Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Suppl. Figure S1 B A patients prospectively recruited patients selected for analyses patients analyzed H.pylori+ H.pylori+ anti-CagA-IgG- anti-CagA-IgG+ 69 413 30 13 6 exclusion criteria cagA DNAcagA DNA+ 400 63 23 31 missing blood/test vacA s2m2 vacA s1m1/2 377 32 9 H.pylori infected patients cagA RNA+ 117 23 18 11 failed H.pylori cultivation patients with H.pylori isolates 99 no/low cagA RNA (5 low quality) unexplained 11 Immunoblot potentially positive (1 missing) Suppl. Figure S2 A r P (two-tailed) 0.025 0.9167 <0.0001 IL-8 / -actin 0.020 0.015 0.010 0.005 0.000 0 500 1000 1500 2000 2500 IL-8 (pg/ml) C s1m1 s1m1 s1m2 s1m2 vacA vacA B s2m2 r P (two-tailed) control 0.000 0.005 0.010 0.015 IL-8 / -actin 0.7634 0.0007 0.020 0.025 s2m2 r P (two-tailed) control 0 500 1000 1500 IL-8 (pg/ml) 0.8148 0.0002 2000 2500 Suppl. Figure S3 B 600 400 200 0 C 800 ViraStripe CagA-IgG ViraStripe CagA-IgG 800 600 400 200 0 0 20 40 60 80 100 120 CagA-IgG Omega Genesis 400 ViraStripe CagA-IgG A 300 200 100 0 0 20 40 60 80 100 120 CagA-IgG Omega Genesis 0 2 4 6 8 CagA-IgG Omega Genesis Suppl. Figure S1. Study design. (A) Number of patients included in the study. (B) Schematic explanation of H.pylori+ anti-CagA-IgG negative samples. Suppl. Figure S2. Correlation between IL-8 mRNA and IL-8 protein expression and vacA polymorphisms in AGS co-culturing model. (A) IL-8 mRNA expression of AGS cells was measured using qPCR and normalized to β-actin expression. IL-8 protein was measured in supernatant of AGS cell co-cultivated with H.pylori strains. IL-8 mRNA (B) and IL-8 protein expression (C) were correlated with vacA polymorphisms. Spearman’s test was used for correlation analyses. AGS cells co-cultivated in similar conditions but without H.pylori were considered as control. Suppl. Figure S3. Validation of anti-CagA-IgG ELISA using Immunoblot. To confirm the anti-CagA-IgG titer we performed independent measurement of anti-CagA-IgG using ViraStripe® CagA IgG immunoblot-based method. (A) Correlation between the tests. (B) All samples positive in ELISA showed strong signal with values above 200% of IU, while only few samples with negative results in ELISA showed varying intensities on immunoblot (C). Box highlights the cut offs according to each test (≥6.25 U/ml for ELISA and 80% of IU in Immunoblot). Suppl. Table S1. Primer used for qualitative PCR and quantitative real-time PCR. Primer Sequence (5’3’) Genes cagA*1 EPIYA Motifs*2 F GATAACAGGCAAGCTTTTGAGG R CTGCAAAAGATTGTTTGGCAGA F ACCCTAGTCGGTAATGGGTTA R GTAATTGTCTAGTTTCGC Annealing temperatur e Product 56°C 349 50°C AB 500, (bp) ABC 600, ABCC 700, ABCCC 800 More than one fragment = mixed infection vacA s*3 vacA m*4 glmM5 cagE*6 virB11*7 β-actin8 F ATGGAAATACAACAAACACAC R CTGCTTGAATGCGCCAAAC F CAATCTGTCCAATCAAGCGAG R GCGTCTAAATAATTCCAAGG F AGGCTTTTAGGGGTGTTAGGGGTTT R AAGCTTACTTTCTAACACTAACGC F TTGAAAACTTCAAGGATAGGATAGAGC R GCCTAGCGTAATATCACCATTACCC F TTAAATCCTCTAAGGCATGCTAC R GATATAAGTCGTTTTACCGCTTC F 56°C s1: 259 s2: 286 56°C m1: 570 m2: 645 56°C 293 53°C 508 49°C 491 CATGCCATCCTGCGTCTGGACC ACATGGTGGTGCCGCCAGACA 60°C 400 F CTTCCTGATTTCTGCAGCTCTG 57°C 193 R GAGCTCTCTTCCATCAGAAAGC R IL-89 F = forward, R = reverse; *-qualitative PCR. References: 1 Peak et al. 1995, 2 Yamaoka et al. 1998, 3,4 Ryberg et al. 2008, 5 Shahamat et al. 2004, 6,7 Tomasini et al. 2003, 8 Wex et al. 2004, 9 Al-Sammak et al.2013