Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Supplemental Table IV
Document related concepts
no text concepts found
Transcript
Supplemental Table I. Information on ERF genes from Arabidopsis, japonica and indica rice closely related to BERF1. Percentages of aminoacid identity and similarity with BERF1 are reported (s, short version; l, long version). Lines separate distinct loci. Where the same gene has been identified in both japonica and indica rice, identity and similarity with BERF1 are given only with the japonica sequence. Chromosomal locations are reported with reference to the TIGR japonica rice genome sequence and the TAIR Arabidopsis genome sequence. *Sub1A is only present in indica rice where it maps on chromosome 9, 45 kb from Sub1B (Xu et al., 2006). TIGR ID/ gene species GenBank Protein Chromosome, coordinates Accession length % identity s-BERF1 % identity l-BERF1 reference 63% 68% Nakano et al., (2006); Lin et al., (2007) (aa) 9, OsERF72/ OsEBP2 Japonica rice Os09g26420 OsBIERF1 Indica rice AY831392 OsERF71 Japonica rice Os06g09390 1595854115961244 396 399 Cao et al. (2006) 6, 362 41,3% 41,5% Nakano et al., (2006) 365 40,9% 41% Nakano et al., (2006) 365 40,9% 41% Cheong et al., (2003) 250 30,5% 30,5% Nakano et al., (2006) 244 30,5% 30,5% Xu et al., (2006) 232 26,7% 26,7% Nakano et al., (2006) 235 26,7% 25,7% Xu et al., (2006) 281 28% 26% Xu et al., (2006) 359 36,7% 36,6% Okamuro et al., (1997) 380 38,6% 36,7% Okamuro et al., (1997) 4730451- 4732320 2, OsERF70 Japonica rice Os02g54160 OsEREBP1 Indica rice AF193803 OsERF63 Japonica rice Os09g11480 3319665033194455 9, 6404950- 6403747 Sub1b Indica rice DQ453964 OsERF73 Japonica rice Os09g11460 9, 6388653-6387955 Sub1c Indica rice DQ453965 Sub1A Indica rice DQ011598 AtERF74/ RAP2.12 Arabidopsis thaliana At1g53910 AtERF75/ RAP2.2 Arabidopsis thaliana At3g14230 9* 1, 2013878020140638 3, 4737153- 4739143 Supplemental Table II. Information on EIL genes from Arabidopsis and rice. Percentages of aminoacid identity and similarity with BEIL are reported. Chromosomal locations are indicated with reference to the TIGR japonica rice genome sequence and the TAIR Arabidopsis genome sequence. OsEIL1a and OsEIL1b exhibit 99% aminoacid sequence identity between them and are arranged in tandem on rice chromosome 3, suggesting a recent duplication event. TIGR ID/ gene species GenBank Protein Chromosome, coordinates Accession % identity % similarity BEIL1 BEIL1 619 63% 76% Mao et al. (2006) 565 55% 66% Mao et al. (2006) 641 36% 52% Mao et al. (2006) Length reference (aa) 8, OsEIL4 Japonica rice Os08g39830 AK072462 OsEIL3 Japonica rice Os09g31400 AK065473 OsEIL1a Japonica rice Os03g20790 AAZ78349 OsEIL1b Japonica rice Os03g20780 OsEIL2 Japonica rice Os07g48630 AB074972 2507929525081154 9, 1888484418883009 3, 1175491611756841 3, 1175009111752025 644 - 7, Arabidopsis 593 36% 49% Mao et al. (2006) 567 45% 57% Chao et al., (1997);Solano et al., (1998) 628 36% 54% Chao et al., (1997);Solano et al., (1998) 584 36% 53% Chao et al., (1997);Solano et al., (1998) 518 31% 45% Chao et al., (1997);Solano et al., (1998) 1, thaliana At1g73730 NP_177514 AtEIN3 Arabidopsis thaliana At3g20770 NP_188713 AtEIL1 Arabidopsis thaliana At2g27050 AF004213 AtEIL2 Arabidopsis thaliana At5g21120 AF004214 AtEIL3 2911632029114539 2773369227736175 3, 72604387263358 2, 1155283111555371 5, 71826247184345 Supplemental Table III. Primers used in SSCP analysis for mapping of KIBP genes. In the case of BGRF1 and BERF1 sequencing of the amplification products detected SNPs between the parents of the relevant mapping populations. Primer name Sequence