Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Chapter 3 Authentication of herbaceous Phyllanthus species grown in Karnataka based on morphological characters and molecular analysis 3. Authentication of herbaceous Phyllanthus species grown in Karnataka based on morphological characters and molecular analysis 3.1 Introduction The genus Phyllanthus belongs to the family Phyllanthaceae. Earlier it was included in the family Euphorbiaceae sensu lato. It is one of the largest genera of flowering plants, with over 1200 species and accounts for more than half of the species in the family (Kathriarachchi et al., 2006; Pruesapan et al., 2008). India has 53 species of Phyllanthus (Balakrishnan and Chakrabarty, 2007), although Hooker (1887) recorded 56 species from the then British India. Chaudhary and Rao (2002) have listed 12 herbaceous Phyllanthus species in India namely, P. ajmerianus Chaudhary & Rao, P. amarus Schumach. & Thonn., P. debilis Klein ex Willd., P. fraternus Webster, P. kozhikodianus Siv. & Mani., P. maderaspatensis L., P. rheedei Wight, P. rotundifolius Klein ex Willd., P. scabrifolius Hook.f., P. tenellus Roxb., P. urinaria L. and P. virgatus Forst. f. Herbaceous Phyllanthus species have been used since ancient times in different systems of medicine, particularly for the treatment of liver disorders and urinary infection. Kannada name for herbaceous Phyllanthus species is ‘Nelanelli’ or ‘Kirunelli’ and in Sanskrit or Ayurveda it is known as ‘Bhumyamalaki’ or ‘Tamalaki’. The herbs known as ‘Bhumyamalaki’ in Indian literature refer to a complex group of P. amarus, P. fraternus, P. debilis and P. urinaria. The whole group forms a ‘niruri complex’ (Chaudhary and Rao, 2002). P. maderaspatensis and P. virgatus are also used as substitutes for ‘Bhumyamalaki’ (Murthy, 1994; Yoganarasimhan, 1996; Chaudhary and Rao, 2002). Although these species closely resemble each other, ethnomedical uses and some aspects of pharmacological activities of these species are different (Theerakulpisut et al., 2008). Confusion exists in identification of these species mainly due to referring them all with a common vernacular name, their similarity in gross morphology, close proximity in growth habitat and lack of guidelines to check the authenticity and quality of the medicinal plant sold (Dnyaneshwar et al., 2006). 44 Webster (1955, 1956, 1956a, 1957, 1958, 1967, 1970 and 1994) has worked exhaustively on Phyllanthus and has provided detailed taxonomic accounts of West Indian Phyllanthus. He made several new observations. For the first time, he observed that true P. niruri L. is a native of the New World and endemic to America and does not occur in India. However, there are many publications published even today from India bearing the title of P. niruri. In 1987, Mitra and Jain, after a critical examination of Indian materials of Phyllanthus revealed that the P. niruri L. described in Flora of British India (Hooker, 1887) is actually a mixture of three closely related but distinct species namely P. amarus, P. debilis and P. fraternus. The reports on P. niruri from India are actually pertaining to investigations on one of the members of this ‘niruri complex’ but not on P. niruri (Dnyaneshwar et al., 2006). Chaudhary and Rao (2002) observed that the concept and identification of various Phyllanthus species, particularly herbaceous ones, have been unclear mainly due to misidentification of specimens in several Indian herbaria. The distribution of some species has also not been recorded correctly. The same thing has happened in floras of Karnataka state also. P. asperulatus Hutch. has been mentioned in flora of Bangalore (Ramaswamy and Razi, 1973) and Mysore (Rao and Razi, 1981). However, Chaudhary and Rao (2002) did not include this species in India. P. debilis, even though reported from Gulbarga and Kodagu by Singh (1988) and Murthy and Yoganarasimhan (1990), Saldanha (1996) did not record this species from Karnataka region and expressed his doubts on the occurrence of this species in this region. Chaudhary and Rao (2002) mentioned its distribution only in coastal areas. P. rotundifolius generally grows near seashores in sandy soils. However, Kammathy et al. (1967) and Rao and Razi (1981) have reported it from Biligirirangana hills. Therefore, Chaudhary and Rao (2002) call for the confirmation of these reports. Even though P. rheedei is reported from Dakshina Kannada (Saldanha, 1996), Bangalore (Ramaswamy and Razi, 1973) and Mysore (Rao and Razi, 1981), Chaudhary and Rao (2002) did not report this species from Karnataka. Study by Gangopadhyay et al. (2004) found that P. kozhikodianus is distinct from P. debilis Hook.f. and is synonymous with P. rheedei. Therefore, the present study was undertaken to investigate the diversity of herbaceous Phyllanthus species in Karnataka and attempt has been made to resolve the nomenclatural problems and confusions persisting in this 45 genus by analyzing the morphological characters of these species and evolve a simple morphology based key for authentic taxonomical identification of the related species. In recent years, efforts have been made to accurately identify medicinal plants used in raw drug trade to ensure the purity, quality and safety of drugs (Jayasinghe et al., 2009). Besides conventional methods including examination of wood anatomy and morpho-taxonomical keys, several DNA-based methods have been developed for the identification of medicinal plants (Sucher and Carles, 2008). For example, a rapid detection method based on DNA sequences has been developed for identifying three species of Bupleurum, B. kaoi Liu Chao et Chuang, B. falcatum L. and B. chinense DC., in the processed herbal material using ITS regions (Lin et al., 2008). A sequence-specific oligonucleotide probe (SSOP) array has been developed using the sequence differences between these three species for identification (Lin et al., 2008). Misra et al. (2006) developed an AFLP based detection of adulterants in crude drug preparations of the safed musli (Chlorophytum) complex. Jain et al. (2008) developed sequence characterized amplified region (SCAR) markers to identify four species of Phyllanthus used in dry leaf bulk herb trade. Several related species of P. amarus (‘Bhumyamalaki’) occur in India and are widely used as medicinal herbs, though the efficacy of these species is not fully established. Further, since all these species are taxonomically closely related to P. amarus, they are often collected, marketed and used as P. amarus. The problem is further complicated as these species exhibit a lot of morphological diversity in different regions. P. amarus is closely related to P. niruri, P. fraternus and P. debilis morphologically, phytochemically and by use. In fact, because of the confusion, the species are often referred as the PAF (Phyllanthus-amarus-fraternus) complex (Ganeshaiah et al., 1998). P. kozhikodianus, P. rheedei, P. scabrifolius and P. tenellus are very similar in their gross morphology (Chaudhary and Rao, 2002). Sequence comparison of the ITS region is widely used in taxonomy and molecular phylogeny because it is easy to amplify even small quantities of DNA and has a high degree of variation even between closely related species. This can be explained by the relatively low evolutionary pressure acting on such nonfunctional sequences. It has proved useful for checking relationships among species and various genera in Asteraceae (Baldwin, 1993). Therefore, authentic identification of morphologically similar and 46 closely related herbaceous Phyllanthus species were carried out at DNA level by using Nuclear ribosomal ITS sequence analysis. 