Download Chapter 3 Authentication of herbaceous Phyllanthus species grown

Chapter 3
Authentication of herbaceous
Phyllanthus species grown in Karnataka
based on morphological characters and
molecular analysis
3. Authentication of herbaceous Phyllanthus species grown in
Karnataka based on morphological characters and molecular
analysis
3.1 Introduction
The genus Phyllanthus belongs to the family Phyllanthaceae. Earlier it was
included in the family Euphorbiaceae sensu lato. It is one of the largest genera of
flowering plants, with over 1200 species and accounts for more than half of the
species in the family (Kathriarachchi et al., 2006; Pruesapan et al., 2008). India has
53 species of Phyllanthus (Balakrishnan and Chakrabarty, 2007), although Hooker
(1887) recorded 56 species from the then British India. Chaudhary and Rao (2002)
have listed 12 herbaceous Phyllanthus species in India namely, P. ajmerianus
Chaudhary & Rao, P. amarus Schumach. & Thonn., P. debilis Klein ex Willd., P.
fraternus Webster, P. kozhikodianus Siv. & Mani., P. maderaspatensis L., P. rheedei
Wight, P. rotundifolius Klein ex Willd., P. scabrifolius Hook.f., P. tenellus Roxb., P.
urinaria L. and P. virgatus Forst. f.
Herbaceous Phyllanthus species have been used since ancient times in
different systems of medicine, particularly for the treatment of liver disorders and
urinary infection. Kannada name for herbaceous Phyllanthus species is ‘Nelanelli’ or
‘Kirunelli’ and in Sanskrit or Ayurveda it is known as ‘Bhumyamalaki’ or
‘Tamalaki’. The herbs known as ‘Bhumyamalaki’ in Indian literature refer to a
complex group of P. amarus, P. fraternus, P. debilis and P. urinaria. The whole
group forms a ‘niruri complex’ (Chaudhary and Rao, 2002). P. maderaspatensis and
P. virgatus are also used as substitutes for ‘Bhumyamalaki’ (Murthy, 1994;
Yoganarasimhan, 1996; Chaudhary and Rao, 2002). Although these species closely
resemble each other, ethnomedical uses and some aspects of pharmacological
activities of these species are different (Theerakulpisut et al., 2008). Confusion exists
in identification of these species mainly due to referring them all with a common
vernacular name, their similarity in gross morphology, close proximity in growth
habitat and lack of guidelines to check the authenticity and quality of the medicinal
plant sold (Dnyaneshwar et al., 2006).
44
Webster (1955, 1956, 1956a, 1957, 1958, 1967, 1970 and 1994) has worked
exhaustively on Phyllanthus and has provided detailed taxonomic accounts of West
Indian Phyllanthus. He made several new observations. For the first time, he observed
that true P. niruri L. is a native of the New World and endemic to America and does
not occur in India. However, there are many publications published even today from
India bearing the title of P. niruri. In 1987, Mitra and Jain, after a critical examination
of Indian materials of Phyllanthus revealed that the P. niruri L. described in Flora of
British India (Hooker, 1887) is actually a mixture of three closely related but distinct
species namely P. amarus, P. debilis and P. fraternus. The reports on P. niruri from
India are actually pertaining to investigations on one of the members of this ‘niruri
complex’ but not on P. niruri (Dnyaneshwar et al., 2006).
Chaudhary and Rao (2002) observed that the concept and identification of
various Phyllanthus species, particularly herbaceous ones, have been unclear mainly
due to misidentification of specimens in several Indian herbaria. The distribution of
some species has also not been recorded correctly. The same thing has happened in
floras of Karnataka state also. P. asperulatus Hutch. has been mentioned in flora of
Bangalore (Ramaswamy and Razi, 1973) and Mysore (Rao and Razi, 1981).
However, Chaudhary and Rao (2002) did not include this species in India. P. debilis,
even though reported from Gulbarga and Kodagu by Singh (1988) and Murthy and
Yoganarasimhan (1990), Saldanha (1996) did not record this species from Karnataka
region and expressed his doubts on the occurrence of this species in this region.
Chaudhary and Rao (2002) mentioned its distribution only in coastal areas.
P.
rotundifolius generally grows near seashores in sandy soils. However, Kammathy et
al. (1967) and Rao and Razi (1981) have reported it from Biligirirangana hills.
Therefore, Chaudhary and Rao (2002) call for the confirmation of these reports. Even
though P. rheedei is reported from Dakshina Kannada (Saldanha, 1996), Bangalore
(Ramaswamy and Razi, 1973) and Mysore (Rao and Razi, 1981), Chaudhary and Rao
(2002) did not report this species from Karnataka. Study by Gangopadhyay et al.
(2004) found that P. kozhikodianus is distinct from P. debilis Hook.f. and is
synonymous with P. rheedei. Therefore, the present study was undertaken to
investigate the diversity of herbaceous Phyllanthus species in Karnataka and attempt
has been made to resolve the nomenclatural problems and confusions persisting in this
45
genus by analyzing the morphological characters of these species and evolve a simple
morphology based key for authentic taxonomical identification of the related species.
In recent years, efforts have been made to accurately identify medicinal plants
used in raw drug trade to ensure the purity, quality and safety of drugs (Jayasinghe et
al., 2009). Besides conventional methods including examination of wood anatomy
and morpho-taxonomical keys, several DNA-based methods have been developed for
the identification of medicinal plants (Sucher and Carles, 2008). For example, a rapid
detection method based on DNA sequences has been developed for identifying three
species of Bupleurum, B. kaoi Liu Chao et Chuang, B. falcatum L. and B. chinense
DC., in the processed herbal material using ITS regions (Lin et al., 2008). A
sequence-specific oligonucleotide probe (SSOP) array has been developed using the
sequence differences between these three species for identification (Lin et al., 2008).
Misra et al. (2006) developed an AFLP based detection of adulterants in crude drug
preparations of the safed musli (Chlorophytum) complex. Jain et al. (2008) developed
sequence characterized amplified region (SCAR) markers to identify four species of
Phyllanthus used in dry leaf bulk herb trade.
Several related species of P. amarus (‘Bhumyamalaki’) occur in India and are
widely used as medicinal herbs, though the efficacy of these species is not fully
established. Further, since all these species are taxonomically closely related to P.
amarus, they are often collected, marketed and used as P. amarus. The problem is
further complicated as these species exhibit a lot of morphological diversity in
different regions. P. amarus is closely related to P. niruri, P. fraternus and P. debilis
morphologically, phytochemically and by use. In fact, because of the confusion, the
species are often referred as the PAF (Phyllanthus-amarus-fraternus) complex
(Ganeshaiah et al., 1998). P. kozhikodianus, P. rheedei, P. scabrifolius and P. tenellus
are very similar in their gross morphology (Chaudhary and Rao, 2002). Sequence
comparison of the ITS region is widely used in taxonomy and molecular phylogeny
because it is easy to amplify even small quantities of DNA and has a high degree of
variation even between closely related species. This can be explained by the relatively
low evolutionary pressure acting on such nonfunctional sequences. It has proved
useful for checking relationships among species and various genera in Asteraceae
(Baldwin, 1993). Therefore, authentic identification of morphologically similar and
46
closely related herbaceous Phyllanthus species were carried out at DNA level by
using Nuclear ribosomal ITS sequence analysis.
3.2 Materials and methods
3.2.1 Taxonomical authentication
Frequent field visits were carried out throughout the Karnataka state to collect
all the herbaceous Phyllanthus species in different seasons. Detailed field notes were
made and specimens were collected for preparing herbarium. Standard protocol was
followed to prepare herbarium specimens. These herbarium specimens were
compared with the herbarium specimens of already recorded herbaceous Phyllanthus
species in the regional floras of Karnataka for provisional identification. Later
authentic identification was done by referring to recent monographs and floras and by
comparing with available type specimens. For each species, correct nomenclature,
detailed description, flowering and fruiting period, distribution in different parts of
Karnataka, habitat and details of collected specimen have been provided. In addition,
stereozoom microscopic view of all taxonomically important morphological features
along with habit photograph for each species and critical notes on their correct
identification, nomenclature, diagnostic characters, relationship with other allied
species and status have also been provided. Finally, morphological distinctions were
listed and came up with simple key for authentic taxonomical identification of
herbaceous Phyllanthus species based on morphological characters especially on the
shape of the leaf.
3.2.2 Molecular authentication
3.2.2.1 Plant material collection
Seven herbaceous Phyllanthus species namely, P. amarus Schumach. &
Thonn., P. debilis Klein ex Willd., P. maderaspatensis L., P. virgatus G. Forst., P.
urinaria L., P. scabrifolius Hook.f. and P. tenellus Roxb. have been collected from
different parts of Karnataka. In addition, P. kozhikodianus Siv. & Mani. from Calicut
(Kerala) and P. rheedei Wight from Yercaud (Tamil Nadu) were also collected. Fresh
leaf samples were collected from these plants, frozen in liquid nitrogen and stored at
– 80 °C until used for DNA isolation.
