Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download 3D protein structure - Diamantina Institute
Document related concepts
no text concepts found
Transcript
SPARQ-ed PROJECT Mutations in the tumor suppressor gene p53 Pulari Thangavelu (PhD student) April 5 2016 Chromosome Instability Group UQ Diamantina Institute Name of presentation Month 2009 Assignment: To find the mutation being introduced into the p53 protein, given a particular primer sequence DNA is made up of nucleotides. A nucleotide is made up of deoxyribose sugar, a nitrogenous base (A/T/G/C) and a phosphate group. The four bases found in DNA EXAMPLE PRIMER SEQUENCE tgatgctgtccccgcacgatattgaacaa Name of presentation Month 2009 STEP 1: Obtain the p53 nucleotide sequence from PUBMED database. Go to the PUBMED database and select ‘Nucleotide’ in the dropdown menu Name of presentation Month 2009 Type in p53 in the search box and click search. Select Homo Sapiens in the ‘Results by taxon’ section. Name of presentation Month 2009 Select the first p53 mRNA sequence shown (Note: this is a complete coding sequence for the p53 protein), 2,451 bp linear mRNA, Accession: AB082923.1, GI: 23491728 Name of presentation Month 2009 At the very end of the page, you will see the nucleotide sequence of the p53 protein. Immediately above the sequence, there is the amino acid sequence under the subheading ‘CDS’. Click CDS to highlight the coding region in the nucleotide sequence. Name of presentation Month 2009 Now copy the nucleotide sequence into the space below and highlight the CDS region in red: ORIGIN 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261 1321 1381 1441 1501 1561 1621 1681 1741 1801 1861 1921 1981 2041 2101 2161 2221 2281 2341 2401 cgtgctttcc gccatggagg tcagacctat atggatgatt ccagatgaag cctacaccgg cagaaaacct aagtctgtga acctgccctg atggccatct gagcgctgct aatttgcgtg tatgagccgc agttcctgca tccagtggta agagaccggc cccccaggga aagaaaccac atgttccgag ggggggagca cataaaaaac gttccccact tctttgaacc tgtcccgggg tggggagtag atgtaagaaa gcccacttca aaggcccata ttaatgaaat tgaccccctt agttgggcag gtctgacaac ctggaggatt agggtcaatt ctttgttgcc ccggctcgag atggccagcc gtctcaaact caattgtgag tctgcatttt atctcttatt acgacggtga agccgcagtc ggaaactact tgatgctgtc ctcccagaat cggcccctgc accagggcag cttgcacgta tgcagctgtg acaagcagtc cagatagcga tggagtattt ctgaggttgg tgggcggcat atctactggg gcacagagga gcactaagcg tggatggaga agctgaatga gggctcactc tcatgttcaa gacagcctcc cttgcttgca ctccactgaa gacataccag tgttcttgca ccgtactaac tctgtgaaat aatgtacatc gagggtgctt ctggttaggt ctcttggtga tcatctcttg tcttttttct caggctggag cagtcctgcc aacttttgca cctgggctca ccaccacgtc caccccaccc ttacaataaa cacgcttccc agatcctagc tcctgaaaac cccggacgat gccagaggct accagccccc ctacggtttc ctcccctgcc ggttgattcc acagcacatg tggtctggcc ggatgacaga ctctgactgt gaaccggagg acggaacagc agagaatctc agcactgtcc atatttcacc ggccttggaa cagccacctg gacagaaggg cacccccatc ataggtgtgc caagttggcc cttagatttt gttaagggtt cagggaagct gctggcattt tggccttgaa gttccctctc agagggagtt accttagtac tatatgatga tttttttttt tggagtggcg tcagcctccg tgttttgtag ggcgatccac cagctggaag ttcccctcct actttgctgc tggattggcc gtcgagcccc aacgttctgt attgaacaat gctccccgcg tcctggcccc cgtctgggct ctcaacaaga acacccccgc acggaggttg cctcctcagc aacacttttc accaccatcc cccatcctca tttgaggtgc cgcaagaaag aacaacacca cttcagatcc ctcaaggatg aagtccaaaa cctgactcag tctccctccc gtcagaagca tgcactggtg aaggttttta agtttacaat gtccctcact gcacctacct accacctttt cctgttggtc gtcaagtctc ctaaaaggaa tctggatcca ttttttcttt tgatcttggc gagtagctgg agatggggtc ctgtctcagc ggtcaacatc tctccctttt caaaaaaaaa agactgcctt ctctgagtca cccccttgcc ggttcactga tggcccctgc tgtcatcttc tcttgcattc tgttttgcca ccggcacccg tgaggcgctg atcttatccg gacatagtgt actacaacta ccatcatcac atgtttgtgc gggagcctca gctcctctcc gtgggcgtga cccaggctgg agggtcagtc actgacattc ctgccatttt cccaggactt ttttgttgtg ctgtgaggga cagccacatt gttgaatttt cacagagtgc attacatggg ggtgggttgg tgctggccca atctcacccc ccaagacttg ttctttgaga ttactgcagc gaccacaggt tcacagtgtt ctcccagagt ttttacattc tatatcccat aaaaaaaaaa ccgggtcact ggaaacattt gtcccaagca agacccaggt accagcagct tgtcccttcc tgggacagcc actggccaag cgtccgcgcc cccccaccat agtggaagga ggtggtgccc catgtgtaac actggaagac ctgtcctggg ccacgagctg ccagccaaag gcgcttcgag gaaggagcca tacctcccgc tccacttctt gggttttggg ccatttgctt gggaggagga tgtttgggag ctaggtaggg ctctaacttc attgtgaggg