Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
1 Catalases and PhoB/PhoR system independently contribute to oxidative stress resistance in 2 Vibrio cholerae O1 3 4 Carolina L. Goulart§*, Livia C. Barbosa§, Paulo M. Bisch and Wanda M.A. von Krüger 5 6 Laboratório de Física Biológica, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal 7 do Rio de Janeiro, Rio de Janeiro, Brazil 8 9 § Both authors contributed equally to this work. 10 *Corresponding author. Mailing address: Laboratório de Física Biológica, Universidade Federal do 11 Rio de Janeiro, Av. Carlos Chagas Filho, 373, CCS, G1-043, Rio de Janeiro – RJ, CEP 21941-902, 12 Brazil; E-mail: [email protected]; Tel.: +55 21 3938-6531; fax: +55 21 2280-8193 13 14 Keywords: KatB, KatG, phosphate 15 16 Running title: Oxidative stress resistance in Vibrio cholerae 17 18 Subject category: Physiology and metabolism 19 20 21 Word count: Abstract – 245 words Main text – 3919 words 22 Abstract 23 24 All cells are subjected to oxidative stress, a condition in which reactive oxygen species (ROS) 25 production exceeds elimination. Bacterial defenses against ROS include synthesis of antioxidant 26 enzymes like peroxidases and catalases. Vibrio cholerae can produce two distinct catalases, KatB 27 and KatG, which contribute to ROS homeostasis. In this study, we analyzed the mechanism behind 28 katG and katB expression in two V. cholerae O1 pandemic strains, O395 and N16961, respectively 29 of Classical and El Tor biotypes. Both strains express these genes, especially at stationary phase. 30 However, El Tor N16961 produces higher KatB and KatG levels and is much more resistant to 31 peroxide challenge than the Classical strain, confirming a direct relationship between catalase 32 activity and oxidative stress resistance. Moreover, we showed that katG and katB expression levels 33 depend on inorganic phosphate (Pi) availability, in contrast to other bacterial species. In N16961, 34 katB and katG expression is reduced under Pi limitation relative to Pi abundance. Total catalase 35 activity in N16961 and its phoB mutant cells was similar, independently of growth conditions, 36 indicating that PhoB/PhoR system is not required for katB and katG expression. However, N16961 37 cells from Pi-limited cultures were 50-100 fold more resistant to H2O2 challenge and accumulated 38 less ROS than phoB mutant ones. Together, these findings suggest that besides KatB and KatG, 39 PhoB/PhoR system is an important protective factor against ROS in V. cholerae N16961. They also 40 corroborate previous results from our and other groups, suggesting that PhoB/PhoR system is 41 fundamental for V. cholerae biology. 42 Introduction 43 Under aerobic conditions, all cells produce reactive oxygen species (ROS) as aerobic metabolism 44 by-products. Bacteria can also be exposed to high levels of ROS generated by the host defense 45 system (Vallet-Gely et al., 2008) or in response to unfavorable environmental conditions (Shimizu, 46 2013). ROS accumulation can lead to oxidative stress, which can damage macromolecules such as 47 nucleic acids, proteins and lipids, and to avoid such harmful effects bacteria have evolved 48 mechanisms to sense ROS levels and to counteract their effects (Lushchak, 2011a). 49 Bacterial ROS-sensing mechanisms involve a number of transcription factors that regulate 50 antioxidant enzyme expression (Dubbs & Mongkolsuk, 2012). These enzymes include superoxide 51 dismutases (SOD), which catalyzes superoxide anion (O2-˙) dismutation to H2O2, and 52 hydroperoxidases (catalases and peroxidases) that cleave peroxidic bond in H2O2 and also in 53 organic peroxides (Lushchak, 2011b). Hydroperoxidase gene expression regulation is well studied 54 in Escherichia coli, a Gram-negative bacterium that produces two catalases. HPI, also known as 55 KatG, is a bifunctional catalase-peroxidase whose expression is H2O2-induced in an OxyR- 56 dependent manner (Storz et al., 1990). E. coli OxyR is a well-characterized bacterial redox-sensing 57 transcription factor that activates a regulon of more than 20 antioxidant genes. HPII, also known as 58 KatE, is a typical catalase whose gene is controlled by RpoS, the primary regulator of stationary 59 phase genes, and is not induced by H2O2 (reviewed in (Schellhorn, 1995). Both KatG and KatE are 60 involved in oxidative stress response in E. coli (Jung & Kim, 2003). 61 Vibrio cholerae is a Gram-negative bacterium that can be found in aquatic environments, especially 62 in brackish water, either free-living or associated with biotic or abiotic surfaces (Colwell, 1996). 63 Several strains are facultative pathogens that can colonize human small intestine and cause watery 64 diarrheic disease known as cholera (Finkelstein, 1996). Seven cholera pandemics have been 65 reported, all caused by V. cholerae O1 serogroup strains (Salim et al., 2005). Some V. cholerae 66 strains can produce two different catalases, KatG (VC1560) and KatB (VC1585), both of which 67 contribute to their oxidative stress resistance (Wang et al., 2012). However, little is known about 68 katG and katB expression regulation in this species. It has been shown that in V. cholerae El Tor 69 biotype strain C7258 katB is repressed by the histone-like nucleoid structuring protein (H-NS) by 70 transcriptional silencing (Silva et al., 2008). Differently from E. coli, in V. cholerae El Tor strain 71 C6706, KatB and KatG production is independent of OxyR (Wang et al., 2012). 