47
3.2.2.2 DNA isolation
DNA was isolated using CTAB (Cetyl trimethyl ammonium bromide) method
following the protocol of Doyle and Doyle (1990). 100 mg of leaf tissue was ground
in liquid nitrogen. Then they were incubated in CTAB buffer (3% (w/v) CTAB, 100
mM Tris-HCl, 20 mM EDTA, 1.4 M NaCl, 2% (v/v) β-mercaptoethanol, 2% (w/v)
polyvinyl pyrrolidone, pH 8) for 2 h at 65 °C. The homogenate was then extracted
with an equal volume of chloroform: isoamyl alcohol (24:1) mixture and centrifuged
at 12000 rpm for 10 min. The upper aqueous layer was recovered and precipitated
with pre-chilled isopropanol. The pellet was suspended with Tris-EDTA buffer (pH
8.0). The crude DNA was treated with RNase and incubated for 30 min at 37 °C and
again extracted with 1 volume phenol and subsequently with 1 volume of chloroform:
isoamyl alcohol (24:1). The supernatants were collected and precipitated with 3 M
sodium acetate and pre-chilled ethanol. The DNA pellet was washed with 70%
ethanol, dried, and resuspended in TE buffer. The high molecular weight DNA was
checked for quality by calculating the ratio of absorbance at 260/280 nm in
spectrophotometer. A value of 1.8 confirmed high quality genomic DNA. Quantity of
DNA was checked electrophoretically using 0.8% agarose gel against a known
amount of lambda DNA taken as standard.
3.2.2.3 ITS amplification, sequencing and authentication
ITS analysis was performed using nine different species of Phyllanthus.
Amplification of the internal transcribed spacer region of nuclear DNA, including
ITS1, 5.8S and part of the ITS2 was done using the primers ITS1 and ITS4 of White
et al. (1990). Polymerase chain reactions were performed in a total volume of 25µl
(Fermentas green PCR master mix (Germany) including Taq polymerase, MgCl2 and
Taq buffer) containing 0.5µl of forward and reverse primers, 25ng of template DNA.
Reactions were performed in an eppendorff PCR thermocycler (Germany). Total 35
amplification cycles were carried out with an annealing temperature of 55 °C for 1
min and an extension for 1 min at 72 °C and final extension was kept at 72 °C for 10
min.
Subsequently, 5µl of each amplification mixtures were analysed by agarose
gel electrophoresis in TBE buffer (1.5% w/v) containing 1µg/ml ethidium bromide,
by comparsion with a known mass standard. The PCR products were purified from
48
excess salts and primers with a PCR purification kit (Fermentas, Germany) and
sequenced (Eurofins, Bangalore). For authentication of Phyllanthus species, generated
sequences were checked for orthology and multiple alignments were performed using
multalign. Phylogenetic analysis and tree construction was done using ClustalW2
software.
3.3 Results
3.3.1 Taxonomical authentication of the herbaceous Phyllanthus species grown in
Karnataka
Extensive field visits resulted in the collection of seven herbaceous
Phyllanthus species namely, P. amarus Schumach. & Thonn., P. debilis Klein ex
Willd., P. maderaspatensis L., P. virgatus G. Forst., P. urinaria L., P. scabrifolius
Hook.f. and P. tenellus Roxb. Totally, 115 specimens belonging to these seven
herbaceous Phyllanthus species have been collected from different parts of Karnataka
(Fig. 3.1) and further processed for preparing herbarium. All the 115 herbarium
specimens have been deposited in the herbarium of Department of Studies in Botany,
University of Mysore, Manasagangotri, Mysore (MGM) for future reference.
Correct nomenclature, detailed description, flowering and fruiting period,
distribution in different parts of Karnataka, habitat, details of collected specimen
along with relevant figures for each species and critical notes on their correct
identification, nomenclature, diagnostic characters and relationship with other allied
species has been given below.
1. Phyllanthus amarus Schumach. & Thonn., in Kongl. Danske Vidensk. Selsk. Skr.,
Natur Vidensk. Math. Afd. 4: 195. 1829; Webster in J. Arnold Arb. 37: 13. 1956 & 38:
313. pl. 19. f. 1-K. 1957; Webster & Airy Shaw in Kew Bull. 26: 92. 1971; Mitra &
Jain in Bull. Bot. Surv. India 27: 164, f. 1. 1987; Brunel & Roux in Nord. J. Bot. 4:
469, f. 1-6. 1984; Chen & Wu in Taiwania 42: 251, f. 54-56. 1997; Chaudhary & Rao
in Phytotaxonomy. 2: 148. 2002. P. nanus Hook. f. in Hook. f., Fl. Brit. India. 5: 298.
1887. P. niruri auct. non L. (1753); Hook. f. in Hook. f., Fl. Brit. India 5: 298. 1887,
p.p.
Branching annual herbs, 10-100 cm tall; stem terete, smooth or sometimes
scabridulous in younger parts. Leaves on the main axis reduced to scale leaves
49
(cataphylls); cataphylls 0.8-1.2 mm long, triangular-lanceolate, acuminate, turn black
at maturity; stipules 1 mm long, triangular-lanceolate, entire along margins,
acuminate, membranous; foliage leaves alternate, distichous; petiole 1 mm long; leaf
lamina 5-9 × 2-4 mm, oblong or elliptic-oblong (sometimes obovate), obtuse or
rounded at base, entire along margins, obtuse and shortly mucronate at apex, glaucous
beneath, 5-7 pairs of nerves, nerves not conspicuous on the upper surface, visible only
in the lower side. Cymules unisexual with 1-2 male flowers in upper 1-2 axils and
bisexual with 1-2 male flowers and 1-2 female flowers in middle axils and again
unisexual with 1 female flower in a few lower axils or sometimes bisexual up to the
upper most axils and unisexual in lower axils. Male flowers yellowish white; pedicel
0.5-1 mm long; calyx lobes 5 (very rarely 6), elliptic with acute tip, 0.5 mm long,
membranous; disk glands 5, saucer-shaped with irregular margins; stamens 3,
filaments completely connate into a column; anthers sessile. Female flowers pale
green; pedicel 1 mm long extending up to 2 mm in fruit; calyx lobes 5 (very rarely 6),
0.8 × 0.4 mm, elliptic, acute, with wide membranous margins and green and thickened
midrib region; disk flat, deeply 5-lobed; styles 3, free, spreading; stigma bifid.
Capsule globose, 1.5-2 mm across, smooth; seeds 0.8 mm long, trigonous, brown,
with 6-7 straight parallel longitudinal ribs on back (Fig. 3.2).
Flowering and fruiting: Almost throughout the year, but peaks during rainy season.
Distribution: Throughout Karnataka, especially in plain and coastal districts. Rare in
Western Ghat regions.
Habitat: In moist shady places in garden lawns, agriculture fields, roadsides, along
railway lines, wastelands and forest margins.
50
51
Specimens collected and examined: Mysore: Manasagangotri (MG) campus,
24.7.2007, S.K.K.K. 2; Talkad (on the river bank), 25.12.2007, S.K.K.K. 22.
Kodagu: Virajpet town, 10.9.2007, S.K.K.K. 9. North Kanara: Kumta, 26.10.2007,
S.K.K.K. 13. Mandya: Pandavapura, 28.11.2007, S.K.K.K. 19. Udupi: Malpe town,
2.3.2008, S.K.K.K.31. South Kanara: Dharmasthala, 4.3.2008, S.K.K.K. 34.
Chikmagalur: Kadur (Railway station), 1.5.2008, S.K.K.K. 37. Shimoga:
Badravathi, 2.5.2008, S.K.K.K.40. Chamarajnagar: Yelandur (on the tank bund),
20.6.2008, S.K.K.K. 43. Hassan: Hassan town (Belur road), 15.7.2008, S.K.K.K. 47.
Bellary: Near Hampi temple, 1.8.2008, S.K.K.K. 48. Davanagere: Davanagere town
(near Avaragere), 14.8.2008, S.K.K.K. 52. Bangalore: GKVK campus (Hebbal),
29.8.2008, S.K.K.K. 58. Ramanagaram: Near Savanadurga hills, 14.9.2008,
S.K.K.K. 63. Chitradurga: Holalkere (Railway station), 13.11.2008, S.K.K.K.81.
Gadag: Gadag Railway station, 24.12.2008, S.K.K.K. 84. Bagalkot: Aihole temple
garden, 25.12.2008, S.K.K.K. 88. Bijapur: Near Almatti, 25.12.2008, S.K.K.K. 90.