3.2 Materials and methods 3.2.1 Taxonomical authentication Frequent field visits were carried out throughout the Karnataka state to collect all the herbaceous Phyllanthus species in different seasons. Detailed field notes were made and specimens were collected for preparing herbarium. Standard protocol was followed to prepare herbarium specimens. These herbarium specimens were compared with the herbarium specimens of already recorded herbaceous Phyllanthus species in the regional floras of Karnataka for provisional identification. Later authentic identification was done by referring to recent monographs and floras and by comparing with available type specimens. For each species, correct nomenclature, detailed description, flowering and fruiting period, distribution in different parts of Karnataka, habitat and details of collected specimen have been provided. In addition, stereozoom microscopic view of all taxonomically important morphological features along with habit photograph for each species and critical notes on their correct identification, nomenclature, diagnostic characters, relationship with other allied species and status have also been provided. Finally, morphological distinctions were listed and came up with simple key for authentic taxonomical identification of herbaceous Phyllanthus species based on morphological characters especially on the shape of the leaf. 3.2.2 Molecular authentication 3.2.2.1 Plant material collection Seven herbaceous Phyllanthus species namely, P. amarus Schumach. & Thonn., P. debilis Klein ex Willd., P. maderaspatensis L., P. virgatus G. Forst., P. urinaria L., P. scabrifolius Hook.f. and P. tenellus Roxb. have been collected from different parts of Karnataka. In addition, P. kozhikodianus Siv. & Mani. from Calicut (Kerala) and P. rheedei Wight from Yercaud (Tamil Nadu) were also collected. Fresh leaf samples were collected from these plants, frozen in liquid nitrogen and stored at – 80 °C until used for DNA isolation. 47 3.2.2.2 DNA isolation DNA was isolated using CTAB (Cetyl trimethyl ammonium bromide) method following the protocol of Doyle and Doyle (1990). 100 mg of leaf tissue was ground in liquid nitrogen. Then they were incubated in CTAB buffer (3% (w/v) CTAB, 100 mM Tris-HCl, 20 mM EDTA, 1.4 M NaCl, 2% (v/v) β-mercaptoethanol, 2% (w/v) polyvinyl pyrrolidone, pH 8) for 2 h at 65 °C. The homogenate was then extracted with an equal volume of chloroform: isoamyl alcohol (24:1) mixture and centrifuged at 12000 rpm for 10 min. The upper aqueous layer was recovered and precipitated with pre-chilled isopropanol. The pellet was suspended with Tris-EDTA buffer (pH 8.0). The crude DNA was treated with RNase and incubated for 30 min at 37 °C and again extracted with 1 volume phenol and subsequently with 1 volume of chloroform: isoamyl alcohol (24:1). The supernatants were collected and precipitated with 3 M sodium acetate and pre-chilled ethanol. The DNA pellet was washed with 70% ethanol, dried, and resuspended in TE buffer. The high molecular weight DNA was checked for quality by calculating the ratio of absorbance at 260/280 nm in spectrophotometer. A value of 1.8 confirmed high quality genomic DNA. Quantity of DNA was checked electrophoretically using 0.8% agarose gel against a known amount of lambda DNA taken as standard. 3.2.2.3 ITS amplification, sequencing and authentication ITS analysis was performed using nine different species of Phyllanthus. Amplification of the internal transcribed spacer region of nuclear DNA, including ITS1, 5.8S and part of the ITS2 was done using the primers ITS1 and ITS4 of White et al. (1990). Polymerase chain reactions were performed in a total volume of 25µl (Fermentas green PCR master mix (Germany) including Taq polymerase, MgCl2 and Taq buffer) containing 0.5µl of forward and reverse primers, 25ng of template DNA. Reactions were performed in an eppendorff PCR thermocycler (Germany). Total 35 amplification cycles were carried out with an annealing temperature of 55 °C for 1 min and an extension for 1 min at 72 °C and final extension was kept at 72 °C for 10 min. Subsequently, 5µl of each amplification mixtures were analysed by agarose gel electrophoresis in TBE buffer (1.5% w/v) containing 1µg/ml ethidium bromide, by comparsion with a known mass standard. The PCR products were purified from 48 excess salts and primers with a PCR purification kit (Fermentas, Germany) and sequenced (Eurofins, Bangalore). For authentication of Phyllanthus species, generated sequences were checked for orthology and multiple alignments were performed using multalign. Phylogenetic analysis and tree construction was done using ClustalW2 software. 3.3 Results 3.3.1 Taxonomical authentication of the herbaceous Phyllanthus species grown in Karnataka Extensive field visits resulted in the collection of seven herbaceous Phyllanthus species namely, P. amarus Schumach. & Thonn., P. debilis Klein ex Willd., P. maderaspatensis L., P. virgatus G. Forst., P. urinaria L., P. scabrifolius Hook.f. and P. tenellus Roxb. Totally, 115 specimens belonging to these seven herbaceous Phyllanthus species have been collected from different parts of Karnataka (Fig. 3.1) and further processed for preparing herbarium. All the 115 herbarium specimens have been deposited in the herbarium of Department of Studies in Botany, University of Mysore, Manasagangotri, Mysore (MGM) for future reference. Correct nomenclature, detailed description, flowering and fruiting period, distribution in different parts of Karnataka, habitat, details of collected specimen along with relevant figures for each species and critical notes on their correct identification, nomenclature, diagnostic characters and relationship with other allied species has been given below. 1. Phyllanthus amarus Schumach. & Thonn., in Kongl. Danske Vidensk. Selsk. Skr., Natur Vidensk. Math. Afd. 4: 195. 1829; Webster in J. Arnold Arb. 37: 13. 1956 & 38: 313. pl. 19. f. 1-K. 1957; Webster & Airy Shaw in Kew Bull. 26: 92. 1971; Mitra & Jain in Bull. Bot. Surv. India 27: 164, f. 1. 1987; Brunel & Roux in Nord. J. Bot. 4: 469, f. 1-6. 1984; Chen & Wu in Taiwania 42: 251, f. 54-56. 1997; Chaudhary & Rao in Phytotaxonomy. 2: 148. 2002. P. nanus Hook. f. in Hook. f., Fl. Brit. India. 5: 298. 1887. P. niruri auct. non L. (1753); Hook. f. in Hook. f., Fl. Brit. India 5: 298. 1887, p.p. Branching annual herbs, 10-100 cm tall; stem terete, smooth or sometimes scabridulous in younger parts. Leaves on the main axis reduced to scale leaves 49 (cataphylls); cataphylls 0.8-1.2 mm long, triangular-lanceolate, acuminate, turn black at maturity; stipules 1 mm long, triangular-lanceolate, entire along margins, acuminate, membranous; foliage leaves alternate, distichous; petiole 1 mm long; leaf lamina 5-9 × 2-4 mm, oblong or elliptic-oblong (sometimes obovate), obtuse or rounded at base, entire along margins, obtuse and shortly mucronate at apex, glaucous beneath, 5-7 pairs of nerves, nerves not conspicuous on the upper surface, visible only in the lower side. Cymules unisexual with 1-2 male flowers in upper 1-2 axils and bisexual with 1-2 male flowers and 1-2 female flowers in middle axils and again unisexual with 1 female flower in a few lower axils or sometimes bisexual up to the upper most axils and unisexual in lower axils. Male flowers yellowish white; pedicel 0.5-1 mm long; calyx lobes 5 (very rarely 6), elliptic with acute tip, 0.5 mm long, membranous; disk glands 5, saucer-shaped with irregular margins; stamens 3, filaments completely connate into a column; anthers sessile. Female flowers pale green; pedicel 1 mm long extending up to 2 mm in fruit; calyx lobes 5 (very rarely 6), 0.8 × 0.4 mm, elliptic, acute, with wide membranous margins and green and thickened midrib region; disk flat, deeply 5-lobed; styles 3, free, spreading; stigma bifid. Capsule globose, 1.5-2 mm across, smooth; seeds 0.8 mm long, trigonous, brown, with 6-7 straight parallel longitudinal ribs on back (Fig. 3.2). Flowering and fruiting: Almost throughout the year, but peaks during rainy season. Distribution: Throughout Karnataka, especially in plain and coastal districts. Rare in Western Ghat regions. Habitat: In moist shady places in garden lawns, agriculture fields, roadsides, along railway lines, wastelands and forest margins. 