72 Under natural conditions, aquatic environments are usually poor in nutrients such as phosphorus, an 73 element essential for all forms of life. V. cholerae survival in such habitat depends on its ability to 74 cope with phosphorous deficiency. Inorganic phosphate (Pi) is the main source of P for bacteria and 75 the maintenance of bacterial Pi homeostasis is controlled by the two-component system PhoB/PhoR 76 (Wanner, 1993). This system regulates expression of genes involved in Pi uptake and metabolism 77 and in many other processes, including pathogenesis (Goulart et al., 2010; Osorio et al., 2004; von 78 Kruger et al., 1999; von Kruger et al., 2006). More recently, we demonstrated for the first time that 79 V. cholerae O1 PhoB/PhoR system is also required for full growth and RpoS accumulation at 80 stationary phase culture under high Pi level, indicating that it is a fundamental system for bacterium 81 biology (Lery et al., 2013). In some bacterial species, Pi limitation induces catalase expression in a 82 PhoB-dependent manner, increasing their ability to cope with oxidative stress in such environments 83 (Yuan et al., 2005). In previous work, we identified many V. cholerae stress-response related gene 84 products whose expression is dependent on PhoB/PhoR and/or Pi levels (von Kruger et al., 2006). 85 Although catalases were not among the proteins identified in the mentioned study, we cannot 86 discard a relationship between kat genes expression and PhoB/PhoR or Pi availability in V. 87 cholerae. This was investigated in the present study using two V. cholerae O1 isolates, the 6th 88 pandemic classical biotype O395 and the 7th pandemic El Tor biotype N16961 (Salim et al., 2005). 89 Our results led us to conclude that KatG and KatB seem to be involved in oxidative stress response 90 in both strains, confirming previous results (Wang et al., 2012). However, differences were found 91 between strains O395 and N16961 with respect to catalase genes expression profile and total 92 catalase activity. Moreover, in contrast to the observed in other bacterial species (Yuan et al., 93 2005), katB and katG expression in V. cholerae N16961 is repressed under Pi limitation in a PhoB- 94 independent manner. However, in this condition, an active PhoB/PhoR system is required for wild- 95 type resistance to ROS. 96 97 Material and Methods 98 99 Strains and growth conditions: Vibrio cholerae spontaneous streptomycin-resistant O1 strains El 100 Tor N16961, classical O395 and WK10, an N16961 isogenic phoB/phoR mutant strain (von Kruger 101 et al., 1999; von Kruger et al., 2006), were routinely grown at 37°C in Luria-Bertani broth (LB) 102 under aeration or on solid medium (1.5% agar in LB). For growth under defined Pi concentrations, 103 MG (165 mM MOPS pH7.4; 80 mM NaCl; 20 mM KCl; 20 mM NH4Cl; 3 mM Na2SO4; 1 mM 104 MgCl2; 200 M CaCl2; 3 M FeCl3; 0.4% glucose; 10 M thiamine) was used with KH2PO4 at 65 105 mM (high phosphate medium MGHP) or 65 M (low phosphate medium MGLP) (von Kruger et 106 al., 1999). For genetic manipulations, E. coli Top10 (Invitrogen) was used. Antibiotics were added 107 to media when required at following concentrations: streptomycin 100 g ml-1, ampicillin 100 g 108 ml-1 and kanamycin 50 g ml-1. Bacterial growth was spectrophotometrically determined by 109 following OD600nm for 8 hours. 110 111 Genetic procedures: Fragments of 1.7 kb and 2.1 kb containing, respectively, V. cholerae N16961 112 katB (vc1585) and katG (vc1560) genes were PCR amplified using N16961 strain chromosomal 113 DNA as template and primers KatBADFw-KatBADRv and KatGBADFw-KatGBADRv listed in 114 Table 1. Fragments were inserted into pBAD TOPO® (Invitrogen), downstream araBAD promoter, 115 according to supplier’s recommendations, to generate arabinose-inducible overexpression systems, 116 pAB-katB and pBAD-katG. katB and perA genes from V. cholerae N16961 are 99% identical to the 117 same genes in O395 strain. 118 Fragments 300bp long of katB regulatory region in N16961 and O395 were PCR-amplified from 119 the chromosomal DNA from each strain using primers KatBpro1 and KatBpro2 (Table 1). The 120 fragments were digested with Nco I and Xho I and ligated to pIC552 (Macian et al., 1994) digested 121 with the same enzymes, to create plasmids pkBN16 and pkBO395. These contained katB regulatory 122 region from each strain fused to lacZ gene sequence. All constructions were confirmed by digestion 123 and sequencing. 124 125 Induction of catalase genes expression. To induce catalase genes expression from pAB-katB and 126 pBAD-katG, plasmids were transformed into O395 competent cells prepared as previously 127 described (von Kruger et al., 1999). Transformants were grown in LB till mid-exponential phase 128 (OD600nm 0.5-0.7) and arabinose at 0.002%, 0.02% or 0.2% was added to three separate cultures. 129 Glucose 0.2% was added to another culture to repress kat genes expression from araBAD promoter 130 (negative control). All cultures were incubated for a further 4h at 37˚C under aeration before 131 catalase activity was assayed. 