* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download tggccatcgtaaggtgcgacc ggtagca
Oncogenomics wikipedia , lookup
Metagenomics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Primary transcript wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Quantitative trait locus wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gene expression programming wikipedia , lookup
DNA vaccination wikipedia , lookup
Y chromosome wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenomics wikipedia , lookup
Point mutation wikipedia , lookup
Human genome wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Neocentromere wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Ridge (biology) wikipedia , lookup
Genomic library wikipedia , lookup
Genome editing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
Genome evolution wikipedia , lookup
Gene expression profiling wikipedia , lookup
X-inactivation wikipedia , lookup
Genomic imprinting wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding DNA wikipedia , lookup
Minimal genome wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome (book) wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
Designer baby wikipedia , lookup
History of genetic engineering wikipedia , lookup
Name: _____________________ DNA vs. Genes vs. Chromosomes Definitions 1. DNA is a nucleic acid that contains the sequence for all our traits. 2. Genes are sections of DNA that code for a particular trait. 3. Chromosomes are condensed DNA fibers, each containing several genes Comparisons 4. Write in order from smallest to largest: DNA, genes, chromosome 5. DNA makes up each gene, which are organized into chromosomes 6. Chromosomes are made of genes, which are made of DNA Identify: Write DNA, Genes, or Chromosomes to show which each statement is describing. The starred (**) will have more than one answer. Chromosomes 7. Inherit one set from mom and one set from dad. Genes, Chromosomes 8. Same in every person ** DNA, Genes, Chromosomes 9. Found in nucleus ** Genes 10. Codes for a trait Chromosomes 11. Contains many genes Genes 12. About 25,000 found in humans Chromosomes 13. May be single-stranded or double-stranded DNA 14. Sequence of nucleotides Genes 15. Contain dominant or recessive alleles Chromosomes 16. There are 46 in humans Drawings: On the drawing below, write the sequence on the other strand of DNA. Then label DNA, chromosome, and genes. T G G C C A C C G G Gene A T C T A G T A A G G C A T T Chromosome ** How many genes are shown in the drawing above? 3 G C C T G C G A C C G DNA Metaphors 1. Example: If a book represented a chromosome, each chapter would be a gene, and the words would be DNA 2. In the space below, come up with your own metaphor to show the relationship between DNA, genes, and chromosomes. Draw a picture in the space below. Underneath each picture, give a brief description of how your picture represents the concept. DESCRIPTION PICTURE DNA Gene Correct based on comments made here. If I did not make comments, leave it alone. Chromosome