BGRF1 lu6 TGATCTCTGCTGATTTGCCGTGGT BGRF1 lu7 TTTTGCGCGGGAAACAGTCAACGA BERF1 lu6 AACTCCAGCCTCCAACATGC BERF1 lu7 CCTTGCATGTGGGCAAGATGAAGA BEIL1 27 CTCTACTGTGGCCGAATTAG BEIL1 28 ACCTCATCGGTATTAATAGTCC Supplemental Table IV: Modified primers used in PCR-based cloning of KIBP genes Restriction enzyme recognition sites and attB sites are underlined Primer name Sequence NcoI BEIL1 forward GAGATCGAATCCATGGTGGATAACCTAGC NcoI BEIL1 reverse GGCCATGGGTTACGTTCCGAGATATTGCAT NcoI BERF1 forward TTGATCCACAGCTCGCCATGGGC NcoI BERF1 reverse ACAAGAACCCCATGGAACCACCAGC XhoI BERF1 reverse AACCTCGAGTAACCACCAGCTGCC NcoI BBR forward CGGCCGCCATGGACGACGACGGCAGCTTGAGCATTC XhoI BBR reverse CAACATAGCTCGAGTTTTACCTGATTGTTACAAAC EcoRI BGRF1 forward GGAATTCATGGCGATGCCCTTTG XhoI BGRF1 reverse CCCTCGAGCGGGAGTATATACCGTTG KpnI BGRF1 forward ATGGTACCAATGGCGATGCCCTTTG PstI BGRF1 reverse GACTGCAGTCACCGGGAGTATATA BglII BEIL1 forward GAAGATCTGATGATGGATAACCTAGCTA PstI BEIL1 reverse GACTGCAGTTACGTTCCGAGATATTGCAT attB1-BEIL1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGATGGATAACCTAGCTA attB2-BEIL1 GGGGACCACTTTGTACAAGAAGCTGGGTGTTACGTTCCGAGATATTGCAT attB1-BERF1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTGCGGCGGAGCCATC attB2-BERF1 GGGGACCACTTTGTACAAGAAGCTGGGTGTCAATAACCACCAGCTGCCA Supplemental Table V: Specific oligonucleotides used in EMSA to assess interaction between KIBP and 34 bp double strand fragments (overlapping regions are underlined). 1 forward from 56 to 85 1 reverse 2 forward AAAAAGCACTTGACTGTTTCTATGGTTCTCGAGG from 77 to 107 2 reverse 3 forward from 100 to 129 from 122 to 151 from 146 to 175 from 168 to 197 from 190 to 220 from 212 to 241 from 236 to 265 11 reverse AAAAGCCTTATCTCTGGTCTCTCTCTCTCTCTCA AAAATGAGAGAGAGAGAGAGACCAGAGATAAGGC from 257 to 286 10 reverse 11 forward AAAAACCATGTTGCTGTATTTTGCGACAGCCTTA AAAATAAGGCTGTCGCAAAATACAGCAACATGGT 9 reverse 10 forward AAAATAGGCATGTAGCTAGACTAGATACCATGTT AAAAAACATGGTATCTAGTCTAGCTACATGCCTA 8 reverse 9 forward AAAAATGCTAGCTCCATCTACTAGTGTAGGCATG AAAACATGCCTAGACTAGTAGATGGAGCTAGCAT 7 reverse 8 forward AAAACCTTGGCAGCAATATTATATGCATGCTAGC AAAAGCTAGCATGCATATAATATTGCTGCCAAGG 6 reverse 7 forward AAAATCTCCAGCAATTTATGCGTGATCTCCTTGG AAAACCAAGGAGATCACGCATAAATTGCTGGAGA 5 reverse 6 forward AAAAGCCACCATTATTTGATGTGAGATCTCCAGC AAAAGCTGGAGATCTCACATCAAATAATGGTGGC 4 reverse 5 forward AAAACAAGTGCTTGCCACAGCCTACAGCCACCAT AAAAATGGTGGCTGTAGGCTGTGGCAAGCACTTG 3 reverse 4 forward AAAACCTCGAGAACCATAGAAACAGTCAAGTGCT AAAATCTCTCTCATGAATAATGGCGGTCAAGAGA AAAATCTCTTGACCGCCATTATTCATGAGAGAGA from 279 to 305 AAAATCAAGAGACGTTGGATGCTTTCCAAGG AAAACCTTGGAAAGCATCCAACGTCTCTTGA Supplemental Table VI: Specific oligonucleotides used in EMSA to map KIBP binding sites (overlapping regions are underlined). BEIL1 40 forward from 122 to 141 40 reverse 41 forward AAAACACGCATAAATTGCTGGAGA from 139 to 158 41 reverse 42 forward 43 forward from 156 to 175 from 257 to 274 from 272 to 290 49 forward from 288 to 305 from 200 to 222 51 reverse AAAGCTAGACTAGATACCATGTTGCT AAAAGCAACATGGTATCTAGTCTAGC from 220 to 242 50 reverse 51 forward AAAA GTT GGA TGC TTT CCA AGG AAAA CCT TGG AAA GCA TCC AAC 49 reverse 50 forward AAAA ATG GCG G TCA AGA GAC GTT AAAA AAC GTC TCT TGA C CGC CAT 45 reverse BERF1 AAAA TCT CTC TCA TGA ATA ATG AAAA CAT TAT TCA TGA GAG AGA 44 reverse 45 forward AAAAAATATTATATGCATGCTAGC AAAAGCTAGCATGCATATAATATT 43 reverse 44 forward AAAAGTGATCTCCTTGGCAGCAAT AAAAATTGCTGCCAAGGAGATCAC 42 reverse BGRF1 AAAATCTCCAGCAATTTATGCGTG AAAGCTGTATTTTGCGACAGCCTTAT AAAATAAGGCTGTCGCAAAATACAGC from 240 to 262 AAATATCTCTGGTCTCTCTCTCTCTC AAAGAGAGAGGAGGAGACCAGAGATA Supplemental Table VII: Specific primers used in standard