132 133 Enzyme assays. Catalase activity was determined in solution and in-gel after non-denaturing 134 polyacrylamide gel electrophoresis. For both procedures, V. cholerae cells were cultivated in LB to 135 mid-exponential (OD600nm 0.5-0.7) or stationary (OD600 > 2.5) phase or in MGHP and MGLP for 136 10h. Cells in a volume corresponding to OD600nm 6 were collected by centrifugation (16,000 x g for 137 15 min at 4°C), suspended in 500 μL 50 mM potassium phosphate buffer pH 7.0 containing 5 mM 138 EDTA, 10% glycerol and 25 μM PMSF and disrupted by sonication. Unbroken cells and large 139 aggregates were removed by centrifugation as above. Lysate protein concentration was determined 140 with Bio-Rad Protein Assay Dye Reagent. 141 To measure catalase activity in solution, a lysate volume containing a minimum of 12.5 μg proteins 142 was diluted in 1mL water to which 500 μL 59 mM H2O2 in 50 mM potassium phosphate buffer 143 pH7.0 was added. H2O2 decomposition was monitored spectrophotometrically by measuring 144 OD240nm for 3 min. The exponential decay of OD240nm per minute (ΔOD240nm/min) was determined 145 and catalase units (U) were defined as (ΔOD240nm/min) x 1000 x 43.6-1 (43.6 represents ε value for 146 H2O2 in mM-1 cm-1). 147 Native PAGE was used to detect protein bands with catalase activity. Briefly, proteins lysate (50- 148 100 μg) was resolved by non-denaturing 4-8% polyacrylamide gradient gel electrophoresis after 149 which the gel was stained specifically for catalase activity using potassium ferricyanide solution 150 (Woodbury et al., 1971). 151 β-galactosidase activities were measured in cell lysates, as previously described (Miller, 1972) and 152 expressed in U x μg protein-1 (Protein Assay Dye Reagent, Bio-Rad). 153 154 Mass spectrometry protein identification: Whole cell lysates (30 μg of proteins) were analyzed 155 by SDS-PAGE (12.5%). Gel was Coomassie Brilliant Blue-stained and protein bands were cut from 156 gel, trypsin digested (Shevchenko et al., 1996) and analyzed by MS ESI-Q-Tof Micro (Waters 157 Corporation, USA), coupled to a NanoUPLC (Nano Ultra Performance Liquid Chromatography- 158 nanoACQUITY Waters), as recommended by MIAPE-Minimum Information About Proteomics 159 Experiment (Taylor et al., 2007). Raw data were processed using the ProteinLynx 2x4 and proteins 160 were identified as described (von Kruger et al., 2006). 161 162 Bacterial survival assays after H2O2 treatment: Aliquots of 500 μL the cultures used for catalase 163 assay were incubated with H2O2 (15 or 30 mM, depending on strain and growth condition) for up to 164 20 min, at 37C, without aeration. Cell survival was calculated by determining CFU ml-1 after 165 challenge in comparison to non-treated culture (control, 100%). 166 167 ROS detection: Intracellular ROS levels were measured using dihydrodichlorofluorescein diacetate 168 (DCFH-DA). N16961 and WK10 were grown for up to 10 hours in MGHP or MGLP. Aliquots of 169 10 μL and 100 μL of the cultures in MGHP and MGLP, respectively, were harvested by 170 centrifugation (16,000 x g for 4 min at room temperature) and ressuspended in 1 mL 0.9 % NaCl. 171 The suspensions were diluted and plated onto LB-agar 1.5% containing streptomycin 100 g ml-1 172 for viable CFU determination. DCFH-DA at a final concentration of 10 μM was then added to the 173 bacterial suspension, followed by 30 min incubation at 37 °C. Fluorescence was measured at 174 485/530 nm excitation/emission using a microplate reader (Victor3; PerkinElmer) and the results 175 were expressed in fluorescence intensity x 1000 / CFU ml-1. 176 177 178 Results 179 Expression of katG and katB in V. cholerae O1 N16961 and O395 is growth-phase dependent 180 and varies between the strains 181 Genome analysis revealed that classical O395 and El Tor N16961 V. cholerae O1 strains have two 182 distinct catalase genes, katG (VC1560) and katB (VC1585), which encode, respectively, KatG and 183 KatB. Previous study has shown that both proteins contribute to oxidative stress resistance in E1 184 Tor strain C6706 (Wang et al., 2012). However, nothing is known about the expression and 185 functions of these genes in the pandemic strains O395 and N16961. In order to investigate whether 186 O395 and N16961 produce catalases, cells were grown in rich medium (LB) and enzyme total 187 activity was measured in exponential and stationary phase cells (Fig. 1(a) and (b)). In N16961, total 188 catalase activity was growth-stage dependent, being higher at stationary phase cells. O395 cells, on 189 the other hand displayed lower and similar catalase activity in both culture phases. 190 N16961 and O395 exponential and stationary phase whole-cell lysates were also subjected to non- 191 denaturing polyacrylamide gel electrophoresis followed by in-gel catalase activity staining 192 (Woodbury et al., 1971). Two catalase activity regions (I and II) exhibiting distinct migration 193 patterns were detected on gel lanes corresponding to N16961 and O395 stationary-phase cells. 194 However, both catalase bands from N16961 were stronger than those from O395 (Fig. 1(b)). 