50 51 Specimens collected and examined: Mysore: Manasagangotri (MG) campus, 24.7.2007, S.K.K.K. 2; Talkad (on the river bank), 25.12.2007, S.K.K.K. 22. Kodagu: Virajpet town, 10.9.2007, S.K.K.K. 9. North Kanara: Kumta, 26.10.2007, S.K.K.K. 13. Mandya: Pandavapura, 28.11.2007, S.K.K.K. 19. Udupi: Malpe town, 2.3.2008, S.K.K.K.31. South Kanara: Dharmasthala, 4.3.2008, S.K.K.K. 34. Chikmagalur: Kadur (Railway station), 1.5.2008, S.K.K.K. 37. Shimoga: Badravathi, 2.5.2008, S.K.K.K.40. Chamarajnagar: Yelandur (on the tank bund), 20.6.2008, S.K.K.K. 43. Hassan: Hassan town (Belur road), 15.7.2008, S.K.K.K. 47. Bellary: Near Hampi temple, 1.8.2008, S.K.K.K. 48. Davanagere: Davanagere town (near Avaragere), 14.8.2008, S.K.K.K. 52. Bangalore: GKVK campus (Hebbal), 29.8.2008, S.K.K.K. 58. Ramanagaram: Near Savanadurga hills, 14.9.2008, S.K.K.K. 63. Chitradurga: Holalkere (Railway station), 13.11.2008, S.K.K.K.81. Gadag: Gadag Railway station, 24.12.2008, S.K.K.K. 84. Bagalkot: Aihole temple garden, 25.12.2008, S.K.K.K. 88. Bijapur: Near Almatti, 25.12.2008, S.K.K.K. 90. Tumkur: Gubbi (on paddy field bund), 3.8.2009, S.K.K.K. 93. Dharwad: Dharwad agriculture university campus, 4.8.2009, S.K.K.K. 96. Haveri: Near Haveri town, 5.8.2009, S.K.K.K. 99. Kolar: Road sides near Narsapura, 4.10.2009, S.K.K.K. 107. Raichur: Near Raichur Railway station, 25.10.2009, S.K.K.K. 109. Gulbarga: Gulbarga town, 8.11.2009, S.K.K.K. 113. Type specimen examined (microfiche): Ghana, Schumacher & Thonning [isotype, fragment and drawings (Kew)]. Notes: Phyllanthus amarus somewhat resembles P. fraternus in gross morphology. This might be the reason for treating this species as P. fraternus in some regional floras. HFP 271 (JCB) in flora of Hassan district, KFP 5913 (JCB) in flora of Karnataka and HGUG 198 in flora of Gulbarga district are treated as P. fraternus, but they actually belong to P. amarus. P. amarus is easily distinguished from P. fraternus by its usually oblong leaves with obtuse-mucronate tip, bisexual cymules in upper axils of branchlets, pentamerous calyx lobes and 5-lobed female disk. Some of the regional floras wrongly treated P. amarus as P. asperulatus, which does not occur in India. Rao 2095 (MGM) in the synoptic flora of Mysore district and SVR 893 and 924 in the flora of Bangalore district have treated this as P. asperulatus, but they actually belong to P. amarus. 52 Phyllanthus amarus originated in the Caribbean area as a vicarious species of P. abnormis of the Southern United States and has spread around the tropics by trading vessels (Webster, 1994). This species is distributed all over India and is considered as the most widely occurring species of Phyllanthus in India (Chaudhary and Rao, 2002). In Karnataka also, this is the most widely distributed species of Phyllanthus, especially in plains and coastal districts but rare in Western Ghats. This species is commonly associated with P. debilis in coastal regions and with P. maderaspatensis in plains. 2. Phyllanthus debilis Klein ex Willd., Sp. Pl. 4: 582. 1805; Webster in J. Arnold Arb. 38: 307. 1957 & Pacific Sci. 40: 104. 1986; Rani in K.M. Matthew, Fl. Tamilnadu Carnatic 3(2): 1466, 1983, p.p.; Mitra & Jain in Bull. Bot. Surv. India 27: 169, f. 2. 1987; Chakrab. & Balakr. in J. Econ. Taxon. Bot. Add. Ser. 9: 94. 1992 ; Chen & Wu in Taiwania 42: 252, f. 57-59, 78. 1997; Chaudhary & Rao in Phytotaxonomy 2: 150. 2002, p.p. (non Buch. Ham. Ex Hook.f. 1887 = P. airyshawii). P. niruri var. debilis (Willd.) Muell.-Arg. in DC., Prodr. 15(2): 407. 1866. P. mukerjeeanus Mitra & Bennet in Bull. Bot. Soc. Bengal 19: 145, f. 1.t.1. 1966. P. niruri auct. non L. 1753; Hook. f., Fl. Brit. India 5: 298. 1887, p.p. Erect annual herbs, 10-70 cm tall, often profusely branched, entirely glabrous; stem green or reddish brown, terete below, angular in upper part, with distinct normal leaves on lower nodes when young, becoming leafless and woody at maturity. Cataphylls 1-1.5 mm long, narrowly lanceolate, acuminate. Leaf-bearing branchlets 210 cm long. Stipules 1.5-2.0 mm long, triangular-lanceolate, acuminate at tip, entire or sometimes irregularly wavy along margins, membranous to thick, sometimes reddish along midrib region. Leaves distichous, narrowly elliptic or obovate, cuneate or acute at base, entire and occasionally reddish along margins, obtuse or acute at apex, 4-20 × 2-5 mm, membranous to chartaceous, mid rib and lateral veins prominently visible beneath; petioles 1.2-1.5 mm long, light green or reddish. Cymules unisexual, proximal 3-4 nodes with 2-4 male flowers, distal nodes with solitary female flowers. Male flowers with minute pedicel; calyx lobes 6, arranged in 2 whorls of 3 each, the outer 3 larger, green with prominent scarious white margins, 0.4–0.6 mm long, obovate, obtuse to truncate at tip; disk glands 6, saucer-shaped with irregular margins; stamens 3, filaments almost connate and free at the apex, anthers 53 globose. Female flowers with 1-2 mm long pedicel; pedicels dilated at apex; calyx lobes 6, similar to that of male flowers in shape and arrangement, up to 1.5 mm long, with broad membranous margins and thickened green middle portion; disk shallowly 6-lobed; ovary subglobose, smooth and 3-celled; style 3, free spreading, appressed to the ovary, bifid about to the middle. Capsules ca. 2-3 mm in diameter, depressedglobose, smooth; seeds, ca. 1 mm long, trigonous, yellowish-brown, with 6-7 straight longitudinal ribs and many fine transverse striae on the back (Fig. 3.3). Flowering and fruiting: January to April in Western Ghats and coastal regions and rainy season onwards to till October in South-Eastern districts. Distribution: Common in coastal and Western Ghat regions. Rarely distributed in South-Eastern districts and absent in plains. Habitat: Grows as weed in moist shady places, stream or riverbanks, roadsides, fallow lands, agricultural fields, banana, arecanut and coconut plantations, etc. Specimens collected and examined: Mysore: Nanjanagud river bank, 20.8.2007, S.K.K.K. 6; Talkad (on the river bank), 25.12.2007, S.K.K.K. 23. North Kanara: Gokarna, 26.10.2007, S.K.K.K. 12. Mandya: Paschimavahini (Sreerangapattana), 28.11.2007, S.K.K.K. 16. Chikmagalur: Kigga (Sringeri), 26.1.2008, S.K.K.K. 25; Kigga (Sringeri), 26.1.2008, S.K.K.K. 26. Udupi: Uppunda (near Byndoor), 2.3.2008, S.K.K.K.32. South Kanara: Subramanya, 5.3.2008, S.K.K.K. 36. Bangalore: IISC campus, 29.8.2008, S.K.K.K. 56. Shimoga: Sampekatte (Hosanagar), 29.9.2008, S.K.K.K.68. Hassan: Sakaleshpur. 10.10.2008, S.K.K.K. 70. Kodagu: Bylukukppe (Kushalnagar), 1.11.2008, S.K.K.K. 76; Bhagamandala, 22,4,2009, S.K.K.K. 92. Kolar: Roadsides near Kolar on Bangalore- Kolar highway, 4.10.2009, S.K.K.K. 105. Type specimen examined (microfiche): India, Madras, Thanjor, Tranquebar, in rice fields, February 1799, Klein s.n. (B-Willd., syntypes- 3 sheets-Herb. Willd. 17898-B). Notes: Saldanha (1996) did not record this species from Karnataka region, even though it has been reported from Gulbarga (Singh, 1988) and Kodagu (Murthy and Yoganarasimhan, 1990). Our observation revealed that P. debilis reported from the Kodagu (KRK and SNY 3649) and Eastern Karnataka actually belongs to P. scabrifolius. Saldanha was right in expressing his doubts on the occurrence of this species from this region. Later, Chaudhary and Rao (2002) and Bhat (2003) reported this species from Shimoga and Udupi districts. Chaudhary and Rao (2002) say that it is found only in coastal areas. However, our field studies confirmed the occurrence of 54 this species in Ghats as well as coastal regions and even in South-Eastern districts (inland). This species is closely related to P. fraternus Webster. However, it appears to be sufficiently distinct by virtue of its leaf shape, nature of female calyx lobes, shape of female disk and lobing of style. Sometimes it grows in association with P. amarus, P. urinaria and P. virgatus. R.R. Rao 1318 (MGM), SNY 5719 (CCRAS), KFP 13993 and 13275 and HFP 1857 (JCB) specimens were wrongly identified as either P. fraternus or P. niruri. However, a close examination of these specimens by us revealed that they are actually P. debilis. 