Tumkur: Gubbi (on paddy field bund), 3.8.2009, S.K.K.K. 93. Dharwad: Dharwad
agriculture university campus, 4.8.2009, S.K.K.K. 96. Haveri: Near Haveri town,
5.8.2009, S.K.K.K. 99. Kolar: Road sides near Narsapura, 4.10.2009, S.K.K.K. 107.
Raichur: Near Raichur Railway station, 25.10.2009, S.K.K.K. 109. Gulbarga:
Gulbarga town, 8.11.2009, S.K.K.K. 113.
Type specimen examined (microfiche): Ghana, Schumacher & Thonning [isotype,
fragment and drawings (Kew)].
Notes: Phyllanthus amarus somewhat resembles P. fraternus in gross morphology.
This might be the reason for treating this species as P. fraternus in some regional
floras. HFP 271 (JCB) in flora of Hassan district, KFP 5913 (JCB) in flora of
Karnataka and HGUG 198 in flora of Gulbarga district are treated as P. fraternus, but
they actually belong to P. amarus. P. amarus is easily distinguished from P. fraternus
by its usually oblong leaves with obtuse-mucronate tip, bisexual cymules in upper
axils of branchlets, pentamerous calyx lobes and 5-lobed female disk. Some of the
regional floras wrongly treated P. amarus as P. asperulatus, which does not occur in
India. Rao 2095 (MGM) in the synoptic flora of Mysore district and SVR 893 and
924 in the flora of Bangalore district have treated this as P. asperulatus, but they
actually belong to P. amarus.
52
Phyllanthus amarus originated in the Caribbean area as a vicarious species of
P. abnormis of the Southern United States and has spread around the tropics by
trading vessels (Webster, 1994). This species is distributed all over India and is
considered as the most widely occurring species of Phyllanthus in India (Chaudhary
and Rao, 2002). In Karnataka also, this is the most widely distributed species of
Phyllanthus, especially in plains and coastal districts but rare in Western Ghats. This
species is commonly associated with P. debilis in coastal regions and with P.
maderaspatensis in plains.
2. Phyllanthus debilis Klein ex Willd., Sp. Pl. 4: 582. 1805; Webster in J. Arnold
Arb. 38: 307. 1957 & Pacific Sci. 40: 104. 1986; Rani in K.M. Matthew, Fl.
Tamilnadu Carnatic 3(2): 1466, 1983, p.p.; Mitra & Jain in Bull. Bot. Surv. India 27:
169, f. 2. 1987; Chakrab. & Balakr. in J. Econ. Taxon. Bot. Add. Ser. 9: 94. 1992 ;
Chen & Wu in Taiwania 42: 252, f. 57-59, 78. 1997; Chaudhary & Rao in
Phytotaxonomy 2: 150. 2002, p.p. (non Buch. Ham. Ex Hook.f. 1887 = P. airyshawii).
P. niruri var. debilis (Willd.) Muell.-Arg. in DC., Prodr. 15(2): 407. 1866. P.
mukerjeeanus Mitra & Bennet in Bull. Bot. Soc. Bengal 19: 145, f. 1.t.1. 1966. P.
niruri auct. non L. 1753; Hook. f., Fl. Brit. India 5: 298. 1887, p.p.
Erect annual herbs, 10-70 cm tall, often profusely branched, entirely glabrous;
stem green or reddish brown, terete below, angular in upper part, with distinct normal
leaves on lower nodes when young, becoming leafless and woody at maturity.
Cataphylls 1-1.5 mm long, narrowly lanceolate, acuminate. Leaf-bearing branchlets 210 cm long. Stipules 1.5-2.0 mm long, triangular-lanceolate, acuminate at tip, entire
or sometimes irregularly wavy along margins, membranous to thick, sometimes
reddish along midrib region. Leaves distichous, narrowly elliptic or obovate, cuneate
or acute at base, entire and occasionally reddish along margins, obtuse or acute at
apex, 4-20 × 2-5 mm, membranous to chartaceous, mid rib and lateral veins
prominently visible beneath; petioles 1.2-1.5 mm long, light green or reddish.
Cymules unisexual, proximal 3-4 nodes with 2-4 male flowers, distal nodes with
solitary female flowers. Male flowers with minute pedicel; calyx lobes 6, arranged in
2 whorls of 3 each, the outer 3 larger, green with prominent scarious white margins,
0.4–0.6 mm long, obovate, obtuse to truncate at tip; disk glands 6, saucer-shaped with
irregular margins; stamens 3, filaments almost connate and free at the apex, anthers
53
globose. Female flowers with 1-2 mm long pedicel; pedicels dilated at apex; calyx
lobes 6, similar to that of male flowers in shape and arrangement, up to 1.5 mm long,
with broad membranous margins and thickened green middle portion; disk shallowly
6-lobed; ovary subglobose, smooth and 3-celled; style 3, free spreading, appressed to
the ovary, bifid about to the middle. Capsules ca. 2-3 mm in diameter, depressedglobose, smooth; seeds, ca. 1 mm long, trigonous, yellowish-brown, with 6-7 straight
longitudinal ribs and many fine transverse striae on the back (Fig. 3.3).
Flowering and fruiting: January to April in Western Ghats and coastal regions and
rainy season onwards to till October in South-Eastern districts.
Distribution: Common in coastal and Western Ghat regions. Rarely distributed in
South-Eastern districts and absent in plains.
Habitat: Grows as weed in moist shady places, stream or riverbanks, roadsides,
fallow lands, agricultural fields, banana, arecanut and coconut plantations, etc.
Specimens collected and examined: Mysore: Nanjanagud river bank, 20.8.2007,
S.K.K.K. 6; Talkad (on the river bank), 25.12.2007, S.K.K.K. 23. North Kanara:
Gokarna, 26.10.2007, S.K.K.K. 12. Mandya: Paschimavahini (Sreerangapattana),
28.11.2007, S.K.K.K. 16. Chikmagalur: Kigga (Sringeri), 26.1.2008, S.K.K.K. 25;
Kigga (Sringeri), 26.1.2008, S.K.K.K. 26. Udupi: Uppunda (near Byndoor), 2.3.2008,
S.K.K.K.32. South Kanara: Subramanya, 5.3.2008, S.K.K.K. 36. Bangalore: IISC
campus, 29.8.2008, S.K.K.K. 56. Shimoga: Sampekatte (Hosanagar), 29.9.2008,
S.K.K.K.68. Hassan: Sakaleshpur. 10.10.2008, S.K.K.K. 70. Kodagu: Bylukukppe
(Kushalnagar), 1.11.2008, S.K.K.K. 76; Bhagamandala, 22,4,2009, S.K.K.K. 92.
Kolar: Roadsides near Kolar on Bangalore- Kolar highway, 4.10.2009, S.K.K.K. 105.
Type specimen examined (microfiche): India, Madras, Thanjor, Tranquebar, in rice
fields, February 1799, Klein s.n. (B-Willd., syntypes- 3 sheets-Herb. Willd. 17898-B).
Notes: Saldanha (1996) did not record this species from Karnataka region, even
though it has been reported from Gulbarga (Singh, 1988) and Kodagu (Murthy and
Yoganarasimhan, 1990). Our observation revealed that P. debilis reported from the
Kodagu (KRK and SNY 3649) and Eastern Karnataka actually belongs to P.
scabrifolius. Saldanha was right in expressing his doubts on the occurrence of this
species from this region. Later, Chaudhary and Rao (2002) and Bhat (2003) reported
this species from Shimoga and Udupi districts. Chaudhary and Rao (2002) say that it
is found only in coastal areas. However, our field studies confirmed the occurrence of
54
this species in Ghats as well as coastal regions and even in South-Eastern districts
(inland).
This species is closely related to P. fraternus Webster. However, it appears to
be sufficiently distinct by virtue of its leaf shape, nature of female calyx lobes, shape
of female disk and lobing of style. Sometimes it grows in association with P. amarus,
P. urinaria and P. virgatus. R.R. Rao 1318 (MGM), SNY 5719 (CCRAS), KFP 13993
and 13275 and HFP 1857 (JCB) specimens were wrongly identified as either P.
fraternus or P. niruri. However, a close examination of these specimens by us
revealed that they are actually P. debilis.
3. Phyllanthus maderaspatensis L., Sp. Pl. 982. 1753; Roxb., Fl. India 3: 654.1832;
Wight, Ic. Pl. Ind. Orient. 5 (Pt. 2): 25; pl. 1895, f.3. 1852; Hook. f. in Hook. f., Fl.
Brit. India 5: 292. 1887. Chaudhary & Rao in Phytotaxonomy 2: 153. 2002.
