Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Mutation pattern in BRCA1/2 genes in Indian hereditary breast/ovarian cancers Prof. Dr. Kannan Vaidyanathan, MBBS, MD Professor & Head, Dept of Biochemistry, Pushpagiri Institute of Medical Sciences & Research Center, Tiruvalla, Kerala, INDIA FAMILIAL BREAST CANCER Breast cancer is one of the most common malignancies affecting women all over the world About 5 - 10% of all breast cancers have a familial basis and are inherited in autosomal dominant manner. Familial breast cancer has an earlier onset of occurrence. It is frequently bilateral and associated with ovarian cancer. BRCA1 and 2 are the most important genes involved. Other genes are p53, CHK2, PTEN, ATM, etc. ROLE OF DIFFERENT GENES IN BREAST CANCER BRCA1 Inherited Unknown BRCA2 Sporadic CHEK2 TP53 BRCA1 gene structure BRCA2 gene structure CHK2 1 113 175 FHA 220 ATP 486 Protein kinase 543 BRCA1 & BRCA2 – MORE ASPECTS… Penetrance – Lifetime risk of developing cancer – 80% for BRCA1 and 2. Different factors including ethnic, OCP use affect penetrance values. Both important in DNA repair, different types and in other cellular functions broadly related to cell cycle. Other cancers related to BRCA1,2 include ovarian, pancreatic, male breast cancer, Wilm’s tumor, Fanconi’s anemia etc. Cellular signal mechanisms could be responsible for the development of one particular tissue cancer and the sparing of the others. IMPORTANCE Mutation carriers have greater chance of developing breast cancer compared to mutation negative individuals. Scope for genetic counseling in affected families; early detection and cure . Can opt for prophylactic therapy, prophylactic oophorectomy or mastectomy. Controversial. Awareness increased; more precaution and can opt for more strict screening measures, including mammography. Risk of Breast/Ovarian Cancer in Mutation Carriers Gene Breast cancer Inherited Risk to All cases cases age 70 NONE 85% BRCA1 5-10% BRCA2 Ovarian Cancer Inherited Risk to All cases cases age 70 9.50% 85% 1.2% 35% 50-80% 3-5% 75% 20-50% 5-10% 40% 50-80% 3-5% 10% 10-30% MMR: MLH1, MSH2, MSH6, PMS1, PMS2 <1% <5% 10% <2% <10% <10% TP53 <1% <1% 90% <1% <1% <1% PTEN <1% <1% 50% <1% <1% <5% *Breast cancer risk to age 50 years : 30% for BRCA carriers compared with 2% for general population!!!!!! Aims and objectives • To study 61 familial breast/ovarian cancer patients for mutations/polymorphisms in BRCA1/BRCA2/CHEK2 genes using conformation sensitive gel electrophoresis (CSGE) and DNA sequencing (sense and anti-sense directions). • To study 110 control subjects for deleterious mutations/polymorphisms using conformation sensitive gel electrophoresis (CSGE) and DNA sequencing (sense and anti-sense directions). Conformation sensitive gel electrophoresis (CSGE) Mutant BRCA2 gene Normal BRCA2 gene G C A T PCR G A C T G A C T CSGE Heteroduplexing G A T C Heteroduplexes Homoduplexes BRCA1 mutations identified Exon 18 2 2 2 2 2 2 2 2 5 11.1 11.9 11.13 9 9 Codon 1716 22/23 22/23 22/23 22/23 22/23 22/23 22/23 22/23 59/60 1111/1112 955 1365 ND ND Nucleotide 5271 185/187 185/187 185/187 185/187 185/187 185/187 185/187 185/187 295/297 3450 2883 4213 ND ND Type NS FS FS FS FS FS FS FS FS FS FS NS NS ND ND FS-frame shift mutation; NS-nonsense mutation Mutation Y1716X delAGter39 delAGter39 delAGter39 delAGter39 delAGter39 delAGter39 delAGter39 delAGter39 delCAter64 3450del4 S955X L1365X ND ND Medical History Breast/Ovarian Breast/Ovarian Ovarian Cancer Ovarian Cancer Breast/Ovarian Breast Cancer Breast Cancer Breast Cancer Breast Cancer Breast/Ovarian Ovarian Cancer Breast Cancer Breast Cancer Breast Cancer Germ Cell Tumor Remarks Novel Reported Reported Reported Reported Reported Reported Reported Reported Novel Reported Reported Novel Ovary BRCA2 MUTATIONS IDENTIFIED EXON CODON NUCLEOTIDE TYPE OF MUTATION MUTATION REMARKS 11J 1547 4866InsT FS Asp1547Stop Novel 11N 1951&195 2 6079delAGTT FS delAGTTter1961 Reported 4 NA IVS4+67A>C Polymorphism NA Novel 8 NA IVS8+56C>T Polymorphism NA Reported 11F 1132 3625A >G Neutral Change Lys1132Lys Reported 25 NA IVS25-16T>C Polymorphism NA Reported 10C NA 1593 Neutral (SNP) Ser 455 Ser Reported 11S NA IVS11+77delTTAA Polymorphism NA Reported 13 NA IVS13+136dup8nt Polymorphism NA Novel 11d 991 3199 A>G Polymorphism Asn3199Asp Reported Control KP12 KP13 KP14 KP6 KP7 KP8 KP9 KP10 KP11 Marker Control KP2 K33 KP4 KP5 Analysis of exon 2 of patient KP2,14 showing 185delAG mutation 500 400 300 258 KP 14 M WT 185delAG Codon Control BRCA1/EXON 2 20 21 22 23 24 25 26 AAA ATC TTA GAG TGT CCC ATC TG K I L E C P I Nucleotidede: 185delAG Codon:22 & 23 to ter 39 Patient AAA ATC TTA GTG TCC CAT CTG K I L V S H L DNA sequencing showing 4866insT pBR322/ HinfI KP7 185del