195 Exponential cells catalase electrophoretic pattern, on the other hand, differed between strains. While 196 N16961 presented only the slow-migrating catalase (band I), no activity was detected in O395 197 exponential cells, under conditions analyzed (Fig. 1(c)). This can be explained by the fact that the 198 gel staining is less sensitive than the catalase quantitative assay, and also because enzyme activity 199 in exponential O395 cells seems to be highly variable (Fig. 1(b)). 200 To identify the catalases, bands of high enzymatic activity (I and II from N16961 stationary-phase 201 cells electrophoretic profile- Fig. 1(c)) were excised, treated with trypsin and the resulting peptides 202 were analyzed by mass spectrometry. While no proteins were identified in band I, several V. 203 cholerae proteins were identified in band II (Table S1), including catalase/peroxidade KatG 204 (VC1560). 205 As strains O395 and N16961 have potential to produce two catalases, KatG and KatB, we 206 hypothesized that KatB, although it was not identified in the former experiment, could be the slow- 207 moving catalase in the band I (Fig. 1(c)). To test this assumption, two plasmids pAB-katB and 208 pBAD-katG, carrying, respectively, KatB and KatG-encoding genes upstream an arabinose 209 inducible promoter, were constructed and introduced into V. cholerae O395, since it shows low 210 endogenous catalase activity (Fig. 1(b) and (c)). Expression of katG and katB in transformed O395 211 cells was induced by arabinose, added to mid-exponential phase cultures. Among arabinose 212 concentrations tested, 0.02% was the lowest required for higher expression of both, katG and katB 213 (Fig. S1). Thus, 0.02% arabinose was used in the subsequent experiments. Expression of katB and 214 katG in induced O395 cells carrying either pBAD-katB or pBAD-katG were evaluated by SDS- 215 PAGE and catalase activity assay. A protein band of molecular mass between 45 and 66 kDa (Fig. 216 2(a)), consistent with theoretical KatB molecular weight of 64 kDa, was only seen in the 217 electrophoretic profile of O395/pBAD-katB induced cells, which also presented strong catalase 218 activity at band I (Fig. 2(b)). These results indicate that katB was expressed in O395/pBAD-katB 219 cells upon arabinose induction and that KatB is the slow-migrating catalase in band I, also seen in 220 Fig. 1(c). 221 The protein profile of the induced O395/pBAD-katG cells, on the other hand, presented an extra 222 band of molecular mass between 66 and 97 kDa (Fig. 2(a)), consistent with the theoretical KatG 223 molecular weight of 86 kDa, which is not present in non-induced cells (Fig. 2(a)). This protein 224 showed high catalase activity, as seen in the fast-migrating band II in Fig. 2(b) and 1(c), and was 225 identified as KatG by mass spectrometry, as mentioned before. 226 In summary, V. cholerae O1 strains El Tor N16961 and classical O395 can express katG and katB 227 in a growth-phase dependent manner. However, N16961 produces significantly higher catalase 228 levels than classical strain O395. This is not surprising since it has been demonstrated that El Tor 229 strains have greater ability to survive stressful environmental conditions than classical ones 230 (Finkelstein, 1996). Sunlight, for instance, can lead to H2O2 generation in water environments 231 (Cooper & Zika, 1983) and bacterial strains with high capability to neutralize peroxide can persist 232 for long periods in water ecosystems (Arana et al., 1992). 233 234 KatB and KatG are involved in oxidative stress response in V. cholerae 235 In order to investigate whether KatB or KatG play roles in oxidative stress resistance in V. cholerae, 236 non-transformed O395 cells and those carrying pBAD-katB or pBAD-katG were cultivated in LB to 237 mid-exponential phase, at 37C, under aeration. At this point, arabinose (to induce 238 araBAD promoter) or glucose (to avoid araBAD promoter leaking) was added to cultures that were 239 incubated for further 4h. Catalase specific activities and cell survival rates were estimated upon 20 240 min exposure to 30 mM H2O2 (Fig. 3). O395/pBAD-katB cells treated with arabinose presented the 241 highest catalase specific activity detected, followed by those carrying pBAD-katG, compared to 242 non-transformed cells or uninduced transformants. The survival rates of cells challenged with H2O2 243 were directly related to their catalase activity. Accordingly, O395/pBAD-katB cells were the most 244 resistant (near 100% survival), followed by pBAD-katG cells (around 10% survival). Cells showing 245 very low catalase levels were very sensitive to H2O2, with survival rates significantly lower (Fig. 3). 246 Taken together these findings show that KatG and KatB catalases seem to be important factors for 247 V. cholerae O1 N16961 and O395 strains oxidative stress response, corroborating data from 248 previous study on El Tor strain C670 (Wang et al., 2012). However, KatB seems to play a critical 249 role in the process (Fig. 3), in agreement with the increased expression of katB gene in V. cholerae 250 O1 El Tor strain A1552 variants highly resistant H2O2 (Yildiz et al., 2004). 