Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Satoh et al. Ramosa 3 trehalose. Supplementary Figures and Legends Supplementary Figure 1. Positional cloning of RA3. a, Markers for fine mapping of RA3 on BAC c0387K01 are shown as black dots, with number of recombinants marked. The adjacent gene, SRA, is a homolog of RA3. b, RA3 gene structure with predicted transcription start (arrow) and stop (vertical line), introns (horizontal lines) and exons (boxes) marked. Grey boxes = TPP domain, black boxes = phosphatase boxes. c, RT-PCR of mRNAs from 1cm long ears of wild-type (1), ra3-ref (2), ra3-fea1 (3), ra3-EV (4), ra3-NI (5), ra3-bre (6). The UBI control shows roughly equal amplification in all samples. 1 Satoh et al. Ramosa 3 trehalose. Supplementary Figure 2. Phylogenetic analysis of selected TPP genes. The best phylogenetic trees estimate that the duplication of RA3/SRA occurred near the base of the major diversification of the grasses. None of the topologies in the 95% credible set of trees satisfied the constraint of a RA3/SRA duplication at the base of the panicoid clade, or at the base of the centothecoid + panicoid clade, allowing us to reject these hypotheses. In contrast, 25 of the 554 topologies in the 95% credible set estimated the RA3/SRA duplication occurred prior to the chloridoid + centothecoid + panicoid clade, indicating that we are unable to reject the hypothesis that the RA3/SRA duplication 2 Satoh et al. Ramosa 3 trehalose. occurred near the base of the PACCAD clade29. Numbers above or below braches represent percent clade credibility. Species abbreviations are: Bacteria: Pca = Pelobacter cabinolicus, No = Nitrosococcus oceani, Rf = Rhodoferax ferrireducens. Insect: Dm = Drosophila melanogaster. Eudicots: At = Arabidopsis thaliana, Br = Brassica rapa, Nt = Nicotiana tabacum. Grasses: As = Avena strigosa, Cl = Chasmanthium latifoium, Et = Eragrostis tef, Hv = Hordeum vulgare, Os = Oryza sativa, Pc = Phalaris canariensis, Pg = Pennisetum glaucum, Sb = Sorghum bicolor, Sv = Setaria viridis, Zm = Zea mays. Because the maize genes are not yet annotated we named them “ZmRA3 Like” (“ZmRA3L”). These sequences correspond to Genbank numbers except for AZM from http://maize.tigr.org/ RfTPP: NZ_AAJK01000029, PcaTPP: NC_007498, NoTPP: NC_007484, DmTPS1: NM_134983, At1g22210: NM_102071, AtTPPB: NM_106458, OsRA3L1: AC103551, ZmRA3L1: AZM4_101301, AsSRA: DQ436922, HvSRA: DQ436929, OsSRA: AK109902, SbSRA: DQ436924, ZmSRA: DQ436921, ClSRA: DQ436926, EtSRA: DQ436927, ZmRA3: DQ436920, SbRA3: ASB1339, SvRA3: DQ436925, OsRA3L2: AP004727, OsRA3L3: XM_467838, PgRA3L3: DQ436923, OsRA3L4: XM_450681, EtRA3L4: DQ436928, PcRA3L4: DQ436930, OsRA3L5: XM_482349, At1g35910: NM_103289, At4g39770: BT005555, At2g22190: BT010648, At5g65200: BT015352, BrTPP1: AC146875, BrTPP2: AC155344, At5g10100: NM_121048, AtTPPA: BT008467, At4g22590: NM_118385, At4g12430: BT002566, NtTPP: AY570725, OsTPP1: NM_197683, XM_473444. 3 OsTPP2: XM_467162, OsTPP3: Satoh et al. Ramosa 3 trehalose. Supplementary Figure 3. Expression of the rice SRA gene measured by RT-PCR. RT-PCR of mRNAs from leaf blade (B), root (R), leaf sheath containing vegetative apex (V) and young inflorescence (I). The rice SRA gene is expressed strongly in root and young inflorescence and it is also detected in vegetative tissues (upper panel). The rice UBI positive control (lower panel) shows roughly equal amplification in all samples. 4 Satoh et al. Ramosa 3 trehalose. 