AM, Jaenisch R (1994) p75-deficient embryonic dorsal root sensory and neonatal sympathetic neurons display a decreased sensitivity to NGF. Development 120:1027-1033. Lee R, Kermani P, Teng KK, Hempstead BL (2001) Regulation of cell survival by secreted proneurotrophins. Science 294:1945-1948. Lei K, Davis RJ (2003) JNK phosphorylation of Bim-related members of the Bcl2 family induces Bax-dependent apoptosis. Proc Natl Acad Sci U S A 100:2432-2437. Letai A, Bassik MC, Walensky LD, Sorcinelli MD, Weiler S, Korsmeyer SJ (2002) Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics. Cancer Cell 2:183-192. Mukai J, Hachiya T, Shoji-Hoshino S, Kimura MT, Nadano D, Suvanto P, Hanaoka T, Li Y, Irie S, Greene LA, Sato TA (2000) NADE, a p75NTR-associated cell death executor, is involved in signal transduction mediated by the common neurotrophin receptor p75NTR. J Biol Chem 275:17566-17570. Patapoutian A, Reichardt LF (2001) Trk receptors: mediators of neurotrophin action. Curr Opin Neurobiol 11:272-280. Petratos S, Butzkueven H, Shipham K, Cooper H, Bucci T, Reid K, Lopes E, Emery B, Cheema SS, Kilpatrick TJ (2003) Schwann cell apoptosis in the postnatal axotomized sciatic nerve is mediated via NGF through the low-affinity neurotrophin receptor. J Neuropathol Exp Neurol 62:398-411. Putcha GV, Moulder KL, Golden JP, Bouillet P, Adams JA, Strasser A, Johnson EM (2001) Induction of BIM, a proapoptotic BH3-only BCL-2 family member, is critical for neuronal apoptosis. Neuron 29:615-628. Puthalakath H, Huang DC, O'Reilly LA, King SM, Strasser A (1999) The proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein motor complex. Mol Cell 3:287-296. Puthalakath H, Villunger A, O'Reilly LA, Beaumont JG, Coultas L, Cheney RE, Huang DC, Strasser A (2001) Bmf: a proapoptotic BH3-only protein regulated by interaction with the myosin V actin motor complex, activated by anoikis. Science 293:1829-1832. Roux PP, Barker PA (2002) Neurotrophin signaling through the p75 neurotrophin receptor. Prog Neurobiol 67:203-233. Roux PP, Colicos MA, Barker PA, Kennedy TE (1999) p75 neurotrophin receptor expression is induced in apoptotic neurons after seizure. J Neurosci 19:68876896. Roux PP, Bhakar AL, Kennedy TE, Barker PA (2001) The p75 neurotrophin receptor activates Akt (protein kinase B) through a phosphatidylinositol 3-kinasedependent pathway. J Biol Chem 276:23097-23104. Roux PP, Dorval G, Boudreau M, Angers-Loustau A, Morris SJ, Makkerh J, Barker PA (2002) K252a and CEP1347 are neuroprotective compounds that inhibit mixedlineage kinase-3 and induce activation of Akt and ERK. J Biol Chem 277:4947349480. Ryden M, Hempstead B, Ibanez CF (1997) Differential modulation of neuron survival during development by nerve growth factor binding to the p75 neurotrophin receptor. J Biol Chem 272:16322-16328. 