RT-PCR experiments (barley development, transgenic rice T1 screening) BEIL1 1385 forward CAAATATTGCTCCTTCCAGCATCT BEIL1 1842 reverse TTACGTTCCGAGATATTGCAT BGRF1 222 forward GCAGGCGCTCATCTACAAGT BGRF1 703 reverse CATAGGCAGAATACCTGAAATCTTTG BBR 384 forward GGTCCTTAATGCTGTTCCTGTTG BBR 939 reverse TGCACCTTGGCTCATTTTCC BERF1 725 forward TGGATTCCCTTCTTCCAGTGA BERF1 1158 reverse AATAACCACCAGCTGCCA Bkn3 590 forward GAGGTCTGACCATGAATCCCTT Bkn3 3’UTR reverse CGCCGACCGAGGTCACCGGT UBI forward AGCAGAAGCACAAGCACAAG UBI reverse AAGCCTGCTGGTTGTAGACG Supplemental Table VIII: Specific primers used in quantitative RT-PCR experiments (ethephon treatment, transgenic rice T2 analysis) BEIL1 1385 forward CAAATATTGCTCCTTCCAGCATCT BEIL1 1463 reverse GGCCAGGAGTTTGCATAATCA BGRF1 448 forward TACTGCGAGCGCCACATG BGRF1 703 reverse CATAGGCAGAATACCTGAAATCTTTG BBR 384 forward GGTCCTTAATGCTGTTCCTGTTG BBR 463 reverse AACCTGTAGGGTGGTGATGCA BERF1 474 forward GGCAGCCAGGGCATATGAT BERF1 796 reverse TCTGGTCAGAGAGCATGTTCATTC Bkn3 900 forward GAAGGTGGCACTGGCCGA Bkn3 3’UTR reverse CGCCGACCGAGGTCACCGGT OsEIL1 1317 forward CACAATGTCCAGTGCCCGCATAG OsEIL1 1616 reverse CTCTCCATGATCGTGGCATTGTC OsEBP89 773 forward CTGAGCTCATGGAGGAGGAC OsEBP89 989 reverse CAAGATCGTCAGTCGAGCAG OsERF72 577 forward GATGAACCAGCTGTTGCTCA OsERF72 796 reverse CGAATGTCTCAGTGGAAGCA OsEREBP1 720 forward TCCTGCAATGAACTCTGCTG OsEREBP1 916 reverse GGACCATTGGGTTGGTACTG Note: OsACO1 specific primers were as in Iwai et al., 2006. Supplemental methods Cloning In order to produce N-terminal fusions with a modified Thioredoxin, KIBP coding sequences were subcloned in pENTR4 (Invitrogen) or pGEM-T easy (Promega) vectors, and then introduced in pThioHisB expression vector (Invitrogen). BBR and BERF1 coding sequences were amplified with specific primers NcoI-BBR f/XhoIBBR r and NcoI-BERF1 f/XhoI-BERF1 r, sub-cloned in pENTR4 vector (Invitrogen) and inframe cloned in pThioHisB as NcoI/XhoI fragments. BGRF1 coding sequence was amplified with specific primers EcoRI-BGRF1 f/XhoI-BGRF1 r and subcloned in pENTR4 vector as EcoRI-XhoI fragment; this plasmid was subsequently used as template together with primers KpnI-BGRF1 f/PstI-BGRF1 r: the PCR product was then subcloned in pGEM-T easy vector (Promega) in-frame cloned in pThioHisB as KpnI/PstI fragment. BEIL1 coding sequence was amplified from genomic DNA of the wild type cultivar Atlas and primers BglII-BEIL1 f/PstI-BEIL1 r: PCR product was subcloned in pGEM-T easy vector and in-frame cloned in pThioHisB as BglII/PstI fragments respectively. pCR-NOS terminator was obtained by TA cloning of the NOS terminator PCR product amplified with primers XhoI for-EcoRV rev and pC1300intB-35SnosBK (AY560326) as template. Supplemental bibliography Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-402. Iwai, T., Miyasaka, A., Seo, S., and Ohashi, Y. (2006). Contribution of ethylene biosynthesis for resistance to blast fungus infection in young rice plants. Plant Physiol. 142: 1202-15. Lander, E.S., Green, P., Abrahamson, J., Barlow, A., Daly, M.J., Lincoln, S.E., and Newburg, L. (1987). MAPMAKER: an interactive computer package fro constructing primary genetic linkage maps of experimental and natural populations. Genomics 1(2): 174-81. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Yamasaki, K., Kigawa, T., Inoue, M., Yamasaki, T., Yabuki, T., Aoki, M., Seki, E., Matsuda, T., Tomo, Y., Terada, T., Shirouzu, M., Tanaka, A., Seki, M., Shinozaki, K., and Yokoyama, S. (2005). Solution structure of the major DNA-binding domain of Arabidopsis thaliana ethylene-insensitive3-like3. J Mol Biol 348 (2): 253-264.
Related documents