Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
The Genome Analysis Centre Building Excellence in Genomics and Computational Bioscience TILLING @ TGAC Sarah Ayling Crop Genomics and Diversity [email protected] The Genome Analysis Centre Building Excellence in Genomics and Computational Bioscience The Genome Analysis Centre The Genome Analysis Centre Definitions Forward genetics is the approach of determining the genetic basis responsible for a phenotype – classical genetics Reverse genetics is an approach to discover the function of a gene by analyzing the phenotypic effects of specific engineered gene sequences. TILLING: Targeting Induced Local Lesions in Genomes Source: Wikipedia The Genome Analysis Centre The Genome Analysis Centre TILLING by sequencing Induce genetic variation Base changes: C > T; G > A GCGATGAGCTCGAAGACGCA GCGATAAGCTCGAAGATGCA Detect base changes in genes Phenotype plants with changes in your gene of interest Sequence once, database for everyone… The Genome Analysis Centre TILLING projects: Brassica rapa Triticum aestivum The Genome Analysis Centre The Genome Analysis Centre Triangle of U black mustard turnip, Chinese cabbage broccoli, cabbage oil seed rape, swede Wikipedia (U, Jpn J Bot 7:389452, 1935) The Genome Analysis Centre The Genome Analysis Centre Triangle of U black mustard turnip, Chinese cabbage broccoli, cabbage oil seed rape, swede Wikipedia (U, Jpn J Bot 7:389452, 1935) The Genome Analysis Centre The Genome Analysis Centre Mutant Areas ofpopulation Activity - brassica Genotype: R-o-18 • Inbred line of B. rapa subsp. Trilocularis (Yellow Sarson) • Closely related to B. rapa oilseed crops grown in Pakistan EMS population developed in Lars Østergaard group, >1000 lines Treat seed with EMS (ethyl methanesulfonate) (0.3 and 0.4%) Grow M1 plants (G:C to A:T mutations) Self-fertilise and harvest seed Grow M2 plants Harvest M3 seed Extract DNA Stephenson et al., BMC Plant Biology 2010 The Genome Analysis Centre The Genome Analysis Centre Slide: Jon Wright Polyploid wheat The Genome Analysis Centre The Genome Analysis Centre Polyploid wheat The Genome Analysis Centre The Genome Analysis Centre Mutant Areas ofpopulation Activity - wheat Genotype: Triticum aestivum cv Cadenza (Bread wheat) EMS population developed in Andy Philips group, >1500 lines as part of WGIN1 Treat seed with EMS (ethyl methanesulfonate) Grow M1 plants (G:C to A:T mutations) Self-fertilise and harvest seed Grow M2 plants Harvest M3 seed The Genome Analysis Centre The Genome Analysis Centre Extract DNA Exome capture Bamshad et al., Nature Reviews Genetics, 2011 The Genome Analysis Centre The Genome Analysis Centre B. rapa genome & annotation The Genome Analysis Centre B. rapa capture design B. rapa genome http://brassicadb.org, v1.2 41,019 protein-coding genes, 48 Mb total sequence 48 Mb 30 Mb Conserved domain CODDLE-like: Comai lab (Codons Optimized to Detect Deleterious Lesions) The Genome Analysis Centre The Genome Analysis Centre Slide: Jon Wright Sequencing strategy • • • • Paired-end Illumina Fragment size: 300bp Read lengths: 2x150bp 24-plex run over 2 lanes • = 12-plex The Genome Analysis Centre The Genome Analysis Centre Sequencing results 998 Number of samples processed 25,892,695 Mean number of reads per sample 3,755,166 Minimum number of reads for a sample 38.5 Mean target coverage Mean percentage of targets with <2x coverage Mean percentage of target bases with >=10x coverage 5.1 86.3 Target coverage variability between samples 120 60 Samples 0 The Genome Analysis Centre The Genome Analysis Centre Slide: Jon Wright MAPS pipeline BWA mapping Picard MarkDuplicates MAPS part1: (whole batch) minLib=n-2 minCov=10 maxCov=1000 hetOneMinPer=20 Mpileup MAPS part2: MAPS part1 MAPS part2 (per sample) minLib=n-2 minCov=10 hetMinPer=30 homMinCov=3 hetMinCov=6 REF x x x x x x x x line1 x line2 line3 line4 line5 line6 line7 line8 Henry et al. 2014. Plant Cell The Genome Analysis Centre The Genome Analysis Centre Results Mean number of mutations per sample Mean mutation density 1188.7 1 per 49.9 kb % Homozygous 10 % Heterozygous 90 Mean % EMS mutations (C:G->A:T) 99.1 ACGT The Genome Analysis Centre The Genome Analysis Centre Slide: Jon Wright Results 92.2% of B. rapa genes contain non-synonymous mutations The Genome Analysis Centre The Genome Analysis Centre Slide: Jon Wright Accessing the data Slide: Jon Wright Accessing the data Slide: Jon Wright Accessing the data Slide: Jon Wright Coming soon to revgen.jic.ac.uk The Genome Analysis Centre Next steps? • Order your seeds (multiple mutants per gene) • Grow your plants • Check phenotypes • Cross/self to obtain homozygous alleles • Check with KASP markers • Grow your plants • Check phenotypes • Publish The Genome Analysis Centre Acknowledgements Brassica: Jon Wright Wheat: Paul Bailey Ksenia Krasileva Ricardo RamirezGonzales Platforms & Pipelines: Leah Clissold and team Trevor Wang Fran Robson Lars Østergaard Saleha Bakht Andy Phillips The Genome Analysis Centre Cristobal Uauy Jorge Dubcovsky Hans VasquezGross Luca Comai Meric Lieberman Isabelle Henry