110 Salehi AH, Xanthoudakis S, Barker PA (2002) NRAGE, a p75 neurotrophin receptorinteracting protein, induces caspase activation and cell death through a JNKdependent mitochondrial pathway. J Biol Chem 277:48043-48050. Salehi AH, Roux PP, Kubu CJ, Zeindler C, Bhakar A, Tannis LL, Verdi JM, Barker PA (2000) NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor-dependent apoptosis. Neuron:279288. Saporito MS, Hudkins RL, Maroney AC (2002) Discovery of CEP-1347/KT-7515, an inhibitor of the JNK/SAPK pathway for the treatment of neurodegenerative diseases. Prog Med Chem 40:23-62. Shi Y (2002) Mechanisms of caspase activation and inhibition during apoptosis. Mol Cell 9:459-470. Soilu-Hanninen M, Ekert P, Bucci T, Syroid D, Bartlett PF, Kilpatrick TJ (1999) Nerve growth factor signaling through p75 induces apoptosis in Schwann cells via a Bcl2-independent pathway. J Neurosci 19:4828-4838. Syroid DE, Maycox PJ, Soilu-Hanninen M, Petratos S, Bucci T, Burrola P, Murray S, Cheema S, Lee KF, Lemke G, Kilpatrick TJ (2000) Induction of postnatal Schwann cell death by the low-affinity neurotrophin receptor in vitro and after axotomy. J Neurosci 20:5741-5747. Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones SN, Flavell RA, Davis RJ (2000) Requirement of JNK for stress-induced activation of the cytochrome c- mediated death pathway. Science 288:870-874. Troy CM, Friedman JE, Friedman WJ (2002) Mechanisms of p75-mediated death of Hippocampal neurons: Role of caspases. J Biol Chem 3:3. Wang KC, Kim JA, Sivasankaran R, Segal R, He Z (2002) P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature 420:74-78. Wang X, Bauer JH, Li Y, Shao Z, Zetoune FS, Cattaneo E, Vincenz C (2001) Characterization of a p75NTR apoptotic signaling pathway using a novel cellular model. J Biol Chem 12:12. Whitfield J, Neame SJ, Paquet L, Bernard O, Ham J (2001) Dominant-negative c-Jun promotes neuronal survival by reducing BIM expression and inhibiting mitochondrial cytochrome c release. Neuron 29:629-643. Wong ST, Henley JR, Kanning KC, Huang KH, Bothwell M, Poo MM (2002) A p75(NTR) and Nogo receptor complex mediates repulsive signaling by myelinassociated glycoprotein. Nat Neurosci 5:1302-1308. Wu X, Deng Y (2002) Bax and BH3-domain-only proteins in p53-mediated apoptosis. Front Biosci7:dl51-156. Yoon SO, Casaccia-Bonnefil P, Carter B, Chao MV (1998) Competitive signaling between TrkA and p75 nerve growth factor receptors determines cell survival. J Neurosci 18:3273-3281. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ (1996) Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCLX(L). Cell 87:619-628. Ill FIGURE LEGENDS Figure 1. Overexpression of p75NTR induces cell death in a variety of cell types. (A) cortical neurons, (B) PC 12, (C) U343 (wild type p53), and (D) U373 (mutant p53) cells were infected with increasing multiplicities of infection (MOI) of LacZ or p75NTR recombinant adenovirus and then analyzed for survival by the MTT assay (see Materials and Methods). Error bars indicate SD. Results were analyzed for statistical significance by ANOVA (Tukey HSD multiple comparison). Statistically significant differences of p<0.001 are indicated by an asterisk. Figure 2. p75NTR activates Caspases and induces accumulation of cytosolic Cytochrome C. (A) Cortical neurons infected with 10, 50, or 100 MOI of LacZ or p75NTR recombinant adenovirus were lysed and analyzed by immunoblot for levels of LacZ, p75NTR and full-length Caspase 9 protein or, using cleavage-specific antibodies, for levels of cleaved Caspases 3 and 6 and cleaved Poly(ADP-ribose) polymerase (PARP). (B) U373 cells were infected with 50 or 100 MOI of either LacZ or p75NTR adenovirus for 48 hours, or treated with etoposide 50 uM (+), and then lysed and analyzed for increases in cleaved Caspase 9. (C) E15 cortical neurons, U373, and PC12 cells were left uninfected (0) or were infected with 100 MOI of LacZ (Lz), or p75NTR (p75) recombinant adenovirus. 