3. Phyllanthus maderaspatensis L., Sp. Pl. 982. 1753; Roxb., Fl. India 3: 654.1832; Wight, Ic. Pl. Ind. Orient. 5 (Pt. 2): 25; pl. 1895, f.3. 1852; Hook. f. in Hook. f., Fl. Brit. India 5: 292. 1887. Chaudhary & Rao in Phytotaxonomy 2: 153. 2002. Erect or decumbent herbs, 10-80 cm tall, stem slender, generally branched, woody at base, glabrous, branches terete below, striate and flattened, particularly at nodes towards apex. Cataphylls absent. Stipules 1-2 mm long, triangular-lanceolate, peltate at base, acuminate at apex, entire and membranous along margins and thickened in the middle region. Foliar leaves alternate, not distichous; petiole short, 1-2 mm long; leaf blade obovate or spatulate, cuneate at base, entire along margins, obtuse or rounded mucronate or sometimes retuse at apex, glaucous beneath, 10-30 × 4-10 mm, 4-5 pairs of nerves prominently visible on the upper surface. Cymules bisexual with 1-4 male flowers and 1 female flower in upper axils and unisexual with solitary female flowers in lower axils. Male flowers minute with short pedicels; calyx lobes 6 in 2 whorls of 3 each, about 2 mm long, obovate, membranous; stamens 3, filaments completely connate into a column; anthers subsessile; disk glands 6, almost rounded, flat or slightly concave. Female flowers with ca. 1 mm long pedicels, extending to 1.5-2 mm in fruits; pedicels filiform but thickened at apex; calyx lobes 6, biseriate (distinctly visible in young flowers), unequal, rhomboid, rhomboid-obovate or spatulate with acute, subobtuse, obtuse or rounded apex, green and thickened except narrow white membranous margins; disk 6-lobed; styles 3, free or slightly fused at base, spreading and minutely bilobed at tip. Capsule 2-3 mm in diameter, depressedglobose, smooth; seeds 1-1.5 mm long, triquetrous, brown, with concentric lines of minute tubercles and minute crossbars (Fig. 3.4). 55 56 57 58 Flowering and fruiting: Almost throughout the year, but peaks during rainy season. Distribution: Common in plain districts and does not grow in coastal and Western Ghat regions. Habitat: Common weed of waste places, garden lawns and cultivated fields in moist and shady places and prefers black cotton soil. Specimens collected and examined: Mysore: Manasagangotri campus, 24.7.2007, S.K.K.K. 1. Mandya: Pandavapura, 28.11.2007, S.K.K.K. 18. Chikmagalur: Birur, 1.5.2008, S.K.K.K. 38. Shimoga: Badravathi, 2.5.2008, S.K.K.K. 39. Chamarajnagar: Yelandur, 20.6.2008, S.K.K.K. 42. Hassan: Holenarasipura, 15.7.2008, S.K.K.K. 45. Bellary: Hampi (Scrub forest), 1.8.2008, S.K.K.K. 49. Davanagere: Davanagere town (near Avaragere), 14.8.2008, S.K.K.K. 53. Bangalore: Kengeri (Road side), 29.8.2008, S.K.K.K. 62. Ramanagaram: Near Ramanagaram hills, 15.9.2008, S.K.K.K. 65. Chitradurga: Near Chitradurga fort, 12.11.2008, S.K.K.K.79. Gadag: Gadag Railway station, 24.12.2008, S.K.K.K. 85. Bagalkot: Bagalkot town, 25.12.2008, S.K.K.K. 89. Bijapur: Muddebihal, 25.12.2008, S.K.K.K. 91. Tumkur: Huliyaru, 3.8.2009, S.K.K.K. 94. Dharwad: Dharwad agriculture university campus, 4.8.2009, S.K.K.K. 95. Haveri: Ranebennur, 5.8.2009, S.K.K.K. 100. Kolar: Road sides near Mulbagil, 4.10.2009, S.K.K.K. 108. Raichur: Near Raichur Railway station, 25.10.2009, S.K.K.K. 110. Gulbarga: Out skirts of Gulbarga, 8.11.2009, S.K.K.K. 115. Specimens examined (Herbaria): Mysore: Manasagangotri botanical garden, R.R. Rao 4 (MGM) and M. M. Hills, R.R. Rao 2091 (MGM); Bangalore: Bangalore, SVR 617 and Govindu 83 (HBUB); Gulbarga: Gulbarga, HGUG 199 (HGUG); Hassan: CJS 11937 (JCB). Notes: Phyllanthus maderaspatensis is a very distinct species and can be easily recognized by its non-phyllanthoid branches, alternate non-distichous leaves, obovatemucronate leaf shape, rhomboid-obovate shape of female calyx lobes and tuberculate seeds. Common weed in plain districts and does not grow in coastal and Western Ghats. Often grows in association with P. amarus. 4. Phyllanthus virgatus G. Forst. Fl. Ins. Austr. 65. 1786; Airy Shaw in Kew Bull. 26: 325. 1972 & 37: 34. 1982. Chen & Wu in Taiwania 42: 259, f. 75-77. 1997. 59 Chaudhary & Rao in Phytotaxonomy 2: 159. 2002. P. simplex var. virgatus (Forst. f.) Muell.-Arg. in Linnaea 32: 32. 1893. P. simplex Retz., Obs. Bot. 5: 29. 1789; Roxb., Fl. Ind. 3: 655. 1832; Hook. f., Fl. Brit. India 5: 295. 1887. P. simplex var. genuinus Muell.-Arg. in DC., Prodr. 15: 391. 1866. Macraea oblongifolia Wight., Ic. Pl. Ind. Orient. 5(2): 27, pl. 1902. f.1. 1852. P. simplex var. oblongifolia (Wight) Muell.-Arg. in Linnaea 32: 32. 1863. Procumbent to erect annual or perennial herbs or sometimes suffruticose, up to 60 cm tall; stem simple or branched (profusely spreading, many branches from base in prostrate-caespitose plants), branchlets angled or winged, glabrous. Cataphylls absent. Stipules 0.5-1 mm long, reddish-brown, ovate-triangular, peltate, subsagitate at base, entire along margins, subacuminate at apex. Leaves alternate, distichous, subsessile; leaf lamina 5-30 × 2-4 mm, leathery, linear or oblong-elliptic, subcordate or rounded at base, obtuse to acute or apiculate at apex, glabrous, lateral veins 5-7 pairs, indistinct to sometimes distinct; petioles 0.5 mm long, glabrous. Cymules bisexual with 1-2 male and 1 female flowers in upper axils and unisexual with solitary female flower in lower axils. Male flowers minute; calyx lobes 6, white to purplish, membranous, obovate, rounded at apex; disk glands 6, orbicular to almost round; stamens 3, filaments free. Female flowers with 3.5-10 mm long (after anthesis) pedicel; pedicels thickened and angled at apex, reddish below and greenish above; calyx lobes 6, ovateoblong, reflexed, purple with whitish membranous margin, persistent in fruit; ovary warty; styles 3, free, spreading, recurved and adpressed to the surface of fruit, bilobed at apex; disk flat, undivided. Capsule long-stalked, depressed-globose, 2.5-3 mm in diam., densely warty (tubercled) in young condition, smooth at maturity; seeds 1.2-2 × 1 mm, trigonous, brown, minutely tubercled, tubercles arranged in several vertical concentric rings (Fig. 3.5). Flowering and fruiting: Almost throughout the year in coastal and plain districts, abundant during rainy season. In Western Ghats, flowering starts at the end of rainy season and fruiting completed in December. Distribution: Throughout Karnataka, but less common in plain districts of Northern Karnataka. Habitat: Grasslands, open grassy areas on roadsides, rocky areas (lateritic), in deciduous and scrub forests. 