Erect or decumbent herbs, 10-80 cm tall, stem slender, generally branched, woody at
base, glabrous, branches terete below, striate and flattened, particularly at nodes
towards apex. Cataphylls absent. Stipules 1-2 mm long, triangular-lanceolate, peltate
at base, acuminate at apex, entire and membranous along margins and thickened in
the middle region. Foliar leaves alternate, not distichous; petiole short, 1-2 mm long;
leaf blade obovate or spatulate, cuneate at base, entire along margins, obtuse or
rounded mucronate or sometimes retuse at apex, glaucous beneath, 10-30 × 4-10 mm,
4-5 pairs of nerves prominently visible on the upper surface. Cymules bisexual with
1-4 male flowers and 1 female flower in upper axils and unisexual with solitary
female flowers in lower axils. Male flowers minute with short pedicels; calyx lobes 6
in 2 whorls of 3 each, about 2 mm long, obovate, membranous; stamens 3, filaments
completely connate into a column; anthers subsessile; disk glands 6, almost rounded,
flat or slightly concave. Female flowers with ca. 1 mm long pedicels, extending to
1.5-2 mm in fruits; pedicels filiform but thickened at apex; calyx lobes 6, biseriate
(distinctly visible in young flowers), unequal, rhomboid, rhomboid-obovate or
spatulate with acute, subobtuse, obtuse or rounded apex, green and thickened except
narrow white membranous margins; disk 6-lobed; styles 3, free or slightly fused at
base, spreading and minutely bilobed at tip. Capsule 2-3 mm in diameter, depressedglobose, smooth; seeds 1-1.5 mm long, triquetrous, brown, with concentric lines of
minute tubercles and minute crossbars (Fig. 3.4).
55
56
57
58
Flowering and fruiting: Almost throughout the year, but peaks during rainy season.
Distribution: Common in plain districts and does not grow in coastal and Western
Ghat regions.
Habitat: Common weed of waste places, garden lawns and cultivated fields in moist
and shady places and prefers black cotton soil.
Specimens collected and examined: Mysore: Manasagangotri campus, 24.7.2007,
S.K.K.K. 1. Mandya: Pandavapura, 28.11.2007, S.K.K.K. 18. Chikmagalur: Birur,
1.5.2008,
S.K.K.K.
38.
Shimoga:
Badravathi,
2.5.2008,
S.K.K.K.
39.
Chamarajnagar: Yelandur, 20.6.2008, S.K.K.K. 42. Hassan: Holenarasipura,
15.7.2008, S.K.K.K. 45. Bellary: Hampi (Scrub forest), 1.8.2008, S.K.K.K. 49.
Davanagere: Davanagere town (near Avaragere), 14.8.2008, S.K.K.K. 53.
Bangalore: Kengeri (Road side), 29.8.2008, S.K.K.K. 62. Ramanagaram: Near
Ramanagaram hills, 15.9.2008, S.K.K.K. 65. Chitradurga: Near Chitradurga fort,
12.11.2008, S.K.K.K.79. Gadag: Gadag Railway station, 24.12.2008, S.K.K.K. 85.
Bagalkot: Bagalkot town, 25.12.2008, S.K.K.K. 89. Bijapur: Muddebihal,
25.12.2008, S.K.K.K. 91. Tumkur: Huliyaru, 3.8.2009, S.K.K.K. 94. Dharwad:
Dharwad agriculture university campus, 4.8.2009, S.K.K.K. 95. Haveri: Ranebennur,
5.8.2009, S.K.K.K. 100. Kolar: Road sides near Mulbagil, 4.10.2009, S.K.K.K. 108.
Raichur: Near Raichur Railway station, 25.10.2009, S.K.K.K. 110. Gulbarga: Out
skirts of Gulbarga, 8.11.2009, S.K.K.K. 115.
Specimens examined (Herbaria): Mysore: Manasagangotri botanical garden, R.R.
Rao 4 (MGM) and M. M. Hills, R.R. Rao 2091 (MGM); Bangalore: Bangalore, SVR
617 and Govindu 83 (HBUB); Gulbarga: Gulbarga, HGUG 199 (HGUG); Hassan:
CJS 11937 (JCB).
Notes: Phyllanthus maderaspatensis is a very distinct species and can be easily
recognized by its non-phyllanthoid branches, alternate non-distichous leaves, obovatemucronate leaf shape, rhomboid-obovate shape of female calyx lobes and tuberculate
seeds.
Common weed in plain districts and does not grow in coastal and Western
Ghats. Often grows in association with P. amarus.
4. Phyllanthus virgatus G. Forst. Fl. Ins. Austr. 65. 1786; Airy Shaw in Kew Bull.
26: 325. 1972 & 37: 34. 1982. Chen & Wu in Taiwania 42: 259, f. 75-77. 1997.
59
Chaudhary & Rao in Phytotaxonomy 2: 159. 2002. P. simplex var. virgatus (Forst. f.)
Muell.-Arg. in Linnaea 32: 32. 1893. P. simplex Retz., Obs. Bot. 5: 29. 1789; Roxb.,
Fl. Ind. 3: 655. 1832; Hook. f., Fl. Brit. India 5: 295. 1887. P. simplex var. genuinus
Muell.-Arg. in DC., Prodr. 15: 391. 1866. Macraea oblongifolia Wight., Ic. Pl. Ind.
Orient. 5(2): 27, pl. 1902. f.1. 1852. P. simplex var. oblongifolia (Wight) Muell.-Arg.
in Linnaea 32: 32. 1863.
Procumbent to erect annual or perennial herbs or sometimes suffruticose, up to
60 cm tall; stem simple or branched (profusely spreading, many branches from base in
prostrate-caespitose plants), branchlets angled or winged, glabrous. Cataphylls absent.
Stipules 0.5-1 mm long, reddish-brown, ovate-triangular, peltate, subsagitate at base,
entire along margins, subacuminate at apex. Leaves alternate, distichous, subsessile;
leaf lamina 5-30 × 2-4 mm, leathery, linear or oblong-elliptic, subcordate or rounded
at base, obtuse to acute or apiculate at apex, glabrous, lateral veins 5-7 pairs, indistinct
to sometimes distinct; petioles 0.5 mm long, glabrous. Cymules bisexual with 1-2
male and 1 female flowers in upper axils and unisexual with solitary female flower in
lower axils. Male flowers minute; calyx lobes 6, white to purplish, membranous,
obovate, rounded at apex; disk glands 6, orbicular to almost round; stamens 3,
filaments free. Female flowers with 3.5-10 mm long (after anthesis) pedicel; pedicels
thickened and angled at apex, reddish below and greenish above; calyx lobes 6, ovateoblong, reflexed, purple with whitish membranous margin, persistent in fruit; ovary
warty; styles 3, free, spreading, recurved and adpressed to the surface of fruit, bilobed
at apex; disk flat, undivided. Capsule long-stalked, depressed-globose, 2.5-3 mm in
diam., densely warty (tubercled) in young condition, smooth at maturity; seeds 1.2-2
× 1 mm, trigonous, brown, minutely tubercled, tubercles arranged in several vertical
concentric rings (Fig. 3.5).
Flowering and fruiting: Almost throughout the year in coastal and plain districts,
abundant during rainy season. In Western Ghats, flowering starts at the end of rainy
season and fruiting completed in December.
Distribution: Throughout Karnataka, but less common in plain districts of Northern
Karnataka.
Habitat: Grasslands, open grassy areas on roadsides, rocky areas (lateritic), in
deciduous and scrub forests.
60
61
Specimens collected and examined: Mysore: Chamundi hills, 10.8.2007, S.K.K.K.
3. North Kanara: Yana (Sirsi), 24.10.2007, S.K.K.K. 10. Mandya: Karighatta
(Sreerangapattana), 28.11.2007, S.K.K.K. 21. Chikmagalur: Kigga (Sringeri),
26.1.2008, S.K.K.K. 24. Udupi: PPC campus, 1.3.2008, S.K.K.K.28. South Kanara:
Near Mangalore, 4.3.2008, S.K.K.K. 33. Hassan: Doddakadanur scrub forest,
15.7.2008, S.K.K.K. 46. Bellary: Yashwanthnagar, 2.8.2008, S.K.K.K. 50.
Davanagere: Near Harapanahalli, 15.8.2008, S.K.K.K. 54. Bangalore: GKVK
campus (Hebbal), 29.8.2008, S.K.K.K. 57. Ramanagaram: Hill near Ramanagaram,
15.9.2008, S.K.K.K. 66. Shimoga: Kodachadri hills (Hosanagar), 29.9.2008,
S.K.K.K. 69. Chamarajnagar: Attikan (on grassy hill tops), 19.10.2008, S.K.K.K.