AG Y1716X CSGE showing 4866insT(11J) in KP-7 T G A A A A A C C T T T T T G A T G A A A A A G A G C A A GG Control 517 506 4866insT 396 403 G A T G A A A A A G A GC A AGG T G A A A A A C C T T T T T T G A T G A A AA A G A G C AAG 344 KP 7 298 Codon Wild type 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 AAA AAC CTT TTT GAT GAA AAA GAG CAA GGT K N L F D E K E Q G Nucleotide: 4866insT Codon: 1547 (GAT) to ter1547 (TGA) Patient AAA AAC CTT TTT TGA TGA AAA AGA GCA AGG K N L F Stop CSGE showing heteroduplex in KP 8 – Exon 11N Sequencing (KP 8) showing 6079delAGTT KP1 KP2 KP3 KP4 KP5 KP6 KP7 KP8 KP9 KP10 KP11 KP12 KP13 Control Control Y1716X 185del Marker AG Control 6079delAGTT KP8 517 506 423 396 344 298 Codon Wild Type 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 T TGT GAT GTT AGT TTG GAA ACT TCA GAT ATA TGT AAA TGT AGT ATA GGG C D V S L E T S D I C K C S I G Nucleotide: 6079delAGTT Codon: 1951/1952 to ter1961 Patient T TGT GAT GTT TGG AAA CTT CAG ATA TAT GTA AAT GTA GTA TAG GG C D V S K L Q I Y V N V V STOP 429 bp 13 17 20 26 Sequencing showing IVS11+80delTTAA pBR322 /HinfI 9 185del AG 8 Y1716X Control CSGE in intron 11 showing IVS11+80delTTAA G G T A T G C T A A C A A T T A A G A G T G T T A T Control 517 506 Patient 396 G G T A T G C IVS 11+80delTTAA T A A C A A 344 298 Wild type: GGTATGCTAACAATTAAGAGTGTTATA IVS 11+80delTTAA Patient: GGTATGCTAACAAGAGTGTTATAAACT T T A A G A G T G T T A T G A G T G T T A T A A A C Sequencing showing 9 nt duplication CSGE in intron 13 showing 9 nt duplication in KP - 29 B 29 30 31 32 C 185delAG 22 23 24 25 26 27 28 Y1716X A pBR322/Hinf1 AA T T T T A T A A A A C G G G A A G TG T T A A C T T C Control 517 506 396 470 bp KP 29 T T T T A T A A A A C GG G A A G T AA T T T T A T A AA AC G G G A AG T G T T A A C T T C Duplication 9 nt 344 298 C Wild Type:- A A T T T T A T A A A A C G G G A A G T G T T A A C T T C Reverse complement INTRON 13 Duplication 9 nt Patient:- A A T T T T A T A A A A C G G G A A G T G T T A A C T T C T T T T A T AAAA C G G G AA G T Reverse complement Results (Contd.) • No mutations were identified in CHEK2 gene, including CHK2 1100delC mutation. • Haplotype analysis was carried out, and it was found to be different from Ashkenazi Jewish population. • Population screening was done on 110 control subjects. • Many of the polymorphisms found in BRCA2 were found in the control subjects in similar or higher frequencies. • This suggested normal population variants. Discussion • 185delAG mutation has been reported to occur at varying frequencies among families with breast/ovarian cancer in different populations. • Some Indian Studies (Kumar et al. 2002; Saxena et al. 2002; Rajkumar et al. 2003; Valarmathi et al. 2003, 2004; Hedau et al. 2004; Saxena et al. 2006, Juwle and Saranth. 2012) have identified BRCA1/2 mutations including 185 delAG mutation. • Chakraborty et al, 2015, Sharma et al. 2014 did not find 185delAG (and 6174delT) mutations from Eastern India and in a pilot study from New Delhi respectively. • Kim and Choi. 2013 report that BRCA2 mutations are more common from Asian population except India and Pakistan. • Not found among Chinese and Japanese families with breast cancer (Ikeda et al. 2001; Zhi et al. 2002). • A very high frequency of 31.6% has been reported among non-Jewish Americans of Spanish ancestry from the San Luis Valley, Colorado (Mullineaux et al. 2003). • However, this mutation has been found to occur at a varying low frequency (1.13–5.9%) among white Americans, the Spanish from Spain, Polish, Iranian, Pakistani and Turkish women (Grzybowska et al. 2002; Shih et al. 2002; Guran et al. 2005; Weitzel et al. 2005; Mehdipour et al. 2006; Rashid et al. 2006). Conclusions • In this study, 61 breast and/or ovarian cancer patients with a positive family history of breast and/or ovarian cancer were screened for BRCA1/2 mutations. • In the BRCA1 gene, 15 mutations were identified; (mutation frequency, 24.6%) and in the BRCA2 gene, two mutations were detected (mutation frequency, 3.28%). • Of the BRCA1 mutations identified, 3 were novel mutations and 3 more were previously reported mutations. • The mutation, 185delAG was found in 10 patients at a very high frequency of 16.4%. • This mutation is detected in high proportion in Ashkenazi Jewish population (18% in breast/ovarian cancers and 1% in general population). • A large number of polymorphisms were also detected in BRCA2 gene, which included normal population variants. • The mutation spectrum of BRCA1/2 in other Indian studies also indicate a higher incidence of 185delAG mutation. • The possibility of founder mutation status need to be considered for BRCA1 185delAG mutation. Sunset at Varkala Beach, Kerala, INDIA Welcome to God’s Own Country !!!