60 61 Specimens collected and examined: Mysore: Chamundi hills, 10.8.2007, S.K.K.K. 3. North Kanara: Yana (Sirsi), 24.10.2007, S.K.K.K. 10. Mandya: Karighatta (Sreerangapattana), 28.11.2007, S.K.K.K. 21. Chikmagalur: Kigga (Sringeri), 26.1.2008, S.K.K.K. 24. Udupi: PPC campus, 1.3.2008, S.K.K.K.28. South Kanara: Near Mangalore, 4.3.2008, S.K.K.K. 33. Hassan: Doddakadanur scrub forest, 15.7.2008, S.K.K.K. 46. Bellary: Yashwanthnagar, 2.8.2008, S.K.K.K. 50. Davanagere: Near Harapanahalli, 15.8.2008, S.K.K.K. 54. Bangalore: GKVK campus (Hebbal), 29.8.2008, S.K.K.K. 57. Ramanagaram: Hill near Ramanagaram, 15.9.2008, S.K.K.K. 66. Shimoga: Kodachadri hills (Hosanagar), 29.9.2008, S.K.K.K. 69. Chamarajnagar: Attikan (on grassy hill tops), 19.10.2008, S.K.K.K. 74. Kodagu: Madikeri, 1.11.2008, S.K.K.K. 77. Chitradurga: Near Chikkajajur (Scrub jungle), 13.11.2008, S.K.K.K.82. Gadag: Near Hole Alur, 24.12.2008, S.K.K.K. 86. Dharwad: Dharwad agriculture university campus, 4.8.2009, S.K.K.K. 98. Tumkur: Devarayanadurga hill, 1.10.2009, S.K.K.K. 103. Kolar: Narsapura, 4.10.2009, S.K.K.K. 106. Raichur: Devadurga, 26.10.2009, S.K.K.K. 111. Gulbarga: Gulbarga out skirts, 8.11.2009, S.K.K.K. 114. Bagalkot: Near Badami (Scrub forest), 15.12.2011, S.K.K.K. 118. Specimens examined (Herbaria): Adyar (Tamil Nadu), Gamble 17638 (MH); Mysore: Chamundi hills, R.R. Rao 9 (MGM); Chamarajnagar: Attikan, R.R. Rao 983 and M.M. Hills, R.R. Rao 6107 (MGM); Hassan: Gendekal reserve forest, CS 8964 (JCB); Gulbarga: Gulbarga, HGUG 1296. Notes: In coastal and plain districts, P. virgatus grows as a procumbent perennial herb with profuse branches from base and has shorter leaves. However, in Western Ghats it is actually an erect annual and rarely (1 or 2) branched with longer leaves. Phyllanthus virgatus can be easily identified by its non-phyllanthoid branches, linear or oblong-elliptic leaves, longer female pedicels (3.5-8 mm long), tuberculate ovary and young fruits and distinctly tuberculate seeds. However, it is often confused with closely related species, P. gardnerianus (Wight) Baillon. Same thing happened in the flora of Chikmagalur by Yoganarasimhan et al. (1981). They identified the herbarium specimen, Simhan 1556 (CCRAS) as P. virgatus instead of P. gardnerianus. 62 5. Phyllanthus urinaria L., Sp. Pl. 982. 1753; Roxb., Fl. Ind. 3: 660. 1832; Hook. f. in Hook. f., Fl. Brit. India 5: 293. 1887; Webster in J. Arnold. Arb. 38: 194, f. 9. 1957 & Brittonia 22: 65. 1970; Airy Shaw in Kew Bull. 26:325. 1972. Chaudhary & Rao in Phytotaxonomy 2: 158. 2002. P. leprocarpus Wight, Ic. Pl. Ind. Orient. 5(2): 25, pl. 1895, f. 4. 1852. Erect or sometimes procumbent annual herbs, 10-100 cm tall; stem woody at base, simple or branched, sometimes profusely branched from the base, terete below and flattened and winged towards apex, acutely ridged at nodes throughout, glabrous to pubescent; hairs only on ridges, spreading. Cataphylls 1.5-2 mm long, ovatelanceolate, acuminate to aristate at tip. Stipules ca. 1 mm long, membranous, greenish or pinkish, triangular-lanceolate, auriculate at base, acuminate-aristate at apex, entire along margins. Leaves variable in size, distichous; lamina 10-17 x 2-6 mm, oblong or linear-oblong, sometimes slightly falcate, obtuse with distinctly mucronate at tip, base unequal sided, hispidulous along margins and intramargins, usually green or sometimes reddish below and green above, occasionally reddish only along margins and apical region, veins raised below and looped close to the margin; petiole short and compressed. Cymules unisexual with solitary female flower in lower axils and 1-3 male flowers in upper axils. Male flowers with minute pedicels; calyx lobes 6, yellowish-white, elliptic-oblong, apex rounded; disk glands 6, cuneate with irregular margins; stamens 3, filaments completely united into a slender column, anthers sessile and erect. Female flowers with minute pedicel; pedicels green or reddish, becoming thickened in fruiting; calyx lobes 6, about 1 mm long, narrowly oblong, obtuse or rounded at apex, with broad, yellowish-white, membranous margins and slightly thickened, green or reddish midrib region; disk 6-lobed; ovary distinctly tuberculate; styles 3, free, deeply lobed at tip, lobes recurved; capsules 2-3 mm in dia., depressedglobose, prominently tuberculate, green or reddish; seeds 1 mm long, trigonous, brown, with 12-15 prominent transverse ridges and with faint cross bars on the rounded back side (Fig. 3.6). Flowering and fruiting: Throughout the year, but luxuriant during rainy season. Distribution: Common in Western Ghats and coastal regions, less common in drier plains. Habitats: Grows on river or stream banks, agricultural fields, forest margins, gardens, wastelands and roadsides. 63 Specimens collected and examined: Mysore: Nanjanagud river bank, 20.8.2007, S.K.K.K. 7. Kodagu: Makutta Ghat (Virajpet), 10.9.2007, S.K.K.K. 8. North Kanara: Syntheri rock, 25.10.2007, S.K.K.K. 11. Mandya: Paschimavahini (Sreerangapattana), 28.11.2007, S.K.K.K. 17. Chikmagalur: Kigga (Sringeri), 26.1.2008, S.K.K.K. 27. Udupi: Near Sri Krishna temple, 1.3.2008, S.K.K.K.29. South Kanara: Dharmasthala, 4.3.2008, S.K.K.K. 35. Bellary: Donimalai forest, 2.8.2008, S.K.K.K. 51. Davanagere: Ucchangidurga, 15.8.2008, S.K.K.K. 55. Bangalore: Lalbag garden, 29.8.2008, S.K.K.K. 61. Shimoga: Agumbe Ghat, 28.9.2008, S.K.K.K. 67. Hassan: Shiradi Ghat (Sakaleshpur), 10.10.2008, S.K.K.K. 71. Chamarajnagar: On the way to Attikan from Bedguli, 19.10.2008, S.K.K.K. 73. Tumkur: Devarayanadurga forest, 1.10.2009, S.K.K.K. 104. Type specimen examined (microfiche): Ceylon, Herb. Hermann (holotype: BM). Specimens examined (Herbaria): Mandya: Paschimavahini, R.R. Rao 812 (MGM & JCB); Gulbarga: Gulbarga, HGUG 1259; Hassan: CJS 14780 and HFP 322 (JCB). Notes: Phyllanthus urinaria is a very distinct species with conspicuously tuberculate ovary and fruits, transversely ridged seeds and leaves sensitive, unequal at base and hispidulous on margins; often grows in association with P. amarus, P. debilis, P. urinaria and P. virgatus especially in coastal areas. This species shows enormous morphological variations, mainly in diffuse to erect habit, colour of the stem and leaves (green or red), shape, size and apex of leaves. 6. Phyllanthus scabrifolius Hook. f. in Fl. Brit. India. 5: 299. 1887; Cooke, Fl. Pres. Bombay. 3: 84. 1967 (repr. ed.); Chaudhary & Rao, Phytotaxonomy. 2: 155. 2002; Murugan et al., Current Science. 91: No. 7, 870. 2006. Diasperus scabrifolius (Hook.f) Kuntze, Revis. Gen. Pl. Erect annual herb, up to 75 cm tall; stem terete below, angular above; branches winged, dentate, hispidulous. Cataphylls 2 mm long, narrowly triangular, lanceolate, acuminate, midrib greenish to pinkish, margin minutely dentate. Stipules 1-1.5 mm long, greenish to pinkish, triangular-lanceolate, acuminate, margin dentate to serrate. Leaf blade 8-20 × 5-10 mm, broadly elliptic or obovate, cuneate or rounded at base, margin entire, acute to acuminate or occasionally mucronate at apex, densely scaberulous below, sparsely scaberulous above, midrib raised on both surfaces, lateral veins 4-6 pairs; petioles up to 1.5 mm long. Cymules both unisexual and bisexual, 64 proximal 3-4 nodes with solitary male flowers, succeeding nodes with 1-2 male flowers and 1 female flower and distal nodes with solitary female flowers. Male flowers minute; pedicel 1 mm long, slightly angled; calyx lobes six, membranous, biseriate, unequal, outer lanceolate, acute, inner ovate-obovate or obtuse, acute to rounded; stamens 3, filaments connate up to middle, free and spreading above; disk glands 6, saucer-shaped with irregular margins. Female flowers with 2 mm long angular, hispidulous pedicel; calyx lobes six (very rarely 7), biseriate, unequal, enlarged and reflexed after fruiting, greenish, broadly thickened in midrib region, narrow membranous along margins, hispidulous outside, particularly in thickened region, outer ones linear-obovate, acute, inner linear-obovate, subobtuse; disk rounded with irregularly lobed margin; styles 3, free, recurved from base, distinctly bilobed. Capsule 5 mm across, depressed-globose, minutely puberulous; seeds 1-2 mm long, trigonous, brownish with 6-8 straight longitudinal lines and many transverse striae on the back (Fig. 3.7). Flowering and fruiting: June to December. Distribution: Throughout the plain districts, almost absent in Western Ghats and coastal regions. Habitat: Found growing in the undergrowth of forests, moist shaded places, below rock boulders, open places and grasslands. More common in dry, gravelly soil in hill slopes. Specimens collected and examined: Mysore: Chamundi hills, 10.8.2007, S.K.K.K. 4. Mandya: Melukote forest, 10.11.2007, S.K.K.K. 14; Kunthi betta (Pandavapura), 28.11.2007, S.K.K.K. 20. Chamarajnagar: K. Gudi, 20.6.2008, S.K.K.K. 44; Punjur Ghat, 19.10.2008, S.K.K.K. 72. Bangalore: Lalbag Garden, 29.8.2008, S.K.K.K. 59. Ramanagaram: Savanadurga hill top, 14.9.2008, S.K.K.K. 64. Chitradurga: Chitradurga fort hill top, 12.11.2008, S.K.K.K. 80. Davanagere: Soolekere hills, 13.11.2008, S.K.K.K. 83. Bagalkot: Hills near Badami, 24.12.2008, S.K.K.K. 87. Dharwad: Dharwad agriculture university campus, 4.8.2009, S.K.K.K. 97. Tumkur: Devarayanadurga hill, 1.10.2009, S.K.K.K. 102. Raichur: Devadurga, 26.10.2009, S.K.K.K. 112. Kodagu: Thithimathi forest, 26.4.2010, S.K.K.K. 116. Bellary: Yashwanthnagar, 30.8.2011, S.K.K.K. 117. Type specimen examined (microfiche): India, Malabar, Concan, Herb. Ind. Or., Stocks, Law 12 (Kew). 