251 252 Expression regulation of katB gene differs between V. cholerae O1 strains O395 and N16961 253 Considering that KatB and KatG are differently expressed in O395 and N16961 cells, we compared 254 a 300bp region upstream the putative translation initiation site of katB and katG from both strains. 255 While katG regulatory regions in both strains are identical, katB regulatory regions share 98% 256 identity (four nucleotide modifications and one gap in O395 sequence, Fig. S2). For that reason, we 257 decided to investigate katB expression regulation in O395 and N16961 strains. To this end, 300bp 258 DNA fragments upstream the putative translation initiation sites of katB from both, N16961 and 259 O395, were fused to lacZ in pIC552 plasmid (Macian et al., 1994) to create pkBN16 and pkBO395 260 plasmids (Table 1). Plasmids pkBN16 and pkBO395 were then used to transform V. cholerae 261 N16961 and O395 and β-galactosidase activity (lacZ gene product) was measured in exponential 262 (OD600 ~ 0.5-0.7) and stationary phase (OD600 > 2.5) cells grown in LB, at 37C, under aeration 263 (Fig. 4). β-galactosidase activity level was higher in stationary-phase cells of both strains, relative 264 to exponential-phase ones, corroborating results presented before (Fig. 1(b) and (c)). Moreover, 265 similar activity levels were observed in cells of each strain harboring either pkBN16 or pkBO395, 266 indicating that katB regulatory regions from V. cholerae N16961 and O395 can activate lacZ 267 transcription similarly (Fig. 4). However, β-galactosidase activity levels in O395 transformed cells, 268 from both culture phases, were about 3-fold lower than the correspondent ones in N16961 269 transformants (Fig. 4). These results are in perfect agreement with O395 cells low catalase activity 270 (Fig. 1(b) and (c)), and are strong evidence that katB expression regulation differs between strains 271 O395 and N16961. Nonetheless, this cannot be attributed to the differences in katB regulatory 272 regions between these strains (Fig. S2) and it may, in fact, depend on strain-specific regulatory 273 elements. 274 275 katB and katG genes expression is repressed under Pi limitation in a PhoB/PhoR-independent 276 manner but this system is required for oxidative stress resistance in V. cholerae O1 N16961 277 In previous work, we identified many V. cholerae O1 proteins synthesized in response to Pi 278 limitation and/or PhoB cellular levels with roles in oxidative and other stresses conditions (von 279 Kruger et al., 2006). Although catalases were not among those proteins, we cannot discard an 280 interaction between kat genes expression and Pi metabolism. Induction of catalase katA expression 281 by Pi limitation was experimentally demonstrated for three different proteobacteria, Sinorhizobium 282 meliloti, Pseudomonas aeruginosa and Agrobacterium tumefaciens (Yuan et al., 2005). In these 283 species, katA transcription requires PhoB and Pho-box elements were identified upstream of katA 284 genes (Yuan et al., 2005; Yuan et al., 2006). Since nothing is known about a possible interaction 285 between catalase production and Pi metabolism, we used the high catalase producer strain N16961 286 (Fig. 1(b) and (c)) and WK10, a phoB mutant of N16961, to examine the involvement of 287 PhoB/PhoR system in the expression regulation of katB and katG. To this end, specific catalase 288 activity was measured in N16961 and WK10 cells grown in MGHP and MGLP with appropriate 289 antibiotics, at 37C, under aeration, for 10 h (stationary phase). Total catalase activity did not differ 290 between the strains, but the cells grown under Pi abundance presented about 4-fold the activity 291 detected in cells from Pi-limited cultures (Fig. 5(a)). 292 We next investigated whether Pi limitation and PhoB/PhoR system were involved in katB and katG 293 genes expression by electrophoresis of cell lysates on non-denaturing polyacrylamide gel, followed 294 by in-gel catalase activity staining. The electrophoretic patterns of the catalases produced by 295 N16961 and WK10 in MGHP and MGLP were highly similar (Fig. 5(b)), presenting two bands 296 corresponding to KatB and KatG, as in Fig. 1(c) and 2(b). Although KatB and KatG specific 297 activity levels did not vary between the strains, they were affected by Pi concentration in culture 298 media, being lower in cells grown under Pi limitation (Fig. 5(b)), corroborating data presented 299 before (Fig. 5(a)). These results contrast with those obtained for other species (Yuan et al., 2005; 300 Yuan et al., 2006) and suggest that katB and katG gene expression in V. cholerae is repressed under 301 Pi-limiting conditions in a PhoB/PhoR-independent process. 