30 hours later cells were fractionated for cytosolic components as described in "Materials and Methods". Cytosolic fractions normalized for protein content were analyzed by immunoblotting with an antibody directed against Cytochrome C. Figure 3. p75NTR activates the JNK pathway. (A) U373 cells were infected with 0, 50, 100, or 200 MOI of control AdLacZ or with Adp75NTR, (B) PC12 cells were injected with 0 or 50 MOI of AdLacZ or Adp75NTR, and (C) cortical neurons were infected with 10, 50, or 150 MOI of AdLacZ or Adp75NTR. Lysates were prepared 3048 hours after infection and examined by immunoblot for LacZ, p75NTR, phosphorylated JNK (pJNK), total JNK, phosphorylated c-Jun (pJun) and total c-Jun as indicated. 112 Figure 4. Inhibition of MAP3K signaling attenuates apoptosis induced by p75NTR. (A) U373 cells infected with 100 MOI of MLK3 adenovirus or left uninfected (0), were treated 47 hours later with DMSO or CEP 1347 at 200 nM for 1 hour. Cells were harvested and lysates subjected to immunoblot analysis for phospho-Ser63 c-Jun (pJun) and total c-Jun protein. (B) Cortical neurons infected with 50 MOI of LacZ or p75NTR adenovirus were treated with DMSO or 50, 200, or 500 nM CEP1347 for 1 hour as in (A). Lysates were analyzed by immunoblot as indicated (pJun, c-Jun, LacZ, p75NTR). (C) AdLacZ or Adp75NTR-infected cortical neurons were treated with 500 nM of CEP 1347 [C] or DMSO [D] at the time of infection and lysates were prepared 48 hours later and analyzed by immunoblot for levels of p75NTR, LacZ, phospho-Ser63 c-Jun (pJun), and cleaved Caspase 3 (cl. Caspase 3). Figure 5. Activation of the JNK pathway is required for p75NTR-mediated Caspase activation. Immunoblots for phospho-Ser63 c-Jun (pJun), c-Jun, Flag-JIP, LacZ, p75NTR, phospho-Thr183/Tyrl85-JNK (pJNK), JNK, and cleaved Caspase 3 were performed as indicated on lysates from (A) U373 cells treated with TNF 20ng/ml that were either left uninfected (0) or infected with JBD-JIP adenovirus (JBD) at 10 MOI, (B) cortical neurons infected with 50 MOI of LacZ or p75NTR adenovirus together with increasing amounts (0, 0.05, 0.5, 2.5 MOI) of JBD-JIP adenovirus, and (C) PC12 cells infected with 50 MOI of LacZ or p75NTR adenovirus supplemented with LacZ or JBD-JIP (JBD) adenovirus (both at 5 MOI). Figure 6. p75NTR-induced Caspase 3 cleavage does not correlate with phosphorylation of c-Jun. PC 12 cells were infected with 50 MOI of AdLacZ (Lz), Adp75NTR (p75), or AdMLK3 (MLK) recombinant adenovirus and lysates were prepared at 30 hours post-infection (A and C), or at 12, 18, 24, and 30 hours postinfection (B). Lysates normalized for protein content were analyzed for LacZ, p75NTR, cleaved Caspase 3, phospho-Thr183/Tyr185-JNK (pJNK), total JNK, phospho-Ser63 c-Jun (pJun) and total c-Jun protein levels by immunoblot as indicated. 