65 66 67 Notes: Phyllanthus scabrifolius can be easily differentiated by its winged and hispidulous branches, scaberulous leaves and narrow membranous margins of female calyx lobes. B.D. Naithani 21193 (MH), R.R. Rao 11 (MGM), KFP 2760, 2180, 4417 and 2134 (JCB), Y.S. Maheshwarappa 49 (MGM) specimens bear the name of very closely related species, P. rheedei. However, they actually belong to P. scabrifolius. Phyllanthus scabrifolius is very close to P. kozhikodianus Siv. & Mani. (Chaudhary and Rao, 2002). However, Gangopadhyay et al. (2004) treated P. kozhikodianus as a synonym of P. rheedei Wight. Close observation of P. scabrifolius from different parts of Karnataka revealed that morphologically it is very similar to P. rheedei. Morpholgical characters of both P. scabrifolius and P. rheedei have been listed in table 3.1. Table 3.1. Morpholgical characters of P. scabrifolius and P. rheedei Characters P. scabrifolius Stem shape Terete below and angular above Cataphyll shape Triangular-lanceolate, acuminate Stipule shape Triangular-lanceolate, acuminate Leaf Flowers Male calyx lobes Stamens Filaments Male disc glands Female calyx lobes Female disc Styles Capsule Seed Broadly elliptic or obovate, cuneate or rounded at base, margin entire, acuteacuminate or mucronate at apex, scaberulous Cymules both unisexual and bisexual, proximal 3-4 nodes with 1 male flowers, succeeding nodes with 1-2 male flowers and 1 female flowers and distal nodes with 1 female flowers 6, membranous, biseriate, unequal, outer lanceolate, acute, inner ovate-obovate or obtuse, acute to rounded 3 Connate up to middle, free and spreading above 6, saucer-shaped with irregular margins 6 (rarely 7), biseriate, unequal, enlarged and reflexed after fruiting, greenish, broadly thickened in midrib region, narrow membranous along margins, outer ones linear-obovate, acute, inner linear-obovate, subobtuse Rounded with irregularly lobed margin 3, free, recurved, distinctly bilobed 5 mm across, depressed-globose, minutely puberulous 1-2 mm long, trigonous, brownish with 6-8 straight longitudinal lines and many transverse striae on the back P. rheedei Terete below, flat and striate towards apex Linear-lanceolate, acuminate Triangular-lanceolate, acuminate at apex Elliptic-obovate, cuneate at base, entire along margins, acute at apex, glabrous Cymules both unisexual or bisexual, consisting of 1-3 male, 12 male + 1 female (proximal axils) and/or 1 female flowers at apex 6 (3+3), ovate-elliptic or ellipticoblong, acute to subobtuse at apex, membranous 3 Connate below for about halfway to 2/3, free, divergent above 6, minute, roundish, deeply lobed or stellate, granular 6 (3+3), almost cover the fruit, ovate-oblong or obovate, acute or subacute at apex, with narrow white membranous margins and thickened remaining portion Annular, thin, deeply lobed 3, free, shortly to deeply bifid 6-8 mm across, oblate, smooth 2 mm long, trigonous, brown, 6-7 ribs on back with transversely striations 68 From the above list, it is evident that there are quite a number of morphological similarities between P. scabrifolius and P. rheedei. Therefore, merger of these two species is suggested to clear the confusion and the molecular studies may throw light on their relationships. Phyllanthus scabrifolius is a rare and endemic species, so far reported only from Maharashtra, Madhya Pradesh and Karnataka (Hooker, 1887; Cooke, 1901-08; Chaudhary and Rao, 2002; Murugan et al., 2006). Curiously, Cooke (1901-08) stated that there is only one specimen of this species in Kew, whereas Chaudhary and Rao (2002) reported this species from Madhya Pradesh based on solitary collection in LWG. While reporting a new distribution record for Karnataka, Murugan et al. (2006) observed only one population of this species consisting of about 25 plants on a dry, gravely hilly slope near Amingad village, Bagalkot district and they also indicated that this species may occur in similar habitats. Incidentally, a few populations of P. scabrifolius were observed during course of this study in Bangalore, Ramangaram, Mandya, Mysore, Chamarajanagar, Tumkur, Chitradurga, Davanagere, Bellary, Raichur, Bagalkot, Dharwad and Kodagu districts of Karnataka in similar habitats. These observations extend its distribution in Southern Peninsular India. Wherever this species grows, its population size is very small. Therefore, efforts should be taken to conserve this rare species. 7. Phyllanthus tenellus Roxb., Fl. Ind. 3: 668. 1832; Muell.-Arg. In DC Prodr. 15: 338. 1866; Hook. f. in Hook. Ic. Pl. 1569. 1887; Webster in J. Arnold Arb. 38: 52, f. 6. 1957; Mitra in Bull. Bot. Surv. India 27: 154, f. 1. 1985 (1987); Chen & Wu in Taiwania 42: 254, f. 3, 69-71, 79. 1997; Tandyekkal & Ramla in J. Eco. Tax. Bot. 21 (3): 733. 1997; Chaudhary & Rao in Phytotaxonomy 2: 157. 2002. Erect annual herbs, 10-75 cm tall; stem terete, smooth, glabrous, branched from the base, branches puberulous towards apex. Cataphylls 1-1.5 mm long, linearlanceolate, aristate, with membranous narrow margins and slightly thickened, reddish middle region. Stipules ca. 1-1.2 mm long, triangular-lanceolate, aristate or more acuminate at tip, with entire, narrow membranous margins, greenish white or reddish along middle region. Leaf blade 6-25 × 3-10 mm, membranous, elliptic or obovate, acute to rounded at the base, entire along margins, acute or obtuse at the apex, lower surface paler, lateral veins 5-6 pairs; petioles 0.5-0.8 mm long. Cymules both bisexual 69 and unisexual; proximal 2 or 3 nodes with 1-3 male flowers, succeeding nodes with 1 male and 1 female flower or 1 male and 2 female flowers or 2 male and 1 female flowers and distal most nodes with solitary female flowers. Male flowers minute with very small pedicels; calyx lobes 5, membranous, broadly obovate; stamens 5, alternate with disk glands; filaments free; disk glands 5, broadly cuneate with irregular margins. Female flowers with 5-8 mm long (after anthesis) pedicel; pedicels filiform, reddish below, thickened, angular, greenish at apex; calyx lobes 5, 0.5-0.8 mm long, ovate, acute at tip, thickened, broad, greenish or sometimes reddish along midribs region, membranous along margins; disk patelliform, fleshy but thin, with undulate margins; styles 3, free, spreading, adpressed to the surface of fruit, distinctly bifurcate up to 2/3 length with divaricate arms. Capsule ca. 1.5 mm in diam., depressedglobose, smooth; seeds trigonous, 0.8-1 mm long, brown, minutely tuberculate in longitudinal rows on back (Fig. 3.8). Flowering and fruiting: Flowering is luxuriant during rainy season, but in favorable conditions flowering is seen throughout the year. Distribution: Bangalore, Mysore, Kodagu, Udupi and Chikmagalur. Introduced weed, but now well naturalized. Habitat: In garden lawns, planted pots, under hedges and in shady and moist soils. Specimens collected and examined: Mysore: Biotechnology Department Garden (MGM), 14.8.2007, S.K.K.K. 5. Udupi: Near Sri Krishna temple, 1.3.2008, S.K.K.K.30. Chikmagalur: Horanadu temple Garden, 3.5.2008, S.K.K.K. 41. Bangalore: Lalbag garden, 29.8.2008, S.K.K.K. 60. Kodagu: Raja Seat (Madikeri), 1.11.2008, S.K.K.K. 78. Type specimen examined: Botanical Garden, Kolkata, Wallich 7892A exp. [Holotype (Kew)]. Notes: Superficially, P. tenellus resembles P. rheedei Wt. However, it can be easily separated from the latter by its distinctly longer female pedicels, particularly after anthesis, and male flowers with five completely free stamens. It seems the species has colonized in many areas, but has been missed by Botanists. KFP 13797 (JCB) in flora of Karnataka reported as P. amarus by Saldanha (1996), but it is actually P. tenellus. Although the herbaceous Phyllanthus species studied so far closely resemble each other, there are distinct morphological characters to maintain their separate taxonomic identity. Morphological distinctions of these species are listed in table 3.2. 