74. Kodagu: Madikeri, 1.11.2008, S.K.K.K. 77. Chitradurga: Near Chikkajajur
(Scrub jungle), 13.11.2008, S.K.K.K.82. Gadag: Near Hole Alur, 24.12.2008,
S.K.K.K. 86. Dharwad: Dharwad agriculture university campus, 4.8.2009, S.K.K.K.
98. Tumkur: Devarayanadurga hill, 1.10.2009, S.K.K.K. 103. Kolar: Narsapura,
4.10.2009, S.K.K.K. 106. Raichur: Devadurga, 26.10.2009, S.K.K.K. 111.
Gulbarga: Gulbarga out skirts, 8.11.2009, S.K.K.K. 114. Bagalkot: Near Badami
(Scrub forest), 15.12.2011, S.K.K.K. 118.
Specimens examined (Herbaria): Adyar (Tamil Nadu), Gamble 17638 (MH);
Mysore: Chamundi hills, R.R. Rao 9 (MGM); Chamarajnagar: Attikan, R.R. Rao
983 and M.M. Hills, R.R. Rao 6107 (MGM); Hassan: Gendekal reserve forest, CS
8964 (JCB); Gulbarga: Gulbarga, HGUG 1296.
Notes: In coastal and plain districts, P. virgatus grows as a procumbent perennial herb
with profuse branches from base and has shorter leaves. However, in Western Ghats it
is actually an erect annual and rarely (1 or 2) branched with longer leaves.
Phyllanthus virgatus can be easily identified by its non-phyllanthoid branches,
linear or oblong-elliptic leaves, longer female pedicels (3.5-8 mm long), tuberculate
ovary and young fruits and distinctly tuberculate seeds. However, it is often confused
with closely related species, P. gardnerianus (Wight) Baillon. Same thing happened
in the flora of Chikmagalur by Yoganarasimhan et al. (1981). They identified the
herbarium specimen, Simhan 1556 (CCRAS) as P. virgatus instead of P.
gardnerianus.
62
5. Phyllanthus urinaria L., Sp. Pl. 982. 1753; Roxb., Fl. Ind. 3: 660. 1832; Hook. f.
in Hook. f., Fl. Brit. India 5: 293. 1887; Webster in J. Arnold. Arb. 38: 194, f. 9. 1957
& Brittonia 22: 65. 1970; Airy Shaw in Kew Bull. 26:325. 1972. Chaudhary & Rao in
Phytotaxonomy 2: 158. 2002. P. leprocarpus Wight, Ic. Pl. Ind. Orient. 5(2): 25, pl.
1895, f. 4. 1852.
Erect or sometimes procumbent annual herbs, 10-100 cm tall; stem woody at
base, simple or branched, sometimes profusely branched from the base, terete below
and flattened and winged towards apex, acutely ridged at nodes throughout, glabrous
to pubescent; hairs only on ridges, spreading. Cataphylls 1.5-2 mm long, ovatelanceolate, acuminate to aristate at tip. Stipules ca. 1 mm long, membranous, greenish
or pinkish, triangular-lanceolate, auriculate at base, acuminate-aristate at apex, entire
along margins. Leaves variable in size, distichous; lamina 10-17 x 2-6 mm, oblong or
linear-oblong, sometimes slightly falcate, obtuse with distinctly mucronate at tip, base
unequal sided, hispidulous along margins and intramargins, usually green or
sometimes reddish below and green above, occasionally reddish only along margins
and apical region, veins raised below and looped close to the margin; petiole short and
compressed. Cymules unisexual with solitary female flower in lower axils and 1-3
male flowers in upper axils. Male flowers with minute pedicels; calyx lobes 6,
yellowish-white, elliptic-oblong, apex rounded; disk glands 6, cuneate with irregular
margins; stamens 3, filaments completely united into a slender column, anthers sessile
and erect. Female flowers with minute pedicel; pedicels green or reddish, becoming
thickened in fruiting; calyx lobes 6, about 1 mm long, narrowly oblong, obtuse or
rounded at apex, with broad, yellowish-white, membranous margins and slightly
thickened, green or reddish midrib region; disk 6-lobed; ovary distinctly tuberculate;
styles 3, free, deeply lobed at tip, lobes recurved; capsules 2-3 mm in dia., depressedglobose, prominently tuberculate, green or reddish; seeds 1 mm long, trigonous,
brown, with 12-15 prominent transverse ridges and with faint cross bars on the
rounded back side (Fig. 3.6).
Flowering and fruiting: Throughout the year, but luxuriant during rainy season.
Distribution: Common in Western Ghats and coastal regions, less common in drier
plains.
Habitats: Grows on river or stream banks, agricultural fields, forest margins, gardens,
wastelands and roadsides.
63
Specimens collected and examined: Mysore: Nanjanagud river bank, 20.8.2007,
S.K.K.K. 7. Kodagu: Makutta Ghat (Virajpet), 10.9.2007, S.K.K.K. 8. North
Kanara: Syntheri rock, 25.10.2007, S.K.K.K. 11. Mandya: Paschimavahini
(Sreerangapattana), 28.11.2007, S.K.K.K. 17. Chikmagalur: Kigga (Sringeri),
26.1.2008, S.K.K.K. 27. Udupi: Near Sri Krishna temple, 1.3.2008, S.K.K.K.29.
South Kanara: Dharmasthala, 4.3.2008, S.K.K.K. 35. Bellary: Donimalai forest,
2.8.2008, S.K.K.K. 51. Davanagere: Ucchangidurga, 15.8.2008, S.K.K.K. 55.
Bangalore: Lalbag garden, 29.8.2008, S.K.K.K. 61. Shimoga: Agumbe Ghat,
28.9.2008, S.K.K.K. 67. Hassan: Shiradi Ghat (Sakaleshpur), 10.10.2008, S.K.K.K.
71. Chamarajnagar: On the way to Attikan from Bedguli, 19.10.2008, S.K.K.K. 73.
Tumkur: Devarayanadurga forest, 1.10.2009, S.K.K.K. 104.
Type specimen examined (microfiche): Ceylon, Herb. Hermann (holotype: BM).
Specimens examined (Herbaria): Mandya: Paschimavahini, R.R. Rao 812 (MGM &
JCB); Gulbarga: Gulbarga, HGUG 1259; Hassan: CJS 14780 and HFP 322 (JCB).
Notes: Phyllanthus urinaria is a very distinct species with conspicuously tuberculate
ovary and fruits, transversely ridged seeds and leaves sensitive, unequal at base and
hispidulous on margins; often grows in association with P. amarus, P. debilis, P.
urinaria and P. virgatus especially in coastal areas. This species shows enormous
morphological variations, mainly in diffuse to erect habit, colour of the stem and
leaves (green or red), shape, size and apex of leaves.
6. Phyllanthus scabrifolius Hook. f. in Fl. Brit. India. 5: 299. 1887; Cooke, Fl. Pres.
Bombay. 3: 84. 1967 (repr. ed.); Chaudhary & Rao, Phytotaxonomy. 2: 155. 2002;
Murugan et al., Current Science. 91: No. 7, 870. 2006. Diasperus scabrifolius
(Hook.f) Kuntze, Revis. Gen. Pl.
Erect annual herb, up to 75 cm tall; stem terete below, angular above;
branches winged, dentate, hispidulous. Cataphylls 2 mm long, narrowly triangular,
lanceolate, acuminate, midrib greenish to pinkish, margin minutely dentate. Stipules
1-1.5 mm long, greenish to pinkish, triangular-lanceolate, acuminate, margin dentate
to serrate. Leaf blade 8-20 × 5-10 mm, broadly elliptic or obovate, cuneate or rounded
at base, margin entire, acute to acuminate or occasionally mucronate at apex, densely
scaberulous below, sparsely scaberulous above, midrib raised on both surfaces, lateral
veins 4-6 pairs; petioles up to 1.5 mm long. Cymules both unisexual and bisexual,
64
proximal 3-4 nodes with solitary male flowers, succeeding nodes with 1-2 male
flowers and 1 female flower and distal nodes with solitary female flowers. Male
flowers minute; pedicel 1 mm long, slightly angled; calyx lobes six, membranous,
biseriate, unequal, outer lanceolate, acute, inner ovate-obovate or obtuse, acute to
rounded; stamens 3, filaments connate up to middle, free and spreading above; disk
glands 6, saucer-shaped with irregular margins. Female flowers with 2 mm long
angular, hispidulous pedicel; calyx lobes six (very rarely 7), biseriate, unequal,
enlarged and reflexed after fruiting, greenish, broadly thickened in midrib region,
narrow membranous along margins, hispidulous outside, particularly in thickened
region, outer ones linear-obovate, acute, inner linear-obovate, subobtuse; disk
rounded with irregularly lobed margin; styles 3, free, recurved from base, distinctly
bilobed. Capsule 5 mm across, depressed-globose, minutely puberulous; seeds 1-2
mm long, trigonous, brownish with 6-8 straight longitudinal lines and many
transverse striae on the back (Fig. 3.7).
