Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supplemental Information Figure S1. MDA separation from coculture with hMSCs using MACS. Flow cytometry analysis on (a) coculture of hMSC and MDA cells and on (b) MDA cells after negative sorting of CD90 positive hMSCs using MACS (Magnetic activated cell sorting). a. after coculture 63% 99.5% 0.5% SS Lin 37% b. MDA after MACS sorting CD90PE 1 Figure S2. Expression of IFN-β in hMSCs after stimulation of poly (dA:dT) and TNF-α. Quantitative RT-PCR for IFN-β from MSCs treated with or without TNF-α (10 ng/ml) or poly (dA:dT) for 24 hrs. MSCs increase IFN-β1 mRNA expression upon poly (dA:dT) stimulation in dose dependent manner. 400 RQ for IFN-beta 350 300 250 200 150 100 50 0 0 MSC 1 5 10 20 50 100 200 500 MSC + TNF-α + Poly (dA:dT) (ng/mL) 2 Figure S3. Assessment of the efficacy of AIM2 siRNA and IFIH1 siRNA in hMSCs. Quantitative RT-PCR assays for AIM2 (A) and IFIH1 (B) in the RQ for Aim2 A 600 B 250 500 RQ for IFIH1 hMSCs that were isolated from the experiment in Figure 4D. 200 400 300 200 100 150 100 50 0 0 control scr Aim2 hMSCs siRNA siRNA hMSCs hMSCs fr CCT fr CCT control scr IFIH1 hMSCs siRNA siRNA hMSCs hMSCs fr CCT fr CCT 3 Figure S4. IFN-β upregulates TRAIL expression in hMSCs during coculture with MDA cells. (A~D) Real-time RT-PCR assays for AIM2, IFIH1, IRF7 and TRAIL in hMSCs treated with different concentrations of rhIFN-β. Values are mean ± S.D. for triplicate of assay. (E~H) Real-time RT-PCR assays for AIM2, IFIH1, IRF7 and TRAIL in hMSCs treated with supernatant from act hMSC-MDA coculture (CCT sup) that was treated with different concentrations of IFN-β neutralizing antibody (α-IFN-β). Values are mean ± S.D. for triplicate of assay. 4 Figure S5. Kaplan-Meier survival analysis of the innate sensors and related genes in breast cancer. (A-C) Kaplan-Meier survival analysis of the all 0 20 40 60 80 100 RFS (%) A 0 20 40 60 80 100 AIM2 (A), IFIH1 (B), TLR3 (C) in all and ER-positive breast cancer. P=0.00088 ER+ P=0.9 AIM2 low AIM2 high 0 20 40 60 80 100 120 Time (months) AIM2 low AIM2 high 0 20 40 60 80 100 120 Time (months) IFIH1 low IFIH1 high 0 20 40 60 80 100 120 Time (months) RFS (%) C 0 20 40 60 80 100 Number at risk low 1782 1581 1362 1158 890 600 388 high 1772 1492 1182 930 722 470 296 0 20 40 60 80 100 P=0.002 P=0.22 IFIH1 low IFIH1 high 0 20 40 60 80 100 120 Time (months) Number at risk low 901 835 732 634 507 370 243 high 901 821 682 540 430 279 174 P=8.4e-13 TLR3 low TLR3 high 0 20 40 60 80 100 120 Time (months) 0 20 40 60 80 100 RFS (%) B 0 20 40 60 80 100 Number at risk Number at risk low 1779 1522 1218 959 747 477 311 low 903 824 674 535 421 257 172 high 1775 1551 1326 1119 865 593 373 high 899 832 740 639 516 382 245 P=0.0024 TLR3 low TLR3 high 0 20 40 60 80 100 120 Time (months) Number at risk Number at risk low 1781 1479 1202 989 761 506 313 low 906 821 694 589 471 313 187 high 1773 1594 1342 1099 851 564 371 high 896 835 720 585 466 336 230 5 List of primers Taqman Gene Expression Assay ID Name (Life Technologies) Human-specific GAPDH Hs00266705_g1 Human TRAIL (TNFSF10) Hs00921974_m1 Human TRAIL receptor 1 (DR4; TNFRSF10A) Human TRAIL receptor 2 (DR5; TNFRSF10B) Hs00269492_m1 Hs00366278_m1 Human AIM2 Hs00915710_m1 Human IFIH1 Hs01070332_m1 Human Fas Hs00236330_m1 Human Fas Ligand (FASLG) Hs00181225_m1 List of Antibodies Antigen Clone Company Dilution TRAIL Rabbit mAb (C92B9) Cell