70 71 Table. 3.2. Morpholgical characters of herbaceous Phyllanthus species Character Stem shape Cataphyll Stipule shape Leaf shape Leaf tip Leaf base Flowers Male calyx lobes Stamens P. amarus Terete Present Triangularlanceolate Oblong or ellipticoblong Obtuse and shortly mucronate Obtuse or rounded Unisexual and bisexual cymules Five (very rarely six) Three P. debilis P. maderarpatensis P. virgatus Terete below and angular above Terete below and striate and flattened above Angular or winged Present Triangularlanceolate Narrowly elliptic or obovate Obtuse acute or Cuneate or acute Absent Triangularlanceolate Obovate spatulate or Obtuse rounded mucronate or Cuneate Absent Ovatetriangular Linear or oblongelliptic Obtuse acute or apiculate Subcordate or rounded Unisexual and bisexual cymules P. urinaria Terete below, flattened and winged above Present Triangularlanceolate Oblong or linearoblong Obtuse with distinct mucronate Unequal Unisexual cymules P. scabrifolius P. tenellus Terete below and angular above Terete Present Triangularlanceolate Broadly elliptic or obovate Present Triangularlanceolate Elliptic or obovate Acute acuminate Acute Cuneate or rounded Unisexual and bisexual cymules Acute to rounded Unisexual and bisexual cymules Unisexual cymules Unisexual and bisexual cymules Six Six Six Six Six Five Three Three Three Three Five Completely connate Free Completely connate Three Connate up to middle, free and spreading above 6, cuneate with irregular margins Filaments Completely connate Almost connate and free at the apex Male disk glands 5, saucershaped with irregular margins 6, saucershaped with irregular margins 6, almost rounded 6, orbicular to almost round Female calyx lobes Five (very rarely six) Six and unequal Six and unequal Six Six Female disk flat, deeply 5-lobed shallowly 6-lobed 6-lobed Flat, undivided 6-lobed Depressedglobose smooth and Depressedglobose, densely warty (tubercled) in young condition, smooth at maturity Depressedglobose, prominently tuberculate Depressedglobose, minutely puberulous Depressedglobose and smooth Triquetrous with concentric lines of minute tubercles and minute crossbars Trigonous, minutely tubercled, tubercles arranged in several vertical concentric rings Trigonous with 12-15 prominent transverse ridges and with faint crossbars on the rounded back side Trigonous with 6-8 straight longitudinal lines and many transverse striae on the back Trigonous, minutely tuberculate in longitudinal rows on back Capsule Seed Globose and smooth Trigonous with 6-7 straight parallel longitudinal ribs on back Depressedglobose and smooth Trigonous with 6-7 straight longitudinal ribs and many fine transverse striae on the back 6, saucershaped with irregular margins Six (rarely seven) and unequal Rounded with irregularly lobed margin Free 5, broadly cuneate with irregular margins Five Patelliform, fleshy with undulate margins Based on distinct morphological characters, especially taking into account the shape of the leaf, a simple key for authentic taxonomical identification of herbaceous Phyllanthus species has been developed. 72 73 3.3.2 Molecular authentication The ITS regions of DNA were sequenced for nine different herbaceous species of Phyllanthus by using ITS 1 and ITS 4 primers (5' TCCGTAGGTGAACCTGCGG 3' and 5' TCCTCCGCTTATTGATATGC 3'). These primers amplified the ITS1, 5.8S and part of the ITS2 region (Fig. 3.9). Fig. 3.9: Amplified DNA ITS regions of Phyllanthus species. Lane M. λ DNA, 1. P. amarus, 2. P. debilis, 3. P. maderaspatensis, 4. P. virgatus, 5. P. urinaria, 6. P. scabrifolius, 7. P. rheedei, 8. P.kozhikodianus, 9. P. tenellus. The PCR amplified products were purified from excess salts and primers and then sequenced. Generated sequences were checked for orthology by comparing them with the existing sequences in the NCBI (National Centre for Biotechnology Information) database. Except for P. scabrifolius, P. rheedei and P. kozhikodianus, other six herbaceous Phyllanthus species sequences matched with the already existing sequences. Generated ITS sequences of nine different herbaceous species of Phyllanthus were submitted to GenBank database and accession numbers were obtained (Table 3.3). For the first time ITS sequences were generated for P. scabrifolius and P. kozhikodianus. Although there are few P. rheedei ITS sequences are present in NCBI database, the ITS sequence generated for P. rheedei in the present study did not match with them. 74 Multiple alignments were performed using multalign. It clearly differentiated the related Phyllanthus species although close similarities were observed among P. scabrifolius, P. rheedei and P. kozhikodianus (Fig. 3.10) Table 3.3. Voucher and accession numbers of herbaceous Phyllanthus species Phyllanthus speicies Voucher No. Matching sequence accession no. in NCBI AY936668. 1 AY936686. 1 AY936707. 1 AY831635. 2 GenBank accession No. of submitted sequence P. amarus SKKK 2 P. debilis SKKK 6 P. maderaspatensis SKKK 1 P. virgatus SKKK 3 P. urinaria SKKK 7 AB550081.1 KF312393 P. scabrifolius SKKK 4 ------------ KF003023 P. rheedei SKKK 75 ----------- KF312394 P. kozhikodianus SKKK 101 ------------ KF312395 P. tenellus SKKK 5 AY936733. 1 KF312396 Primer sequence KF312389 KF312390 KF312391 KF312392 5'TCCGTAGGTG AACCTGCGG3' 5'TCCTCCGCTTA TTGATATGC3' Finally, the dendrogram was constructed using ClustalW2 software (Fig. 3.11). It clearly formed three clusters. Cluster I consists of Phyllanthus species, which are generally included in ‘Bhumyamalaki’ complex. Morphologically very closely related species P. scabrifolius, P. rheedei, P. kozhikodianus and P. tenellus are nested in cluster II. P. virgatus, morphologically a distinct species, formed an out group. 75 Fig. 3.10: Multiple alignment of Phyllanthus species ITS sequences. 1. P. amarus, 2. P. debilis, 3. P. maderaspatensis, 4. P. virgatus, 5. P. urinaria, 6. P. scabrifolius, 7. P. rheedei, 8. P. kozhikodianus, 9. P. tenellus. 76 Fig. 3.11: Dendrogram of Phyllanthus species generated based on ITS sequence homology by ClustalW2. 