302 N16961 and WK10 cells grown in MGHP and MGLP were also exposed to H2O2 for 5, 10 and 20 303 min and their survival rates were determined. The high catalase level in N16961 and WK10 cells 304 from MGHP cultures correlated well with their survival rates upon challenge with H2O2 compared 305 to cells grown in MGLP (Fig. 6(a)). Interestingly, although N16961 and WK10 grown in MGLP 306 cultures presented similar specific catalase activity levels, the wild type cells were about 50 to 100- 307 fold more resistant to H2O2 challenge than the mutant ones (Fig. 6(a)). These results and those 308 presented before (Fig. 3) highlight a close relationship between total catalase activity and oxidative 309 stress response in V. cholerae O1 N16961. They also indicate that extracellular Pi levels regulate 310 katG and katB expression in a PhoB/PhoR-independent manner in this strain. However, catalases 311 are not the only factor contributing to N16961 resistance to H2O2. PhoB/PhoR system directly or 312 indirectly contributes to ROS resistance in V. cholerae O1, confirming previous results from our 313 group (Lery et al., 2013; von Kruger et al., 2006). 314 315 PhoB/PhoR system is essential to control cytoplasmic ROS accumulation in V. cholerae O1 316 strain N16961 under Pi limitation 317 In order to investigate how PhoB/PhoR system protects N16961 cells against oxidative stress, we 318 determined intracellular ROS levels in wild type N16961 and phoB/phoR mutant WK10 cells grown 319 in MGHP or MGLP for 10 h (Fig. 6(b)). Although N16961 and WK10 cells cultivated in Pi-limiting 320 conditions presented similar catalase activities (Fig. 5), similar ROS levels were detected in the 321 wild-type cells from both cultures and in the mutant WK10 cultivated in MGHP (Fig. 6(b)). In 322 contrast, WK10 cells grown in MGLP presented about 7-fold less ROS levels than in MGHP (Fig. 323 6b), indicating that PhoB/PhoR system, in an unknown way, protects V. cholerae O1 against ROS 324 accumulation. These findings could help us to understand the phosphate-starvation response of the 325 phoB mutant WK3, in comparison to its parental strain from the classical biotype 569B of V. 326 cholerae O1 described previously (von Kruger et al., 1999; von Kruger et al., 2006). WK3 327 differentially expressed many genes involved in stress resistance and survival in comparison to 328 569B under Pi limitation. These included genes of detoxification enzymes, such as the 329 alkylhydroperoxide reductase subunit C (AhpC) that is a common scavenger of peroxides in 330 bacteria and a spermidine/putrescine-binding protein that has been associated with DNA protection 331 from oxidative damages (von Kruger et al., 2006). Our results indicate PhoB/PhoR system plays a 332 role in orchestrating detoxifying mechanisms other than catalases to protect cells against oxidative 333 stress. 334 335 Concluding remarks 336 In this study, it is shown for the first time a relationship between Pi levels and katG and katB genes 337 expression in pandemic strains of V. cholerae O1. Although PhoB/PhoR system is not required for 338 full expression of catalase genes, it is involved in V. cholerae O1 response against oxidative stress. 339 This conclusion is based on our findings that besides catalases, a functional PhoB/PhoR system is 340 critical for hydrogen peroxide resistance in V. cholerae O1, especially under Pi limitation. 341 Therefore, this study reveals new roles for PhoB/PhoR, a system that has already been related to 342 many physiological processes and pathogenicity in V. cholerae O1 (Lery et al., 2013; Pratt et al., 343 2009; Pratt et al., 2010; Sultan et al., 2010; von Kruger et al., 2006). 344 345 Acknowledgments 346 347 We thank FAPERJ, CNPq and CAPES for financial support. We are grateful to Mr. E. Camacho for 348 technical support and to Dr. Rodrigo Fortunato for his assistance in intracellular ROS 349 determination. 350 351 352 References 353 Arana, I., Muela, A., Iriberri, J., Egea, L. & Barcina, I. (1992). Role of hydrogen peroxide in 354 loss of culturability mediated by visible light in Escherichia coli in a freshwater ecosystem. Applied 355 and environmental microbiology 58, 3903-3907. 356 357 Colwell, R. R. (1996). Global climate and infectious disease: the cholera paradigm. Science 274, 358 2025-2031. 359 360 Cooper, W. J. & Zika, R. G. (1983). Photochemical formation of hydrogen peroxide in surface 361 and ground waters exposed to sunlight. Science 220, 711-712. 362 363 Dubbs, J. M. & Mongkolsuk, S. (2012). Peroxide-sensing transcriptional regulators in bacteria. 364 Journal of bacteriology 194, 5495-5503. 365 366 Finkelstein, R. A. (1996). Cholera, Vibrio cholerae O1 and O139, and other pathogenic Vibrios. In 367 Medical Microbiology. Edited by S. Byron: The University of Texas Medical Branch at Galveston. 368 369 Goulart, C. L., dos Santos, G. G., Barbosa, L. C., Lery, L. M., Bisch, P. M. & von Kruger, W. 370 M. (2010). A ToxR-dependent role for the putative phosphoporin VCA1008 in bile salt resistance 371 in Vibrio cholerae El Tor N16961. Microbiology 156, 3011-3020. 372 373 Jung, I. L. & Kim, I. G. (2003). Transcription of ahpC, katG, and katE genes in Escherichia coli is 374 regulated by polyamines: polyamine-deficient mutant sensitive to H2O2-induced oxidative damage. 375 Biochemical and biophysical research communication 301, 915-922. 376 377 Lery, L. M., Goulart, C. L., Figueiredo, F. R., Verdoorn, K. S., Einicker-Lamas, M., Gomes, 378 F. M., Machado, E. A., Bisch, P. M. & von Kruger, W. M. (2013). A comparative proteomic 379 analysis of Vibrio cholerae O1 wild-type cells versus a phoB mutant showed that the PhoB/PhoR 380 system is required for full growth and rpoS expression under inorganic phosphate abundance. 381 Journal of proteomics 86, 1-15. 