113 Figure 7. p75NTR does not transcriptionally regulate BH3-domain-only proteins. Cortical neurons were infected with 0, 50, or 200 MOI of LacZ or p75NTR (p75) adenovirus and 24 hours later mRNA was isolated as described in Materials and Methods. RT-PCR was performed using primers directed against Bim, Bmf, Hrk, Bik, Puma, Noxa, p75NTR and Actin as indicated. Figure 8. p75NTR activates JNK-dependent phosphorylation and oligomerization of Bad. (A) U373 cells were infected with 0, 50, 100, or 200 MOI of LacZ or p75NTR adenovirus and lysates were analyzed by immunoblot for LacZ, p75NTR, phospho-Ser128 Bad, and Bad (C-20 - shown; N19 - data not shown). (B) PC 12 cells were left uninfected (0) or were infected with LacZ (Lz) or p75NTR (p75) adenovirus aqt 100 MOI and lysates were analyzed by immunoblot for LacZ, p75NTR, phospho-Ser128 Bad, and Bad (C-20). (C) PC 12 cells were infected with nothing (0), LacZ (Lz), or p75NTR (p75) adenovirus together with either 5 MOI of LacZ or JBD-JIP (JBD) adenovirus. Lysates were compared for expression of Bad, cleaved Caspase 3, LacZ, p75NTR, and Flag-JIP (Flag) by immunoblot as indicated. Figure 9. Bad is required for p75NTR-induced apoptosis. PC 12 cells were transfected with GFP plasmid alone or with GFP plasmid together with plasmids encoding DN-Bad (SI28A) or expressing Bad-RNAi. Cells were infected 48 hours later with LacZ or p75NTR adenovirus and, at 24 hours post-infection, were fixed and immunostained for cleaved Caspase 3 as described in Materials and Methods. Transfected cells were scored for Caspase 3 cleavage by a blind observer (n =300 cells/condition). '**' indicates a difference of p<0.001 between GFP/Mock (Bar 1) and GFP/p75NTR (Bar 5) and '*' indicates a difference of p<0.001 between GFP/p75NTR (Bar 5) and both DNBad/p75NTR (Bar 6) and with Bad RNAi/p75NTR (Bar 7), indicated by ANOVA. 114 Cortical Neurons 0.045 0.035 w wo < en 0.025 LacZ .p75NTR £ in 0.015 li 0.005 0 50 250 B PC12 0.8 >. I 8 0.6 > o ; in LacZ .p75NTR £ m 0.4 t~ * 0.2 I i 0 50 100 U343 %i 1 I1 1l j s 0.5 oo * < cr> 0.4 l£> to > O 0.3 £ in w Q 0.2 I :* i 0.1 0 D i 0 10 .p75NTR 1 JUL 50 100 250 U373 1.6 to IA „ IB o < 0> s <° 56 1.4 1.2 1 n • £ m 0.8 0.6 ; 0.4 Figure 1 Bhakar et al. I, 1 I 0.2 0 LacZ .p75NTR * 10 50 100 * 250 115 LacZ 10 50 p75NTR 100 10 50 100 LacZ mm% p75NTR mM Caspase 9 ~m* CI Caspase 3 CI PARP — B LacZ 0 p75NTR 50 100 50 TSF *^ Z^t M 100 Cortical neurons mm PC12 — Bhakar et. al. + Lz p75 — Figure 2 CI Caspase 6 U373 116 A B LacZ 0 p75NTR C rj 50 100200 50 100200 Lz p75 JH mm «• m mmmm - Figure 3 Bhakar et al. -r JNK * • » • » • • LacZ -, LacZ 10 50 150 p75NTR 10 50 150 P75NTR pJNK JNK - • - mm, — — — P75NTR pJun 117 MLK3 0 DMSO CEP C-Jun « M » W B LacZ DMSO 500 50 CEP 200 p75NTR DMSO 500 500 50 m CEP 200 500 pJun - c-Jun ,., LacZ ^^^m ymmim •^"* ^^^ p75NTR LacZ p75NTR C D C D C — pJun — CI Caspase 3 LacZ fcaE~- Figure 4 Bhakar et al. — *• 118 0 TNF 0 10 JBD —mm pJun Flag-JBD B LacZ 0 p75NTR 0 0.05 0.5 2.5 0 0.05 0.5 2.5 JBD Sm — pJun Jun LacZ p75NTR Flag-JBD LacZ JBD Lz p75 Lz p75 0 *•» pJNK JNK pJun CI Caspase 3 w « LacZ p75NTR Flag-JBD Figure 5 Bhakar et al. 119 Lz p75 MLK a s pJNK JNK pJun mm - ~ CI Caspase 3 B 12 18 24 Lz p75 Lz p75 Lz p75 «• I • """*• <•»• 30 hours Lz p75 « M m^-IB LacZ P75NTR - — C I Caspase 3 *""* ~ " «2! PJNK — pJun Figure 6 Bhakar et al. 120 LacZ p75 0 50 