Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Supplemental File S6: Answer key for the example worksheets to assess achievement of learning objectives 3, 4, and 6. Instructions 1. Using the DNA template shown below, underline the template sequence where the two primers will annel. Label the underlined sequence as “Primer 1” or “Primer 2”. 2. Using the DNA template and primers shown below, write the sequence of the resulting PCR product (after 30 cycles). Be sure to align your product with the sequence shown. 3. Draw a box around the site(s) on the PCR product that would be recognized and cleaved by EcoRI. (3’5’ Primer 2) 3-‘gcatattgccccatc-5’ 5’-GTTGTATCGTACATAGGATCGATAGGCTAGACGAATTAGACTTACGTATAACGGGGTAGACAGATATTTAG-3’ 3’-CAACATAGCATGTATCCTAGCTATCCGATCTGCTTAATCTGAATGCATATTGCCCCATCTGTCTATAAATC-5’ 5’-tcgtacataggatcg-3’ Primer 1 (5’3’) Primer 1: Primer 2: 5’ CGAATTCTCGTACATAGGATCC 3’ 5’ GGAATTCCTACCCCGTTATACG 3’ EcoRI recognition site: 5’-GAATTC-3’ 3’-CTTAAG-5’ 5’-CGAATTCTCGTACATAGGATCGATAGGCTAGACGAATTAGACTTACGTATAACGGGGTAGGAATTCC-3’ 3’-GCTTAAGAGCATGTATCCTAGCTATCCGATCTGCTTAATCTGAATGCATATTGCCCCATCCTTAAGG-5’ Instructions The diagram below shows a 310 bp fragment of double-stranded DNA. Above the fragment, the sizes of various segments of DNA are shown (in base pairs). Below the DNA fragment, various primers, labeled A through F are shown. 30 Size (in bp) 50 30 150 30 20 5’ 3’ 5’ 3’ 1. 3’ 5’ A B 3’ 5’ 5’ 3’ C D 3’ 5’ 5’ 3’ E F 3’ 5’ Predict the size of the PCR product (if any) that will be produced from the following primer pairs. Primers Product? yes/no A and CNn no A and F yes C and E no D and F no Product Size (bp) 290 2. Which primer pairs will produce a product that is 210 bp? Primers C and F 3. Which primer pairs will produce a product that is 190 bp? Primers A and D