Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein Synthesis Worksheet
Document related concepts
no text concepts found
Transcript
Protein Synthesis Worksheet 1. In DNA, adenine binds with ____________ and guanine binds with _____________. 2. In RNA, adenine binds with ____________ and guanine binds with _____________. 3. Transcription takes place in the ________________; translation takes place in the _______________. 4. The monomers (building blocks) of nucleic acids are _____________. 5. The enzyme responsible for “unzipping” the DNA molecule in preparation for copying is called ____________________________. 6. ____________-RNA is formed from one side of the DNA in a process called ______________. 7. When this “string” of RNA leaves the nucleus through a nuclear pore, it goes into the cytoplasm and binds to another player, ____-RNA (the“site of protein synthesis”). 8. The ___-RNA code is “read” and a protein is assembled in a process called ___________________. 9. The monomers (building blocks) of proteins are _________________________, so another form of RNA is necessary to deliver those building blocks to the site of protein synthesis. This is ___________RNA. 10. The 3 nitrogen bases of DNA are called ________________; the 3 nitrogen bases of ____________are called anticodons; the 3 nitrogen bases of ____________are called codons. 11. All of the above steps take place during what PHASE of the cell cycle? ____________________ 12. Know these steps in order, and be sure to learn the associated vocabulary. 13. Chromatin is __________________________________________________________________. 14. A chromosome is ______________________________________________________________. 15. A gene is _____________________________________________________________________. 16. The genome is _________________________________________________________________. The following is the base sequence on one strand of a DNA molecule: TAGACTTGCCAAAACGTAATTGACTATTCCTTATCCGCAATG 17. What is the base sequence of the complementary DNA strand? 18. What is the base sequence of the mRNA read from the original DNA strand? 19. Using the mRNA codon chart on the back, determine the order of the amino acids in the protein fragment that would be made? Note: usually only the first 3 letters are used as an abbreviation. mRNA codon CUU CUC CUA CUG CCU CCC CCA CCG CAU CAC CAA CAG CGU CGC CGA CGG Amino Symbol Acid A leucine A leucine A leucine B leucine C proline C proline D proline D proline E histidine E histidine F glutamine F glutamine G arginine G arginine G arginine H arginine mRNA codon AUU AUC AUA AUG ACU ACC ACA ACG AAU AAC AAA AAG AGU AGC AGA AGG Amino mRNA Symbol Acid codon H isoleucine GUU I isoleucine GUC I isoleucine GUA I methionineGUG J threonine GCU K threonine GCC K threonine GCA L threonine GCG L asparagine GAU L asparagine GAC L lysine GAA M lysine GAG M serine GGU N serine GGC N arginine GGA O arginine GGG Symbol O P P Q R R R R S S S S T T T T Amino Acid valine valine valine valine alanine alanine alanine alanine aspartic acid aspartic acid glutamic acid glutamic acid glycine glycine glycine glycine mRNA codon UUU UUC UUA UUG UCU UCC UCA UCG UAU UAC UAA UAG UGU UGC UGA UGG Symbol U U V V W W X X Y Y space space Z z space space Amino Acid phenylalanine phenylalanine leucine leucine serine serine serine serine tyrosine tyrosine stop stop cyteine cyteine stop tryptophan 20. Let’s translate that mRNA code into English alphabet symbols. What is the protein sentence? Let’s try one more. Here’s the DNA sequence: AGGGAGCCTCTCCAATCTACTGATTCGGGCATTGGACGGTACGGGTGG 21. What is the mRNA sequence read from that DNA strand? 22. What is the order of amino acids in the resulting protein? 24. What is the “DNA message” as read with the English alphabet symbols?
Related documents