3.4 Discussion Most of the taxonomic keys are generally highly technical and so very exhaustive that they are suitable for advanced scientific studies but are beyond the comprehension of non-scientific users. Therefore, keys for nonprofessional with minimal technical details should either be developed or abridged from elaborate ones (Kandavel et al., 2011). Present study attempted to achieve this goal. The key characters presented here to a large extent can be examined with naked eye and does not need any laboratory instruments or techniques. Intentionally, number of female calyx lobes taken as a major distinguishing character since female calyx persists even in fruit. Along with the number of stamens, nature of filaments and fruits, key is mainly focused on the shape of leaf. For easy identification of related herbaceous Phyllanthus species, leaf photographs of each species are given along with key characters. Phyllanthus amarus can be easily distinguished from other members of ‘Bhumyamalaki’ or ‘niruri complex’ by its unique characteristics of oblong leaves with obtuse-mucronate tip and 5-lobed female calyx. P. tenellus also has 5-lobed female calyx. That may be the reason why Saldanha (1996) confused the characters of 77 P. tenellus with P. amarus in flora of Karnataka. However, P. tenellus is distinct in having five free stamens and elliptic leaves. Other herbaceous Phyllanthus species have 6-lobed female calyx. P. urinaria is distinct in having oblong leaves with unequal base and obtuse mucronate tip, hispidulous leaf margins and prominently tuberculate fruits. P. virgatus has linear or oblong-elliptic leaves with subcordate base and long-stalked and slightly tuberculate fruits, at least in young condition. However, it is often confused with closely related species, P. gardnerianus (Wight) Baillon., as is the case in the flora of Chikmagalur by Yoganarasimhan et al. (1981). P. maderaspatensis is quite different from the rest in having obovate or spatulate leaves with obtuse or rounded mucronate tip and unequal female calyx lobes with rhomboidobovate shape. P. debilis and P. scabrifolius share a few morphological characters. That might be the reason for inclusion of P. debilis from Gulbarga and Kodagu instead of P. scabrifolius (Singh, 1988; Murthy and Yoganarasimhan, 1990). However, leaf shape and union of staminal filaments can differentiate them. Leaves of P. debilis are narrowly elliptic or obovate with obtuse or acute apex, whereas P. scabrifolius has scaberulous and broadly elliptic or obovate leaves with acuteacuminate apex. Staminal filaments of P. debilis are almost connate and free only at the apex, whereas P. scabrifolius staminal filaments connate up to middle, free and spreading above. Present field studies and observation of herbarium specimens revealed that P. fraternus is not available in Karnataka. Earlier reports of this species from Hassan (Saldanha and Nicolson, 1976), Gulbarga (Seetharam et al., 2000) and Bellary (Saldanha, 1996) are due to wrong identification of specimens. These specimens are actually belonging to P. amarus. Same thing happened to P. asperulatus in flora of Bangalore and Mysore (Ramaswamy and Razi, 1973; Rao and Razi, 1981). They wrongly treated the P. amarus as P. asperulatus, which does not occur in India. Saldanha’s (1996) doubt regarding the occurrence of P. debilis Klein ex willd., from Gulbarga and Kodagu has been solved. Reported specimens actually belong to P. scabrifolius. Chaudhary and Rao (2002) mentioned P. debilis is distributed only in coastal areas. However, our field studies confirmed the occurrence of this species in ‘Ghats’ along with coastal regions and even in South-Eastern districts (inland) of Karnataka. Close observation of P. scabrifolius from different parts of Karnataka revealed that morphologically it is very similar to P. rheedei. Earlier reports of 78 P. rheedei from Bangalore and Mysore (Ramaswamy and Razi, 1973; Rao and Razi, 1981) has been misidentified for P. scabrifolius. Probably that was the reason for noninclusion of this species distribution in Karnataka by Chaudhary and Rao (2002). In the present study, P. rotundifolius Klein ex willd. from Biligirirangana hills was not found as reported by Rao and Razi (1981). This species might have been eradicated from said area due to habitat destruction. It has become common to add admixtures with morphologically allied and geographically co-occurring species to raw drugs (Nair et al., 1983; Bisset, 1984; Sunita, 1992; Khatoon et al., 2006; Mitra and Kannan, 2007; Ved and Goraya, 2008; Srirama et al., 2010). Due to a high level of morphological similarity among the herbaceous Phyllanthus species (Chaudhary and Rao, 2002; Ganeshaiah et al., 1998), raw drug samples often contain species admixtures (van Rhede, 1690; Dymock, 1883; Dymock et al., 1893; Kirtikar and Basu, 1935; Nadkarni, 1954). An attempt was made by Palaniappan and Marappa (2006) to assess the extent of genetic diversity in P. amarus and two of its related species, P. debilis and P. virgatus, using RAPD and ISSR markers which yielded low level of genetic diversity in P. amarus. RAPD markers are difficult to reproduce and therefore preferentially converted to more specific SCAR markers for better reproducibility. Jain et al. (2008) developed SCAR markers for four Phyllanthus species, namely P. amarus, P. debilis, P, fraternus and P. urinaria. SCAR markers (Jain et al., 2008) and DNA barcodes (Srirama et al., 2010) are helpful in distinguishing the related Phyllanthus species. SCAR Analysis for validating the identity of P. amarus was carried out by Kandavel et al. (2011). However, development of SCAR markers are little complicated and DNA barcodes are not prepared for all the Phyllanthus species. Sequence comparison of the ITS region is widely used in taxonomy and molecular phylogeny because of high copy number of rRNA genes as it is easy to amplify even from small quantities of DNA and has a high degree of variation even between closely related species. This can be explained by the relatively low evolutionary pressure acting on such nonfunctional sequences. It has proven to be useful for checking relationships among species and various genera in Asteraceae (Baldwin, 1993). Bandyopadhyay and Raychaudhury (2010) developed ITS based SCAR markers for identification of five medicinally important species of Phyllanthus. However, they developed ITS based SCAR markers for only three herbaceous Phyllanthus species, 79 namely, P. amarus, P. fraternus and P. urinaria. In the present study, ITS sequences were generated for nine different herbaceous Phyllanthus species. Most of the sequences generated from Phyllanthus species using ITS primers in the present study were matched with the existing sequences in the NCBI database except for P. scabrifolius, P. rheedei and P. kozhikodianus. For the first time ITS sequences were generated for P. scabrifolius and P. kozhikodianus. Although there are few P. rheedei ITS sequences are present in NCBI database, the ITS sequence generated for P. rheedei in the present study did not matched with them. This might be due to wrong identification of the plant material. Interestingly the Phyllanthus species, which are generally included in ‘Bhumyamalaki’ complex, are nested in Cluster I. This indicates relationship between them. Chaudhary and Rao (2002) observed morphological similarities between P. scabrifolius, P. rheedei, P. kozhikodianus and P. tenellus. All these four species are nested in cluster II. P. rheedei and P. kozhikodianus are nested in same sub cluster. This result validates the synonymisation of P. kozhikodianus under P. rheedei (Gangopadhyay et al., 2004). Morphological similarities observed in the present study between P. scabrifolius and P. rheedei also got validation from the dendrogram generated here. However, for merging of these two species, further molecular analyses are warranted. Out-grouping of P. virgatus is justified by their non- phyllanthoid branching and undivided female flower disk. Though lot of molecular work has been done earlier on the ‘Bhumyamalaki’ or ‘niruri’ complex, not much attention was paid to P. scabrifolius, P. rheedei and P. kozhikodianus complex. Present ITS analysis validates the morphological similarities observed between these species by Chaudhary and Rao (2002) and also clearly distinguished each species of this complex. In addition, clear demarcation was made between members of ‘Bhumyamalaki’ or ‘niruri’ complex. While the search for an universal barcode(s) for plants is still on, present study suggests that candidate regions like nrITS can be used for identification and authentication of specific taxa. Using both morphotaxonomical keys and molecular techniques like ITS analysis, authentication of herbaceous Phyllanthus species used in medicine can be carried out. 80