Flowering and fruiting: June to December.
Distribution: Throughout the plain districts, almost absent in Western Ghats and
coastal regions.
Habitat: Found growing in the undergrowth of forests, moist shaded places, below
rock boulders, open places and grasslands. More common in dry, gravelly soil in hill
slopes.
Specimens collected and examined: Mysore: Chamundi hills, 10.8.2007, S.K.K.K.
4. Mandya: Melukote forest, 10.11.2007, S.K.K.K. 14; Kunthi betta (Pandavapura),
28.11.2007, S.K.K.K. 20. Chamarajnagar: K. Gudi, 20.6.2008, S.K.K.K. 44; Punjur
Ghat, 19.10.2008, S.K.K.K. 72. Bangalore: Lalbag Garden, 29.8.2008, S.K.K.K. 59.
Ramanagaram: Savanadurga hill top, 14.9.2008, S.K.K.K. 64.
Chitradurga:
Chitradurga fort hill top, 12.11.2008, S.K.K.K. 80. Davanagere: Soolekere hills,
13.11.2008, S.K.K.K. 83. Bagalkot: Hills near Badami, 24.12.2008, S.K.K.K. 87.
Dharwad: Dharwad agriculture university campus, 4.8.2009, S.K.K.K. 97. Tumkur:
Devarayanadurga hill, 1.10.2009, S.K.K.K. 102. Raichur: Devadurga, 26.10.2009,
S.K.K.K. 112. Kodagu: Thithimathi forest, 26.4.2010, S.K.K.K. 116. Bellary:
Yashwanthnagar, 30.8.2011, S.K.K.K. 117.
Type specimen examined (microfiche): India, Malabar, Concan, Herb. Ind. Or.,
Stocks, Law 12 (Kew).
65
66
67
Notes: Phyllanthus scabrifolius can be easily differentiated by its winged and
hispidulous branches, scaberulous leaves and narrow membranous margins of female
calyx lobes. B.D. Naithani 21193 (MH), R.R. Rao 11 (MGM), KFP 2760, 2180, 4417
and 2134 (JCB), Y.S. Maheshwarappa 49 (MGM) specimens bear the name of very
closely related species, P. rheedei. However, they actually belong to P. scabrifolius.
Phyllanthus scabrifolius is very close to P. kozhikodianus Siv. & Mani.
(Chaudhary and Rao, 2002). However, Gangopadhyay et al. (2004) treated P.
kozhikodianus as a synonym of P. rheedei Wight. Close observation of P. scabrifolius
from different parts of Karnataka revealed that morphologically it is very similar to P.
rheedei. Morpholgical characters of both P. scabrifolius and P. rheedei have been
listed in table 3.1.
Table 3.1. Morpholgical characters of P. scabrifolius and P. rheedei
Characters
P. scabrifolius
Stem shape
Terete below and angular above
Cataphyll shape
Triangular-lanceolate, acuminate
Stipule shape
Triangular-lanceolate, acuminate
Leaf
Flowers
Male calyx lobes
Stamens
Filaments
Male disc
glands
Female calyx
lobes
Female disc
Styles
Capsule
Seed
Broadly elliptic or obovate, cuneate or
rounded at base, margin entire, acuteacuminate or mucronate at apex,
scaberulous
Cymules both unisexual and bisexual,
proximal 3-4 nodes with 1 male flowers,
succeeding nodes with 1-2 male flowers
and 1 female flowers and distal nodes
with 1 female flowers
6, membranous, biseriate, unequal, outer
lanceolate, acute, inner ovate-obovate or
obtuse, acute to rounded
3
Connate up to middle, free and spreading
above
6, saucer-shaped with irregular margins
6 (rarely 7), biseriate, unequal, enlarged
and reflexed after fruiting, greenish,
broadly thickened in midrib region, narrow
membranous along margins, outer ones
linear-obovate, acute, inner linear-obovate,
subobtuse
Rounded with irregularly lobed margin
3, free, recurved, distinctly bilobed
5 mm across, depressed-globose, minutely
puberulous
1-2 mm long, trigonous, brownish with 6-8
straight longitudinal lines and many
transverse striae on the back
P. rheedei
Terete below, flat and striate
towards apex
Linear-lanceolate, acuminate
Triangular-lanceolate, acuminate at
apex
Elliptic-obovate, cuneate at base,
entire along margins, acute at apex,
glabrous
Cymules both unisexual or
bisexual, consisting of 1-3 male, 12 male + 1 female (proximal axils)
and/or 1 female flowers at apex
6 (3+3), ovate-elliptic or ellipticoblong, acute to subobtuse at apex,
membranous
3
Connate below for about halfway
to 2/3, free, divergent above
6, minute, roundish, deeply lobed
or stellate, granular
6 (3+3), almost cover the fruit,
ovate-oblong or obovate, acute or
subacute at apex, with narrow
white membranous margins and
thickened remaining portion
Annular, thin, deeply lobed
3, free, shortly to deeply bifid
6-8 mm across, oblate, smooth
2 mm long, trigonous, brown, 6-7
ribs on back with transversely
striations
68
From the above list, it is evident that there are quite a number of
morphological similarities between P. scabrifolius and P. rheedei. Therefore, merger
of these two species is suggested to clear the confusion and the molecular studies may
throw light on their relationships.
Phyllanthus scabrifolius is a rare and endemic species, so far reported only
from Maharashtra, Madhya Pradesh and Karnataka (Hooker, 1887; Cooke, 1901-08;
Chaudhary and Rao, 2002; Murugan et al., 2006). Curiously, Cooke (1901-08) stated
that there is only one specimen of this species in Kew, whereas Chaudhary and Rao
(2002) reported this species from Madhya Pradesh based on solitary collection in
LWG. While reporting a new distribution record for Karnataka, Murugan et al. (2006)
observed only one population of this species consisting of about 25 plants on a dry,
gravely hilly slope near Amingad village, Bagalkot district and they also indicated
that this species may occur in similar habitats. Incidentally, a few populations of P.
scabrifolius were observed during course of this study in Bangalore, Ramangaram,
Mandya, Mysore, Chamarajanagar, Tumkur, Chitradurga, Davanagere, Bellary,
Raichur, Bagalkot, Dharwad and Kodagu districts of Karnataka in similar habitats.
These observations extend its distribution in Southern Peninsular India. Wherever this
species grows, its population size is very small. Therefore, efforts should be taken to
conserve this rare species.
7. Phyllanthus tenellus Roxb., Fl. Ind. 3: 668. 1832; Muell.-Arg. In DC Prodr. 15:
338. 1866; Hook. f. in Hook. Ic. Pl. 1569. 1887; Webster in J. Arnold Arb. 38: 52, f.
6. 1957; Mitra in Bull. Bot. Surv. India 27: 154, f. 1. 1985 (1987); Chen & Wu in
Taiwania 42: 254, f. 3, 69-71, 79. 1997; Tandyekkal & Ramla in J. Eco. Tax. Bot. 21
(3): 733. 1997; Chaudhary & Rao in Phytotaxonomy 2: 157. 2002.
Erect annual herbs, 10-75 cm tall; stem terete, smooth, glabrous, branched
from the base, branches puberulous towards apex. Cataphylls 1-1.5 mm long, linearlanceolate, aristate, with membranous narrow margins and slightly thickened, reddish
middle region. Stipules ca. 1-1.2 mm long, triangular-lanceolate, aristate or more
acuminate at tip, with entire, narrow membranous margins, greenish white or reddish
along middle region. Leaf blade 6-25 × 3-10 mm, membranous, elliptic or obovate,
acute to rounded at the base, entire along margins, acute or obtuse at the apex, lower
surface paler, lateral veins 5-6 pairs; petioles 0.5-0.8 mm long. Cymules both bisexual
69
and unisexual; proximal 2 or 3 nodes with 1-3 male flowers, succeeding nodes with 1
male and 1 female flower or 1 male and 2 female flowers or 2 male and 1 female
flowers and distal most nodes with solitary female flowers. Male flowers minute with
very small pedicels; calyx lobes 5, membranous, broadly obovate; stamens 5, alternate
with disk glands; filaments free; disk glands 5, broadly cuneate with irregular
margins. Female flowers with 5-8 mm long (after anthesis) pedicel; pedicels filiform,
reddish below, thickened, angular, greenish at apex; calyx lobes 5, 0.5-0.8 mm long,
ovate, acute at tip, thickened, broad, greenish or sometimes reddish along midribs
region, membranous along margins; disk patelliform, fleshy but thin, with undulate
margins; styles 3, free, spreading, adpressed to the surface of fruit, distinctly bifurcate
up to 2/3 length with divaricate arms. Capsule ca. 1.5 mm in diam., depressedglobose, smooth; seeds trigonous, 0.8-1 mm long, brown, minutely tuberculate in
longitudinal rows on back (Fig. 3.8).