Signaling Technology 1:1000 PKC-α Rabbit mAb Cell Signaling Technology 1:1000 Cell Signaling Technology 1:1000 Sigma Aldrich 1:25000 Phospho- Rabbit mAb PKC-α (Thr638/641) β-actin Clone AC-15 For secondary antibodies, HRP-linked anti-rabbit IgG or anti-mouse IgG (Cell Signaling Technology; 1:2,000) were used. 6 Preparation of TRAIL reporter construct. Genomic DNA isolated from hMSCs (QIAamp Tissue Kit; QIAGEN) was used as the template with primers for the human TRAIL promoter (Figure 1 for sequences for primers), using the Expand High Fidelity PCR System (Roche Molecular Biochemicals) following the manufacturer’s instruction. The amplified DNA fragments (1183bp) were subcloned into the KpnI and NheI sites in the pGL4 plasmid containing the luciferase reporter gene (pGL4-17; Promega). The PCR construct was amplified between the highlighted area in TRAIL promoter sequence. 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261 1321 1381 1441 1501 1561 1621 aaaatttgaaaatattttcttaaatgtagactcatttacagatagaaggcaagggcagga agtgatggtgaccagcggtgcctgaatgaactcaggaatgtaactgtagatctagggtcc caaactttaggtttcaaaggatctcttggagtacttgctgaaaaatgtaggttcctaagt ccactgccagaaactctgactcagtgggtcaagaatggaataactaaacaatggccccat gcagtggttcatgcctgtaatcccagcacgttgggaggttgaagcaagaggatcacttga ggtcaggagttcgagaccagcctggcctacatgataaaaccccatctctactaaaaatac aaaaaaattagctgggcatggtggcatgcacctgtaatcccagctacttgggaggctgag gcaggagaattgcttgaatctgggaggtggaggttgtagtgggccgagattgtgccattg caccactgcactccagcctgggcgataaagtgagattctgtcaaaaaaataaataaatac atgaaagagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaga aagaaagaaagaaggaaagaaggaaagaatagaaaagaaaagaaagaaagggaggaagaa aaggaaagaaagaaatgctgaataagatatagagacacatacagctgggccagcttatga catctgatagtggggagatttggggctgggtcctgaatctgagggtaattaactccctgt aacttcttttcctaatctgtaaaaggatagtgacagcgagacattgtgatggggttaata ttttggaaaacatccacatgtttttttcctttgcctttctgagtgtgtcaactacttcct acctgtccagcctaacacacaggcatattgtcttggtagggatggagatctgagaaggag attagaatttgtgtctgaaggtttgcaaagaggaagaagtcgtcaatatttagattctga cattcaagatggaattatgtagcaagaccattgctatgagacagtatttctattttcctt tatccactcccaccctgccctcttcccaccctcacagtagcatgagaaaaaccacatatg gaagtttcaggtcataaaaattatcttataatttagaaaacaggccttgtgcctatgaca gccaggccatgaggcttagagctctgtggtagaatgaggatatgttagggaaaagcaaag aaaatccctcccctccttggctgaggacattatcaaaaggagagcaagaaagagaagaga gaaatgggcttgaggtgagtgcagataaggggtgcatggatcctgagggcaaggagagga gcttctttcagtttccctcctttccaacgactactttgagacaagagctgtccctgggca gtaggaagggggagggacagttgcaggttcaatagatgtgggtggggccaaggccacaga acccagaaaaacaactcattcgctttcatttcctcactgactataaaagaatagagaagg aagggcttcagtgaccggctgcctggctgacttacagcagtcagactctgacaggatcat ggctatgatggaggtccaggggggacccagcctgggacagacctgcgtgctga 7 Stable transfection MDA cells were transfected with TRAIL-pGL4 reporter using Lipofectamine 2000 (Life Technologies) as manufacturer’s instruction. After 72 hours of transfection, MDA cells were treated with 1000 μg/mL neomycin (Sigma) for the first week and 500 μg/mL neomycin in DMEM containing 10 % FBS for 2 more weeks. The media was changed every 3rd day and the cells were passaged in 1:4 upon 80 % confluency. The transfected cells were than plated <100 cells/cm2 and cultured until the cells start to form colonies. The colonies were then isolated and cultured until they reach sufficient number. Expanded clone of MDA cells were tested for luciferase activity and the clone with the strongest activity was selected for further experiments 8