382 383 Lushchak, V. I. (2011a). Adaptive response to oxidative stress: Bacteria, fungi, plants and animals. 384 Comparative biochemistry and physiology part C: toxicology & pharmacology 153, 175-190. 385 386 Lushchak, V. I. (2011b). Environmentally induced oxidative stress in aquatic animals. Aquat 387 Toxicology 101, 13-30. 388 389 Macian, F., Perez-Roger, I. & Armengod, M. E. (1994). An improved vector system for 390 constructing transcriptional lacZ fusions: analysis of regulation of the dnaA, dnaN, recF and gyrB 391 genes of Escherichia coli. Gene 145, 17-24. 392 393 Miller, J. H. (1972). A Short Course in Bacterial Genetics. Cold Spring Harbor, NY: Cold Spring 394 Harbor Laboratory. 395 396 Osorio, C. G., Martinez-Wilson, H. & Camilli, A. (2004). The ompU Paralogue vca1008 is 397 required for virulence of Vibrio cholerae. Journal of bacteriology 186, 5167-5171. 398 399 Pratt, J. T., McDonough, E. & Camilli, A. (2009). PhoB regulates motility, biofilms, and cyclic 400 di-GMP in Vibrio cholerae. Journal of bacteriology 191, 6632-6642. 401 402 Pratt, J. T., Ismail, A. M. & Camilli, A. (2010). PhoB regulates both environmental and virulence 403 gene expression in Vibrio cholerae. Molecular microbiology 77, 1595-1605. 404 405 Salim, A., Lan, R. & Reeves, P. R. (2005). Vibrio cholerae pathogenic clones. Emerging 406 infectious diseases 11, 1758-1760. 407 408 Schellhorn, H. E. (1995). Regulation of hydroperoxidase (catalase) expression in Escherichia coli. 409 FEMS Microbiology Letters 131, 113-119. 410 411 Shevchenko, A., Wilm, M., Vorm, O. & Mann, M. (1996). Mass spectrometric sequencing of 412 proteins from silver stained polyacrylamide gels. Analytical Chemistry 68, 850-858. 413 414 Shimizu, K. (2013). Regulation systems of bacteria such as Escherichia coli in response to nutrient 415 limitation and environmental stresses. Metabolites 4, 1-35. 416 417 Silva, A. J., Sultan, S. Z., Liang, W. & Benitez, J. A. (2008). Role of the histone-like nucleoid 418 structuring protein in the regulation of rpoS and RpoS-dependent genes in Vibrio cholerae. Journal 419 of bacteriology 190, 7335-7345. 420 421 Storz, G., Tartaglia, L. A. & Ames, B. N. (1990). Transcriptional regulator of oxidative stress- 422 inducible genes: direct activation by oxidation. Science 248, 189-194. 423 424 Sultan, S. Z., Silva, A. J. & Benitez, J. A. (2010). The PhoB regulatory system modulates biofilm 425 formation and stress response in El Tor biotype Vibrio cholerae. FEMS Microbiology Letters 302, 426 22-31. 427 428 Taylor, C. F., Paton, N. W., Lilley, K. S. & other authors (2007). The minimum information 429 about a proteomics experiment (MIAPE). Nature Biotechnology 25, 887-893. 430 431 Vallet-Gely, I., Lemaitre, B. & Boccard, F. (2008). Bacterial strategies to overcome insect 432 defences. Nature Reviews Microbiology 6, 302-313. 433 434 von Kruger, W. M., Humphreys, S. & Ketley, J. M. (1999). A role for the PhoBR regulatory 435 system homologue in the Vibrio cholerae phosphate-limitation response and intestinal colonization. 436 Microbiology 145 ( Pt 9), 2463-2475. 437 438 von Kruger, W. M., Lery, L. M., Soares, M. R., de Neves-Manta, F. S., Batista e Silva, C. M., 439 Neves-Ferreira, A. G., Perales, J. & Bisch, P. M. (2006). The phosphate-starvation response in 440 Vibrio cholerae O1 and phoB mutant under proteomic analysis: disclosing functions involved in 441 adaptation, survival and virulence. Proteomics 6, 1495-1511. 442 443 Wang, H., Chen, S., Zhang, J., Rothenbacher, F. P., Jiang, T., Kan, B., Zhong, Z. & Zhu, J. 444 (2012). Catalases promote resistance of oxidative stress in Vibrio cholerae. PLoS One 7, e53383. 445 446 Wanner, B. L. (1993). Gene regulation by phosphate in enteric bacteria. Journal of Cellular 447 Biochemistry 51, 47-54. 448 449 Woodbury, W., Spencer, A. K. & Stahman, M. A. (1971). An improved procedure using 450 ferricyanide for detecting catalase isozymes. Analytical biochemistry 44, 301-305. 451 452 Yildiz, F. H., Liu, X. S., Heydorn, A. & Schoolnik, G. K. (2004). Molecular analysis of rugosity 453 in a Vibrio cholerae O1 El Tor phase variant. Molecular Microbiology 53, 497-515. 454 455 Yuan, Z. C., Zaheer, R. & Finan, T. M. (2005). Phosphate limitation induces catalase expression 456 in Sinorhizobium meliloti, Pseudomonas aeruginosa and Agrobacterium tumefaciens. Molecular 457 Microbiology 58, 877-894. 458 459 Yuan, Z. C., Zaheer, R., Morton, R. & Finan, T. M. (2006). Genome prediction of PhoB 460 regulated promoters in Sinorhizobium meliloti and twelve proteobacteria. Nucleic Acids Research 461 34, 2686-2697. 