4 3.5 3 2.5 2 1.5 1 0.5 0 T6P G6P S6P F6P Ser/Thr -0.5 Supplementary Figure 4a. RA3 has trehalose phosphate phosphatase activity. The chart shows phosphate release, following treatment of various phosphorylated substrates. RA3 full length protein or the TPP domain alone, and Mycobacterium TPP30, specifically catalyzed dephosphorylation of T6P (trehalose-6-phosphate), with no activity on G6P, S6P or F6P (glucose, sucrose or fructose-6-phosphates), nor on a Ser/Thr (serine/threonine phosphopeptide) as a reporter of protein phosphatase activity (Promega). The N-terminal region of RA3 had no enzyme activity and the positive control SAP (shrimp alkaline phosphatase) showed phosphatase activity against all substrates. 5 Satoh et al. Ramosa 3 trehalose. Supplementary Figure 4b. RA3 complements a yeast TPP mutant. RA3 full length protein or TPP domain of RA3 rescued the growth of a yeast TPP mutant at the non-permissive temperature in the presence of 1M NaCl. 6 Satoh et al. Ramosa 3 trehalose. Supplementary methods Phylogenetic analysis Total RNA was extracted from 1-10 mm long developing inflorescences of barley (Hordeum vulgare), green millet (Setaria viridis), inland sea oats (Chasmanthium latifolium), oats (Avena strigosa), tef (Eragrostis tef) and sorghum (Sorghum bicolor) using RNAwiz (Ambion, Austin, TX). RA3/SRA genes were amplified using one-step RT-PCR (Invitrogen, Carlsbad, CA) using either (ATGACGAASCACGCCGSCTWCKCC) and (STCWCKCAGMGWGTAGGATGC) or (AGCAGATCGTCATGTTCCTGGACTA) and the primers RA3-1F RA3-1015R SRA-293F SRA-1042R (CCAACTTGCGCAGGAACT) designed using Primaclade31. Amplified fragments were cleaned, sub-cloned and sequenced as described32. 43 TPP gene nucleotide sequences were aligned using MacClade 4.033 and ClustalX34 using the amino acid translation as a guide. Bayesian phylogenetic estimates were produced using the General Time Reversal model with some invariant sites and gamma distributed rates (GTR + I + G) based on two separate runs of 10 million Markov Chain Monte Carlo (MCMC) generations using MrBayes 3.121. Trees were sampled every 500 generations and burn-in was determined empirically by plotting likelihood score against generation number. After burn-in trees had been removed, clade credibility values (CC) and the 95% credible set of trees were estimated using MrBayes 3.121. The 95% set of credible trees contained 554 different topologies. Constraint trees reflecting different SRA/RA3 duplication scenarios were generated in MacClade34. The set of 95% credible trees were then filtered using these constraint trees within PAUP*4.035. 7 Satoh et al. Ramosa 3 trehalose. Molecular biology For RT-PCR in Supplementary figure 3, the primers NS466 (GGTTGATTTTGGGGGATGAC) and NS469 (TACTTGCCAATCAGCCCTTTG), UBI RTF1 (CTGATCTTCGCTGGCAAGCAG) and UBI RTR1 (CATATCATACGGACTCGATGGTCCA) were used to amplify the rice SRA and UBI genes respectively. Protein expression and phosphatase asssay RA3 full length cDNA or a cDNA of the TPP domain were ampified using primers NS487 (CGAGCCATGACGAAGCAC) and NS429 (ATAAGCGCCTCTTTGCTGTTG or NS483 (GGCGACTGGATGGAGAAGCA) and NS429, and cloned into the vector pCR T7/NT-TOPO containing an N-terminal histidine tag (Invitrogen). Recombinant proteins were expressed in E. coli and purified by a batch purification method (Qiagen). The proteins were used at a concentration of 70ng/ phosphopeptide as described23. Phosphate release was measured as OD600 (serine/threonine phosphatase assay system, Promega). Yeast complementation test RA3 full length cDNA or a cDNA of the TPP domain were amplified using primers NS489 (AAGGAAAAAAGCGGCCGCGCCATGACGAAGCACGCCGCCTACTC) and NS490 NS490 (ACGAGGTCGTGCCTGCCGCTCATGGTTGGCGCGCCCCCTTCT) and (CGCGCCGCCGGCGGCCGCGACATGGACTGGATGGAGAAGCACCCGTC) or NS500 and cloned into a yeast shuttle vector, pFL61, which drives strong expression from the 8 Satoh et al. Ramosa 3 trehalose. phosphoglycerate kinase promoter36. The Arabidopsis TPPB gene was used as a positive control. The constructs were transformed into the yeast strain YSH6.106.