Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supplemental Figure Legends Fig. S1. Gene synteny between IFNd and CD79b in zebrafish and Atlantic salmon. The salmon IFNd gene was identified by TBLASTN in the genomic sequence with GenBank Accession no. AGKD01088706, which was annotated (GenBank accession no. BK008598) using the Fgenesh program (http://softberry.com). CD79b was found in the same sequence. Zebrafish IFNd/ φͶ (GenBank GeneID:100302089) was found linked to a gene (GenBank accession no. LOC100329481), which was identified as CD79b antigen (immunoglobulin-associated beta) by BLAST search. Other genes in the same cluster are scn4αα (sodium channel, voltage-gated, type IV, alpha, a) and ghrhr2 (growth hormone-releasing hormone receptor second type). Fig. S2. Comparison of amino acid sequences of full length IFNa, IFNb, IFNc and IFNd translated from cDNA. A. Multiple alignment of IFNa1 (AY216594), IFNb (JX524152), IFNc (JX524153) and IFNd (JX524151) by the Clustal W program. Shaded amino acids show identity to the consensus sequence. Positions of cysteines, which are putatively involved in disulphide bridges are marked with stars. Exon boundaries are indicated with arrows. B. Percentage amino acid identity between the sequences. The IFNb cloned in the present work is most similar to the sequence encoded by the IFNb2 gene (99.5%) and the cloned IFNc is most similar to the sequence encoded by the IFNc1 gene (99.5%) where the genomic sequences are described by Sun et al. (8). Fig. S3. Atlantic salmon type I IFN promoter regions. A. Putative IRF binding elements in the Atlantic salmon IFNd promoter region. Potential transcription factor binding sites in the 1000 nucleotide sequence upstream of the open reading frame of the IFNd gene (GenBank accession no. BK008598) was identified by the MatInspector program (www.genomatix.de). Two IRF-binding motifs and two TATA-boxes were identified as indicated by grey shading, but no Ǧ κǤ Ǧ ȋͳͲȌǤ B. Overview of putative IRF and NF-B binding elements in the proximal promoter regions of IFNa1, IFNb2, IFNc1 and IFNd. Potential transcription factor binding sites in the 500 nucleotide sequence upstream of the open reading frame of the genes were identified by the MatInspector program as described by Sun et al. (8). The specific IRF binding sites detected by the MatInspector program is based on sequence preferences of mammalian IRFs and are merely shown to illustrate differences in IRF binding sites. (+) and (-) indicate the DNA-strand for the binding sites. Supplemental figure 1 IFN 4 CD79b IFNd CD79b ghrhr2 scn4 zebrafish Chr. 12 Atl. salmon AGKD01088706 Supplemental figure 2 A * * * * B IFNd IFNc IFNb 37.4% 25.3% 30.4% IFNb 30.2% 30.7% - IFNc 25.6% - - IFNa1 Supplemental figure 3 A TTTTCGATCTGCTTCAGATGATATTCATGATGCCACACAGCCTGAGGCTCAAATCAAAGT GTATTTGTCATGTGCGCCGAATTCAACAACCTTACAGTGAAATGCTTACTTACAGGCAAT AACCAATAGTGCAAAAAAAGGTATTAGGTGAACAATAGGTAAGTAAAGAAATAAAAAGAA IRF-E AGTGAAAAATAACACACAATGCAAATAGTCCGGGTAGCCATTTGATTACCTGTTCAGGAG TCTTGCTTGGGGGTAAAAACTGTTGAGAAGCCTTTTTGTCCTAGACCTGGCACTCCGGTA CCGCTTGTCATGCGATAGTAGATAAGAACATTCTATGACTGGGGTGGTTGGTTCTATTAA GTAAAAAAAAAAATAAAATAGGCCTACGTTTTTTAAAATTAATAACATTATGGGCTTAAT ATAAATAATATATTTTTGTTCAGTGGTTAAAGTAGCCCAATTTCAATGGCTACTAAATGA AATAAAACAAATAGGCTAGTTAAAATCATATTGAATAGCCTACATTAATATTTACAGAAA ATGACTCGGAAAAAATACATGTAAACGAAGCCTACAGAAAATTGCAAACAATTGCAATTT ATAGCCTCAGCTCAGGCCATGCAAATCGGAAAAAGTGTCTCAAACATGTTTAGATGCGTT CTAGCGTCCTATTCAGCTGGCTTGGTATGACATTTACAGTAGCCTATTCGATGTGTGTGA ATATTTCTAAAAATAATACATTGACTTTCCAAACACTGTAAAACATAAACGAATATAAAT IRF-E GTCGTGGTAAATATGTGCTCTTAATTGTTTTCCAACCGTCGCAGGTACGGAAAGTGAAAC AGGTATTGGCTTCACCCTATTCGTTTTGAGAAACTATAAAGGTCGCATTCCTACAGGTAA TATGGTATACCTAAACATTAGTAACAAGACAGTTACAATTGCCTATTTTGTATTACAAAG ATATACTTTTTTTGCTCCACGTCTTGTTTTCATTACCAACATG -941 -881 -821 -761 -701 -641 -581 -521 -461 -401 -341 -281 -221 -161 -101 -41 B IRF7(+) NF-kB IRF3(-) TATA IRF7(-) IFNa1 IRF2(+) IRF7(+) TATA IFNb IRF3(-) IRF1(+) IRF2(-) IFNc TATA IRF2(+) TATA IFNd - 500 - 400 - 300 - 200 nucleotides upstream of ATG -100 -1