Flowering and fruiting: Flowering is luxuriant during rainy season, but in favorable
conditions flowering is seen throughout the year.
Distribution: Bangalore, Mysore, Kodagu, Udupi and Chikmagalur. Introduced
weed, but now well naturalized.
Habitat: In garden lawns, planted pots, under hedges and in shady and moist soils.
Specimens collected and examined: Mysore: Biotechnology Department Garden
(MGM), 14.8.2007, S.K.K.K. 5. Udupi: Near Sri Krishna temple, 1.3.2008,
S.K.K.K.30. Chikmagalur: Horanadu temple Garden, 3.5.2008, S.K.K.K. 41.
Bangalore: Lalbag garden, 29.8.2008, S.K.K.K. 60. Kodagu: Raja Seat (Madikeri),
1.11.2008, S.K.K.K. 78.
Type specimen examined: Botanical Garden, Kolkata, Wallich 7892A exp. [Holotype
(Kew)].
Notes: Superficially, P. tenellus resembles P. rheedei Wt. However, it can be easily
separated from the latter by its distinctly longer female pedicels, particularly after
anthesis, and male flowers with five completely free stamens. It seems the species has
colonized in many areas, but has been missed by Botanists. KFP 13797 (JCB) in flora
of Karnataka reported as P. amarus by Saldanha (1996), but it is actually P. tenellus.
Although the herbaceous Phyllanthus species studied so far closely resemble
each other, there are distinct morphological characters to maintain their separate
taxonomic identity. Morphological distinctions of these species are listed in table 3.2.
70
71
Table. 3.2. Morpholgical characters of herbaceous Phyllanthus species
Character
Stem shape
Cataphyll
Stipule shape
Leaf shape
Leaf tip
Leaf base
Flowers
Male calyx
lobes
Stamens
P. amarus
Terete
Present
Triangularlanceolate
Oblong or
ellipticoblong
Obtuse and
shortly
mucronate
Obtuse or
rounded
Unisexual
and
bisexual
cymules
Five (very
rarely six)
Three
P. debilis
P.
maderarpatensis
P. virgatus
Terete
below and
angular
above
Terete below and
striate
and
flattened above
Angular or
winged
Present
Triangularlanceolate
Narrowly
elliptic or
obovate
Obtuse
acute
or
Cuneate or
acute
Absent
Triangularlanceolate
Obovate
spatulate
or
Obtuse
rounded
mucronate
or
Cuneate
Absent
Ovatetriangular
Linear or
oblongelliptic
Obtuse
acute
or
apiculate
Subcordate
or rounded
Unisexual
and
bisexual
cymules
P. urinaria
Terete
below,
flattened
and winged
above
Present
Triangularlanceolate
Oblong or
linearoblong
Obtuse with
distinct
mucronate
Unequal
Unisexual
cymules
P.
scabrifolius
P. tenellus
Terete
below and
angular
above
Terete
Present
Triangularlanceolate
Broadly
elliptic or
obovate
Present
Triangularlanceolate
Elliptic or
obovate
Acute
acuminate
Acute
Cuneate or
rounded
Unisexual
and
bisexual
cymules
Acute
to
rounded
Unisexual
and
bisexual
cymules
Unisexual
cymules
Unisexual
and
bisexual cymules
Six
Six
Six
Six
Six
Five
Three
Three
Three
Three
Five
Completely
connate
Free
Completely
connate
Three
Connate up
to middle,
free
and
spreading
above
6, cuneate
with
irregular
margins
Filaments
Completely
connate
Almost
connate and
free at the
apex
Male disk
glands
5, saucershaped with
irregular
margins
6, saucershaped with
irregular
margins
6, almost rounded
6, orbicular
to almost
round
Female calyx
lobes
Five (very
rarely six)
Six
and
unequal
Six and unequal
Six
Six
Female disk
flat, deeply
5-lobed
shallowly
6-lobed
6-lobed
Flat,
undivided
6-lobed
Depressedglobose
smooth
and
Depressedglobose,
densely
warty
(tubercled)
in young
condition,
smooth at
maturity
Depressedglobose,
prominently
tuberculate
Depressedglobose,
minutely
puberulous
Depressedglobose and
smooth
Triquetrous with
concentric lines
of
minute
tubercles
and
minute crossbars
Trigonous,
minutely
tubercled,
tubercles
arranged in
several
vertical
concentric
rings
Trigonous
with 12-15
prominent
transverse
ridges and
with faint
crossbars
on
the
rounded
back side
Trigonous
with
6-8
straight
longitudinal
lines
and
many
transverse
striae on the
back
Trigonous,
minutely
tuberculate
in
longitudinal
rows
on
back
Capsule
Seed
Globose
and smooth
Trigonous
with
6-7
straight
parallel
longitudinal
ribs on back
Depressedglobose and
smooth
Trigonous
with
6-7
straight
longitudinal
ribs
and
many fine
transverse
striae on the
back
6, saucershaped with
irregular
margins
Six (rarely
seven) and
unequal
Rounded
with
irregularly
lobed
margin
Free
5, broadly
cuneate
with
irregular
margins
Five
Patelliform,
fleshy with
undulate
margins
Based on distinct morphological characters, especially taking into account the
shape of the leaf, a simple key for authentic taxonomical identification of herbaceous
Phyllanthus species has been developed.
72
73
3.3.2 Molecular authentication
The ITS regions of DNA were sequenced for nine different herbaceous species
of Phyllanthus by using ITS 1 and ITS 4 primers (5' TCCGTAGGTGAACCTGCGG
3' and 5' TCCTCCGCTTATTGATATGC 3'). These primers amplified the ITS1, 5.8S
and part of the ITS2 region (Fig. 3.9).
Fig. 3.9: Amplified DNA ITS regions of Phyllanthus species. Lane M. λ DNA, 1.
P. amarus, 2. P. debilis, 3. P. maderaspatensis, 4. P. virgatus, 5. P. urinaria, 6. P.
scabrifolius, 7. P. rheedei, 8. P.kozhikodianus, 9. P. tenellus.
The PCR amplified products were purified from excess salts and primers and
then sequenced. Generated sequences were checked for orthology by comparing them
with the existing sequences in the NCBI (National Centre for Biotechnology
Information) database. Except for P. scabrifolius, P. rheedei and P. kozhikodianus,
other six herbaceous Phyllanthus species sequences matched with the already existing
sequences. Generated ITS sequences of nine different herbaceous species of
Phyllanthus were submitted to GenBank database and accession numbers were
obtained (Table 3.3). For the first time ITS sequences were generated for P.
scabrifolius and P. kozhikodianus. Although there are few P. rheedei ITS sequences
are present in NCBI database, the ITS sequence generated for P. rheedei in the
present study did not match with them.
74
Multiple alignments were performed using multalign. It clearly differentiated
the related Phyllanthus species although close similarities were observed among P.
scabrifolius, P. rheedei and P. kozhikodianus (Fig. 3.10)
Table 3.3. Voucher and accession numbers of herbaceous Phyllanthus species
Phyllanthus
speicies
Voucher
No.
Matching
sequence
accession
no. in
NCBI
AY936668.
1
AY936686.
1
AY936707.
1
AY831635.
2
GenBank
accession
No. of
submitted
sequence
P. amarus
SKKK 2
P. debilis
SKKK 6
P. maderaspatensis
SKKK 1
P. virgatus
SKKK 3
P. urinaria
SKKK 7
AB550081.1
KF312393
P. scabrifolius
SKKK 4
------------
KF003023
P. rheedei
SKKK 75
-----------
KF312394
P. kozhikodianus
SKKK 101
------------
KF312395
P. tenellus
SKKK 5
AY936733.
1
KF312396
Primer sequence
KF312389
KF312390
KF312391
KF312392
5'TCCGTAGGTG
AACCTGCGG3'
5'TCCTCCGCTTA
TTGATATGC3'
Finally, the dendrogram was constructed using ClustalW2 software (Fig.
3.11). It clearly formed three clusters. Cluster I consists of Phyllanthus species, which
are generally included in ‘Bhumyamalaki’ complex. Morphologically very closely
related species P. scabrifolius, P. rheedei, P. kozhikodianus and P. tenellus are nested
in cluster II. P. virgatus, morphologically a distinct species, formed an out group.