200 50 200 Figure 7 Bhakar et al 121 B LacZ 0 p75NTR 0 50 100 200 50 100 200 — Lz p75 mm LacZ LacZ Wmf H •~m~ — • - -• — «l m m p75NTR LacZ JBD 0 Lz p75 Lz p75 Bad • " * • CI Caspase 3 pS128-Bad m - * - pS 128-Bad LacZ p75NTR Bad - * - Bad Flag-JBD Figure 8 Bhakar et al. 122 GFP Mock Figure 9 Bhakar et al. GFP DN-Bad LacZ Bad RNAi GFP DN-Bad p75NTR Bad RNAi 123 Supplementary Figure 1 BAD U6 US-Ri Bad Actin Validation of Bad RNA Interference vector. Bad RNAi was validated by transfection of 293 cells with a Bad expression plasmid in the absence or presence of the U6-driven Bad RNAi plasmid, followed by lysis and analysis by immunoblot Upper panel was analyzed with an anti-Bad antibody (N-20) and lower panel with an antibody directed against actin. M = Mock transfection, V = pcDNA3, U6 = pcDNA3+U6 promoter. U6-R1I = pcDNA3+ U6 promoter drivingBad RNAi Guide ine;; ror completing the fo.'rn are available at wwyv mcgiil sa/rjo/animal ssr^ss Protccc! : * McGili University Animal Use Protocol -- Research !nvestica:cr:?: Approval End Date Facility Ccmr.iiee F i l l ; : MAGE gt-nes arid autism (musi t.iatek ike til. e of the funding source application) X] New Application Q] Renewal of Protocol # _ Category (see section llj Pilot I. Investigator Data: Principal Investigator Dr Phi! A Barker Neurology arid Neurosurgery' Bepiirmienii: FaT,i: M.N.I. - :;810 Universilv St. Iddi-ess: Email: Jy«-5iH phil.barker'axicgil] c£ I. Emergency C o n t a c t s : i u o peoj le must be designated to handle err erge: >aes. 830-3243 Same: Phi Barkei Work ft: 393-3064 3 Name: Kathleen E'icisoi YV'ork#: 393-3212 Emergency it: 3, F u a d i o g Source: Esters ai [^ Internal ioma Source (s): (s): Stat is : [K; A-warded ~'^J 827-2919 For Office Use Only: C l.F.R. - MOP-62^-99 Peer Reviewed: £>3 YES ..>*..< j ^ , . L ] NO** f j Pending Funding period: Ai:r 1. 2003-Mar. 3 1 . 200-i | | Peer Reviewed: Q Status: YES ' 1 Awarded L NO** Q Pending Funding period: ** Ail ]:rojecis ihi.t have not been peer reviewed for scientific nKrit bv tfce funding source require 2 Pee:- !iev:ev Fo ins to be comsjeiafi e.;>. Projects f jnded from .ndiistriai sources. Pee:* Review Jonas are avaiiabie at www tncgiH.Cii/rgD/animai i Proposed Start But of Anima! Use (d/m/v): jane 16. 2003 or ongoing i Expect:d Date of 'Completio.i of Animal Use (d/m/y): Mar. 3 ?. 2005 9r ongoing 1 1 1 i i Investigator's Statement: The information in this application js^oact ^:fS comptoe. I assure that all care and Lse of animals ir tus i proposal will be in accordance with the guidelines and policies of' thejtanacBan Council on Animal Care and tlicse of McG 11 Universi>• I shall I request the Aaimal Care Committee's approval prior to any deviatiG5<s^frd"ii this/protocol as approved. I understand that this approval is valid i for one year and mjst be approved on an annual basis. /// / ! I " I y -' / j Principal Investigator's signature:' ' I ,-•>- / / Approvedby: 1 Chair, Facility Ankaai C.sre Committee: • ] Til .> r - . i L^aje. University Veterinarian: i ! Date; 1 C h a r , Ethics Subcommittee (as perDACCpolio): 4pp r eved Animal list Beginning: [ j This protocol has fceer approved with the modiikations noted in Section 13. October 2002 | Dare: ! Endin<*: S3 i