Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
BHQ1 A T A T G C Phosphorothioate bond G C G C C G T A Restriction endonuclease site C G A T Fluorophore-dT CT GT G A TACGCCACCAGCTCC ACTACCACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAAAATAATGAAAATGTGACTATATTA 3’ ACGGATGCGGTGGTCGAGGTTGATGGTGTTCAAATATAAGTCAGTAAAAGTCGTCCGGAATATTATTTTTATTACTTTTACACTGATATAATCTTG5’ Figure S2 OCEAN ternary structure. At the selected reaction temperature, the target (in black) binds the anchor (in dark gray) and its specific amplifier (in light gray) forming a 3-way DNA junction that contains a restriction endonuclease site (in the rectangle). The underlined base represents the nucleotide potentially mutated.