75
Fig. 3.10: Multiple alignment of Phyllanthus species ITS sequences. 1. P. amarus,
2. P. debilis, 3. P. maderaspatensis, 4. P. virgatus, 5. P. urinaria, 6. P. scabrifolius,
7. P. rheedei, 8. P. kozhikodianus, 9. P. tenellus.
76
Fig. 3.11: Dendrogram of Phyllanthus species generated based on ITS sequence
homology by ClustalW2.
3.4 Discussion
Most of the taxonomic keys are generally highly technical and so very
exhaustive that they are suitable for advanced scientific studies but are beyond the
comprehension of non-scientific users. Therefore, keys for nonprofessional with
minimal technical details should either be developed or abridged from elaborate ones
(Kandavel et al., 2011). Present study attempted to achieve this goal. The key
characters presented here to a large extent can be examined with naked eye and does
not need any laboratory instruments or techniques. Intentionally, number of female
calyx lobes taken as a major distinguishing character since female calyx persists even
in fruit. Along with the number of stamens, nature of filaments and fruits, key is
mainly focused on the shape of leaf. For easy identification of related herbaceous
Phyllanthus species, leaf photographs of each species are given along with key
characters.
Phyllanthus amarus can be easily distinguished from other members of
‘Bhumyamalaki’ or ‘niruri complex’ by its unique characteristics of oblong leaves
with obtuse-mucronate tip and 5-lobed female calyx. P. tenellus also has 5-lobed
female calyx. That may be the reason why Saldanha (1996) confused the characters of
77
P. tenellus with P. amarus in flora of Karnataka. However, P. tenellus is distinct in
having five free stamens and elliptic leaves. Other herbaceous Phyllanthus species
have 6-lobed female calyx. P. urinaria is distinct in having oblong leaves with
unequal base and obtuse mucronate tip, hispidulous leaf margins and prominently
tuberculate fruits. P. virgatus has linear or oblong-elliptic leaves with subcordate base
and long-stalked and slightly tuberculate fruits, at least in young condition. However,
it is often confused with closely related species, P. gardnerianus (Wight) Baillon., as
is the case in the flora of Chikmagalur by Yoganarasimhan et al. (1981). P.
maderaspatensis is quite different from the rest in having obovate or spatulate leaves
with obtuse or rounded mucronate tip and unequal female calyx lobes with rhomboidobovate shape. P. debilis and P. scabrifolius share a few morphological characters.
That might be the reason for inclusion of P. debilis from Gulbarga and Kodagu
instead of P. scabrifolius (Singh, 1988; Murthy and Yoganarasimhan, 1990).
However, leaf shape and union of staminal filaments can differentiate them. Leaves of
P. debilis are narrowly elliptic or obovate with obtuse or acute apex, whereas P.
scabrifolius has scaberulous and broadly elliptic or obovate leaves with acuteacuminate apex. Staminal filaments of P. debilis are almost connate and free only at
the apex, whereas P. scabrifolius staminal filaments connate up to middle, free and
spreading above.
Present field studies and observation of herbarium specimens revealed that P.
fraternus is not available in Karnataka. Earlier reports of this species from Hassan
(Saldanha and Nicolson, 1976), Gulbarga (Seetharam et al., 2000) and Bellary
(Saldanha, 1996) are due to wrong identification of specimens. These specimens are
actually belonging to P. amarus. Same thing happened to P. asperulatus in flora of
Bangalore and Mysore (Ramaswamy and Razi, 1973; Rao and Razi, 1981). They
wrongly treated the P. amarus as P. asperulatus, which does not occur in India.
Saldanha’s (1996) doubt regarding the occurrence of P. debilis Klein ex willd., from
Gulbarga and Kodagu has been solved. Reported specimens actually belong to P.
scabrifolius. Chaudhary and Rao (2002) mentioned P. debilis is distributed only in
coastal areas. However, our field studies confirmed the occurrence of this species in
‘Ghats’ along with coastal regions and even in South-Eastern districts (inland) of
Karnataka. Close observation of P. scabrifolius from different parts of Karnataka
revealed that morphologically it is very similar to P. rheedei. Earlier reports of
78
P. rheedei from Bangalore and Mysore (Ramaswamy and Razi, 1973; Rao and Razi,
1981) has been misidentified for P. scabrifolius. Probably that was the reason for noninclusion of this species distribution in Karnataka by Chaudhary and Rao (2002). In
the present study, P. rotundifolius Klein ex willd. from Biligirirangana hills was not
found as reported by Rao and Razi (1981). This species might have been eradicated
from said area due to habitat destruction.
It has become common to add admixtures with morphologically allied and
geographically co-occurring species to raw drugs (Nair et al., 1983; Bisset, 1984;
Sunita, 1992; Khatoon et al., 2006; Mitra and Kannan, 2007; Ved and Goraya, 2008;
Srirama et al., 2010). Due to a high level of morphological similarity among the
herbaceous Phyllanthus species (Chaudhary and Rao, 2002; Ganeshaiah et al., 1998),
raw drug samples often contain species admixtures (van Rhede, 1690; Dymock, 1883;
Dymock et al., 1893; Kirtikar and Basu, 1935; Nadkarni, 1954). An attempt was made
by Palaniappan and Marappa (2006) to assess the extent of genetic diversity in P.
amarus and two of its related species, P. debilis and P. virgatus, using RAPD and
ISSR markers which yielded low level of genetic diversity in P. amarus. RAPD
markers are difficult to reproduce and therefore preferentially converted to more
specific SCAR markers for better reproducibility. Jain et al. (2008) developed SCAR
markers for four Phyllanthus species, namely P. amarus, P. debilis, P, fraternus and
P. urinaria. SCAR markers (Jain et al., 2008) and DNA barcodes (Srirama et al.,
2010) are helpful in distinguishing the related Phyllanthus species. SCAR Analysis
for validating the identity of P. amarus was carried out by Kandavel et al. (2011).
However, development of SCAR markers are little complicated and DNA barcodes
are not prepared for all the Phyllanthus species. Sequence comparison of the ITS
region is widely used in taxonomy and molecular phylogeny because of high copy
number of rRNA genes as it is easy to amplify even from small quantities of DNA
and has a high degree of variation even between closely related species. This can be
explained by the relatively low evolutionary pressure acting on such nonfunctional
sequences. It has proven to be useful for checking relationships among species and
various genera in Asteraceae (Baldwin, 1993).
Bandyopadhyay and Raychaudhury (2010) developed ITS based SCAR markers
for identification of five medicinally important species of Phyllanthus. However, they
developed ITS based SCAR markers for only three herbaceous Phyllanthus species,
79
namely, P. amarus, P. fraternus and P. urinaria. In the present study, ITS sequences
were generated for nine different herbaceous Phyllanthus species. Most of the
sequences generated from Phyllanthus species using ITS primers in the present study
were matched with the existing sequences in the NCBI database except for P.
scabrifolius, P. rheedei and P. kozhikodianus. For the first time ITS sequences were
generated for P. scabrifolius and P. kozhikodianus. Although there are few P. rheedei
ITS sequences are present in NCBI database, the ITS sequence generated for P. rheedei
in the present study did not matched with them. This might be due to wrong
identification of the plant material.
Interestingly the Phyllanthus species, which are generally included in
‘Bhumyamalaki’ complex, are nested in Cluster I. This indicates relationship between
them. Chaudhary and Rao (2002) observed morphological similarities between P.
scabrifolius, P. rheedei, P. kozhikodianus and P. tenellus. All these four species are
nested in cluster II. P. rheedei and P. kozhikodianus are nested in same sub cluster.
This result validates the synonymisation of P. kozhikodianus under P. rheedei
(Gangopadhyay et al., 2004). Morphological similarities observed in the present study
between P. scabrifolius and P. rheedei also got validation from the dendrogram
generated here. However, for merging of these two species, further molecular
analyses are warranted.
Out-grouping of P. virgatus is justified by their non-
phyllanthoid branching and undivided female flower disk. Though lot of molecular
work has been done earlier on the ‘Bhumyamalaki’ or ‘niruri’ complex, not much
attention was paid to P. scabrifolius, P. rheedei and P. kozhikodianus complex.
Present ITS analysis validates the morphological similarities observed between these
species by Chaudhary and Rao (2002) and also clearly distinguished each species of
this complex. In addition, clear demarcation was made between members of
‘Bhumyamalaki’ or ‘niruri’ complex. While the search for an universal barcode(s) for
plants is still on, present study suggests that candidate regions like nrITS can be used
for identification and authentication of specific taxa. Using both morphotaxonomical
keys and molecular techniques like ITS analysis, authentication of herbaceous
Phyllanthus species used in medicine can be carried out.
80