Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
DNA Microarray Experiments and Analysis John Wyrick MBios 503 12/6/2004 mRNA level Down Up Mechanics of DNA Microarrays complex mixture of mRNA molecules Fluorescent Dye Gene 1 Gene 2 UACGGCUUAGCAGGUCAUUGG ATGCCGAATCGTCCAGTAACC ...Gene 6200 Constructing DNA Microarrays § A DNA microarray is a collection of DNA probes separated in a regular array atop a solid support (glass slide, silicon chip, etc) § Affymetrix oligonucleotide microarrays • Short oligonucleotide probes (25mers) are synthesized directly on a silicon wafer using photolithography methods • Multiple oligonucleotide probes per gene including mismatch probe controls § cDNA microarrays • Full length cDNAs are PCR amplified and then printed using a robot onto coated glass slides • Glass slides can be coated with poly-lysine, GAPS, etc to facilitate attachment of DNA to the glass slide § Oligonucleotide microarrays • Long (70 - 100mers) oligonucleotide probes are printed on coated glass slides cDNA Microarray For Yeast: • Array of 6361 spots, each representing a single yeast gene • Printed on GAPS-coated glass microscope slide • Each spot contains 500 pg of PCR product • Size of PCR products range from 60 bp to 1500 bp; average size: 480 bp Affymetrix Oligonucleotide Microarrays • 6181 ORFs + alignment controls • each ORF: 20 perfect match 25mers (PM) 20 single base mismatch (MM) • mRNA signal = average of differences (PM - MM) • Sensitivity = 0.1 mRNA molecules/cell • Dynamic range = 0.1 - 100 mRNAs/cell • Reproducibility = wt vs wt experiment, 99% of genes within 1.7 fold The Mechanics of a DNA Microarray Experiment § Isolate mRNA from cell cultures § Reverse Transcribe mRNA into cDNA § Label cDNA or cRNA by incorporating fluorescently-labeled nucleotides § Hybridize labeled cDNA to DNA microarray § Wash and scan microarray in confocal laser scanner § Analyze data DNA Microarray Experimental Procedure Extracting Data from Scanned Microarray Image Scanned Image Gene with altered mRNA levels § Grid • The total amount of fluorescence intensity of Cy5 and Cy3 dyes inside each grid circle is calculated • Grid can be aligned manually or automatically Experimental mRNA (Cy5) Control mRNA (Cy3) Merge Initial Microarray Data Analysis § Data Normalization • Total signal normalization • Exogenous (spiked) control mRNAs § Filters for identifying genes with altered mRNA levels • Absolute intensity change thresholds • Fold-change cutoffs • T-tests and other significance tests • Permutation tests • Error model methods § Use a Database to normalize, filter, and analyze microarray data • Integrate microarray data with data from other sources (gene function, proteomics data, etc) Microarray Database Literature -Gene annotations Results Analysis Tools Raw data DataBase -Microarray data -mySQL Perl Perl Web interface -Error model analysis -Cluster analysis -Chromosome display Methods for Data Mining and Visualization § Data visualization tools • Displays microarray data using prior knowledge of gene location/function § Clustering • Simplifies analysis by grouping together genes with similar expression patterns, but does not infer relationships between genes § Boolean Comparisons • Compares different microarray data sets to identify significant overlaps in expression patterns § Hidden Markov models • Useful for clustering time course data § Bayesian networks • Useful for identifying and testing relationships between genes Raw Microarray Data GCN5 deletion Gene ORF YAL069W SEO1 (YAL067C) ORF YAL066W ORF YAL065C ORF YAL065C-A ORF YAL063C GDH3 (YAL062W) ORF YAL061W ORF YAL060W SIM1 (YAL059W) CNE1 (YAL058W) ORF YAL058C-A ORF YAL056W ORF YAL055W ACS1 (YAL054C) ORF YAL053W ORF YAL051W ORF YAL049C ORF YAL048C ORF YAL047C ORF YAL046C ORF YAL045C GCV3 (YAL044C) PTA1 (YAL043C) ORF YAL042W ORF YAL043C-A CDC24 (YAL041W) CLN3 (YAL040C) CYC3 (YAL039C) CDC19 (YAL038W) Gene (parse) YAL069W YAL067C YAL066W YAL065C YAL065CA YAL063C YAL062W YAL061W YAL060W YAL059W YAL058W YAL058CA YAL056W YAL055W YAL054C YAL053W YAL051W YAL049C YAL048C YAL047C YAL046C YAL045C YAL044C YAL043C YAL042W YAL043CA YAL041W YAL040C YAL039C YAL038W WT1val 2.0 13.0 10.0 10.0 21.0 9.0 17.0 21.0 96.0 182.0 56.0 12.0 52.0 43.0 15.0 51.0 8.0 117.0 5.0 0.0 44.0 2.0 339.0 23.0 167.0 10.0 1.0 37.0 86.0 2651.0 WT1call A A A A A A M P P P P A P P A P A P A A P A P P P A A P P P MT1val 6.9 6.9 2.5 6.3 3.1 0.6 11.3 12.0 53.5 105.7 33.3 23.3 56.6 29.6 0.6 52.2 16.4 112.6 17.6 12.6 18.9 12.6 315.8 43.4 118.3 12.0 110.1 70.5 78.6 2257.6 MT1call A A A A A A A A A P P A P A A P A P A A A A P P P A P P P P WT2val 0.7 11.3 20.0 7.3 14.0 20.0 18.0 16.0 58.1 154.2 40.7 0.7 66.8 13.4 6.0 61.4 22.7 98.8 7.3 12.0 40.7 7.3 236.3 41.4 140.2 5.3 12.7 50.7 72.1 3955.4 WT2call A A P A A A M A P P P A P A M P P P A A P A P P P A A P P P MT2val 0.0 0.9 16.4 2.7 23.7 2.7 3.6 9.1 57.4 96.6 29.2 25.5 67.5 65.6 0.0 95.7 8.2 101.2 0.9 5.5 29.2 5.5 255.2 50.1 97.5 20.1 24.6 34.6 58.3 4586.3 MT2call A A A A A A A A P P M A P P A P A P A A A A P P P A A P P P