462 463 464 465 Figure legends 466 467 Table 1 – Plasmids and primers used in this work 468 469 Fig. 1- Catalase activity in exponential and stationary-phase cells of the V. cholerae strains El Tor 470 N16961 and classical O395. Cells were grown to exponential or stationary growth phase in LB at 471 37 °C, under aeration. (a) N16961 and O395 growth curves showing exponential (black arrow) and 472 stationary (white arrow) phases sampling points. (b) Catalase specific activity was determined in 473 cell lysates. Columns represent the average of three individual experiments with standard deviation 474 as error bars. (c) Exponential and stationary-phase whole-cell lysates proteins (60 μg) were resolved 475 by electrophoresis on a 4-8% gradient non-denaturing polyacrylamide gel followed by in-gel 476 catalase activity staining. The arrows indicate two bands of catalase activity that will be referred as 477 bands I and II in the text. 478 479 Fig. 2 – Protein profiles of O395 cells carrying pBAD-katB or pBAD-katG. O395 cells carrying 480 pBAD-katB or pBAD-katG were grown in LB for 4h, at 37˚C, under aeration, after arabinose 481 addition to mid exponential phase cultures. Cells were then collected and lysates were prepared and 482 gel analyzed. (a) Whole cell lysates electrophoretic profiles (30 μg of proteins/lane) after SDS- 483 PAGE (12.5%). Arrows indicate protein bands only seen on arabinose treated cells profile. (b) 484 Whole cell lysates catalase activity (50 μg of proteins/lane) after non-denaturing 4-8% gradient gel 485 electrophoresis and specific staining. 486 487 Fig. 3 – Effect of katG and katB overexpression on V. cholerae O395 resistance to H2O2. Cells were 488 grown in LB at 37°C, under aeration, till exponential phase. Cultures were divided in two flasks, 489 where glucose 0.2% (Glu) or arabinose 0.02% (Ara) were added. Flasks were incubated for 4 hours 490 at 37°C, under aeration, before catalase activity was measured. To determine cell survival upon 491 exposure to peroxide, aliquots of these cultures were taken and H2O2 at final concentration of 30 492 mM was added to each one. Samples were collected 5, 10 and 20 min after H2O2 addition, diluted 493 and plated onto LB-agar. Cell survival was calculated by determining CFU number after challenge 494 and expressed as CFU percentage obtained for the control culture (non-exposed to H2O2). Columns 495 represent the average of four independent experiments with standard deviation as error bars. Each 496 value in the upper box represents the average catalase activity in cells from the same cultures used 497 for assessing H2O2 sensitivity. 498 499 Fig. 4 –β-galactosidase specific activity in N16961 and O395 cells harbouring pkB-N16 or pkB- 500 O395. Cells were grown till exponential (OD600 ~ 0.5) or stationary (OD600 > 2.5) phases in LB, 501 at 37C, under aeration and β-galactosidase specific activity was measured in their lysates. Data 502 represent the average of four experiments with standard deviation as error bars. 503 504 Fig. 5 – Specific catalase activity in V. cholerae N16961 and WK10 cells cultivated under Pi-rich 505 and Pi-limiting conditions. Wild-type N16961 and phoB/phoR mutant WK10 cells were grown in 506 MG medium supplemented with Pi at high (HP) or low (LP) concentration, at 37 °C, under 507 aeration, for 10 hours (stationary phase). (a) Total catalase activity was determined in cell lysates. 508 Columns represent five individual experiments average with standard deviation as error bars. (b) V. 509 cholerae catalase isozymes observed by non-denaturing polyacrylamide gel. Whole cell lysates 510 (100 μg) were resolved on a 4-8% gradient non-denaturing polyacrylamide gel that was specifically 511 stained for catalase activity. 512 513 Fig. 6 – Oxidative stress resistance and ROS accumulation in V. cholerae N16961 and WK10 cells 514 cultivated under Pi-rich and Pi-limiting conditions. Wild-type N16961 and phoB/phoR mutant 515 WK10 cells were grown in high (MGHP) or low (MGLP) Pi concentration, at 37 °C, under 516 aeration, for 10 hours (stationary phase). (a) Survival rates after 5, 10 and 20 min treatment with 517 H2O2, relative to the control (untreated cells, 100%). N16961 and WK10 cells from MGHP were 518 treated with 30 mM H2O2, while those from MGLP cultures, that do not resist such peroxide 519 concentration, 15 mM H2O2 was used. Columns represent four individual experiments average with 520 standard deviation as error bars. (b) Intracellular ROS accumulation in V. cholerae cells was 521 inferred using DCF-DA, a molecule that penetrates the cell and reacts with cytoplasmic ROS, 522 resulting in fluorescence emission. Data were normalized by the number of cells used in the assay 523 and are presented in fluorescence intensities x 1000 / CFU ml-1. Columns represent the average of 524 three individual experiments with standard deviation as error bars. 525 Table 1 526 Name Description Application pBAD TOPO® Cloning vector, Invitrogen Cloning vector pAB-katB V. cholerae katB (vc1585) fusioned to araBAD promoter katB expression pBAD-katG V. cholerae katG (vc1560) fusioned to araBAD promoter katG expression pIC552 Cloning vector (Macian et al., 1994) Cloning vector pkBN16 V. cholerae N16961 katB regulatory region fusioned to Evaluation of lacZ N16961 katB Plasmid regulatory region activity pkBO395 V. cholerae O395 katB regulatory region fusioned to lacZ Evaluation of O395 katB regulatory region activity Primers (5’–3’) KatBADFw TGATGAGGAATAATAATTGATAAGTAAAAATATGAG Cloning (katB gene) KatBADRv CATCGCGGCCAGTTTTGCCACC Cloning (katB gene) KatGBADFw TGAGAGGAATAATAAATGGAGCACAATAAAGCG Cloning (katG gene) KatGBADRv CACCAGATCAAATCGATCCGCATTCATT Cloning (katG gene) KatBpro1 GTCTACCATGGATAGCCGTATTGAG Cloning (katB regulatory region) KatBpro2 GCTACTCGAGCCGTCATTATTTTAAG Cloning (katB regulatory region) 527