-8C, which has a deletion of the TPS2 gene and hence lacks TPP activity. This mutant strain is sensitive to high temperature and salt concentrations24, so we assayed for growth on selective media at 40.5oC, the non-permissive temperature, in the presence of 1M NaCl. 9 Satoh et al. Ramosa 3 trehalose. Supplementary Tables Supplementary Table1. Molecular markers used for RA3 mapping (Fig. 2). Marker name og.1 Nature of marker Sequence indel marker cb. g1E CAPS marker with Mse1 NS362 indel marker NS364 indel marker NS346 indel marker cb. e RFLP marker with BamH1 GAGCGGGAGGTGTAGAGACAAG and CCAGCTTCACGAAGTTGAACAC GTGCTGTGGTCCTTCAATTCTG and GCGCAGATCACGGCTCCCAT ACGTGTAGCCACACACAGTCG and GCAACGACATACACCACGAGA ATGCACGAGGTCGTCTTCATT and GAGATTCGTCCGTCCATCAAG AAGCAGCCCAAAGAACAACAA and CTTTTGCATCGGGAAGAAGTG Probe was made with primers CCCAGAGCATCCATAACTCTGAT and AGTCTCCTTTTTCGACGATGTTG 10 Satoh et al. Ramosa 3 trehalose. Supplementary Table2. Molecular lesions in ra3 alleles. Allele Source ra3-ref Maize Genetics Stock Center ra3-fea1 Mu transposon stock (D. Jackson) ra3-EV Ac-Ds stock (E. Vollbrecht) ra3-NI ra3-bre EMS screen (N. Inada) Unknown (E. Irish) ra3-JL Mu transposon screen ra3-NS Spm transposon screen Lesion 4bp insertion (AGCT) in exon 7 after nt 743 ~2kb ILS-like transposon37 between TATA box and exon1 and 4bp insertion (CCGG) into exon 7 after nt 769 4bp insertion (GCGC) into exon 6 after nt 663 ~150bp insertion* into exon 10 after nt 995 10bp (ATATATATAT) insertion into exon 6 after nt 617 42bp deletion and 15bp insertion (GCCATCGCCTGCGTCCACTTCCGCT) in exon 6 after nt 649 2bp insertion (CA) into exon 6 after nt 662 Nucleotide (nt) numbers are counted from the predicted ATG. *GTTTGTTTGGATAATCTCGGATTGAAATGGATTGAGGTGGTATGTGGTGT ATTGAAGTGTAATATGAACTAATTTTTTTTCAATCCCCTTCAATACACCTTA ATACACTTCAATCCCTCTGTACCCAAACAAAG; similar to repetitive sequence associated with the B transcriptional activator b1-B' allele, (genbank # AY078063) and the sucrose synthase (shrunken1) gene (genbank # AF544125). 11 Satoh et al. Ramosa 3 trehalose. Supplementary notes 29. Grass Phylogeny Working Group. Phylogeny and subfamilial classification of the grasses (Poaceae). Ann. Mo. Bot. Gard. 88, 373-457 (2001). 30. Edavana, V. K. et al. Cloning and expression of the trehalose-phosphate phosphatase of Mycobacterium tuberculosis: comparison to the enzyme from Mycobacterium smegmatis. Arch Biochem Biophys 426, 250-257 (2004). 31. Gadberry, M. D., Malcomber, S. T., Doust, A. N. & Kellogg, E. A. Primaclade - a flexible tool to find conserved PCR primers across multiple species. Bioinformatics 21, 1263-1264 (2005). 32. Malcomber, S. T. & Kellogg, E. A. Heterogeneous expression patterns and separate roles of the SEPALLATA gene LEAFY HULL STERILE1 in grasses. Plant Cell 16, 1692-706 (2004). 33. Maddison, W. P. & Maddison, D. R. MacClade: Analysis of Phylogeny and Character Evolution. (Sinauer Associates, Sunderland, 2003). 34. Jeanmougin, F. J., Thompson, D., Gouy, M., Higgins, D. G. & Gibson, T. J. Multiple sequence alignment with Clustal X. Trends in Biochem. Sciences 23, 403-405 (1998). 35. Swofford, D. L. PAUP*: Phylogenetic Analysis Using Parsimony. (Sinauer Associates, Sunderland, 2000). 36. Minet, M., Dufour, M. E. & Lacroute, F. Complementation of Saccharomyces cerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs. Plant J 2, 417-422 (1992). 37. Alrefai,R., Orozco,B. and Rocheford,T. Detection and sequencing of the 12 Satoh et al. Ramosa 3 trehalose. transposable element ILS-1 in the Illinois long-term selection maize strains. Plant Physiol. 106, 803-804 (1994). 13