gtctagaact tagtttctac gccaaaccct atcccacacc ttttatgctc ctgggtctcg ctttgcctcc tcatgccacc gcccaggctg gctgggatta tgcaagcaca ttttatatcg a // Name of presentation Month 2009 STEP 2: Compare and find out which region your particular primer binds to in the p53 coding sequence. Using google, search for ‘nucleotide blast’ – an NCBI sequence alignment program and open the following page. Name of presentation Month 2009 Copy and paste your primer sequence in the QUERY box and your p53 nucleotide sequence in the SUBJECT box. Click on BLAST. The colourful box shows a visual representation of your results while the exact nucleotide matches are shown below. Name of presentation Month 2009 The query sequence (1-29 nucleotides in length) matched exactly to the subject sequence from its nucleotide sequence starting from 194-222. Now go back to your nucleotide sequence and highlight in yellow, the corresponding region (194-222). NOTE: There will be a mismatch of one nucleotide (which is your mutation). Also, the reverse primers will map in the 3’ to 5’ direction. Name of presentation Month 2009 STEP 3: Find out which amino acid is being mutated and what the mutation is. Copy your CDS (coding sequence highlighted in red) from the nucleotide sequence below. 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 atggagg tcagacctat atggatgatt ccagatgaag cctacaccgg cagaaaacct aagtctgtga acctgccctg atggccatct gagcgctgct aatttgcgtg tatgagccgc agttcctgca tccagtggta agagaccggc cccccaggga aagaaaccac atgttccgag ggggggagca cataaaaaac agccgcagtc ggaaactact tgatgctgtc ctcccagaat cggcccctgc accagggcag cttgcacgta tgcagctgtg acaagcagtc cagatagcga tggagtattt ctgaggttgg tgggcggcat atctactggg gcacagagga gcactaagcg tggatggaga agctgaatga gggctcactc tcatgttcaa agatcctagc tcctgaaaac cccggacgat gccagaggct accagccccc ctacggtttc ctcccctgcc ggttgattcc acagcacatg tggtctggcc ggatgacaga ctctgactgt gaaccggagg acggaacagc agagaatctc agcactgtcc atatttcacc ggccttggaa cagccacctg gacagaaggg gtcgagcccc aacgttctgt attgaacaat gctccccgcg tcctggcccc cgtctgggct ctcaacaaga acacccccgc acggaggttg cctcctcagc aacacttttc accaccatcc cccatcctca tttgaggtgc cgcaagaaag aacaacacca cttcagatcc ctcaaggatg aagtccaaaa cctgactcag ctctgagtca cccccttgcc ggttcactga tggcccctgc tgtcatcttc tcttgcattc tgttttgcca ccggcacccg tgaggcgctg atcttatccg gacatagtgt actacaacta ccatcatcac atgtttgtgc gggagcctca gctcctctcc gtgggcgtga cccaggctgg agggtcagtc actga ggaaacattt gtcccaagca agacccaggt accagcagct tgtcccttcc tgggacagcc actggccaag cgtccgcgcc cccccaccat agtggaagga ggtggtgccc catgtgtaac actggaagac ctgtcctggg ccacgagctg ccagccaaag gcgcttcgag gaaggagcca tacctcccgc Name of presentation Month 2009 A codon is a group of three nucleotides coding for a single amino acid. Please refer to the codon table provided below to know the composition of each amino acid. As you will notice, ATG is a start codon (first codon of your sequence in red) and TGA is a stop codon (last codon of your sequence in red). Amino acid Ala/A Arg/R Codons GCT, GCC, GCA, GCG CODON TABLE Compresse Amino acid d GCN Leu/L CGN, MGR Lys/K Asn/N Asp/D Cys/C CGT, CGC, CGA, CGG, AGA, AGG AAT, AAC GAT, GAC TGT, TGC AAY GAY TGY Met/M Phe/F Pro/P Gln/Q CAA, CAG CAR Ser/S Glu/E GAA, GAG GAR Thr/T Gly/G GGT, GGN GGC, GGA, GGG CAT, CAC CAY ATT, ATC, ATH ATA ATG Trp/W His/H Ile/I START Tyr/Y Val/V STOP Codons Compresse d YTR, CTN TTA, TTG, CTT, CTC, CTA, CTG AAA, AAG AAR ATG TTT, TTC CCT, CCC, CCA, CCG TCT, TCC, TCA, TCG, AGT, AGC ACT, ACC, ACA, ACG TGG TAT, TAC GTT, GTC, GTA, GTG TAA, TGA, TAG TTY CCN TCN, AGY ACN TAY GTN TAR, TRA Name of presentation Month 2009 Next, split your above sequence into groups of three (i.e. into each codon) as shown below. 1 2 3 4 5 6 7 8 9 10 11 atg tca gca cca cca tct cat ttt ccc gtt cct aac tgt cgg cgg gaa aag gat gag agc aaa gag gac atg ggt gca gtc tct tgc ggc gtg cag act acc agg aac gag cga gga ctg agg aaa gag cta gat cca gct cct ggg caa acc agg cat ttt acc ccc agc aat gca gaa aat gct ctc ccg tgg gat gat cct tcc aca ctg cgc cgc ctt cga atc atc ttt ctc ctg tat gag cac atg cag aaa ttg gaa aca cag gcc gcc gtc tgc atc cat cac ctc gag cgc tcc ttc gcc tcc ttc tca cta atg gct ccg aaa aag aag cgc ccc cga agt tac acc gtg aag aac acc ttg agc aag gat ctt ctg ccc gcg acc tct acc gcc cac gtg gtg aac atc cat aaa aac ctt gaa cac aca cct cct tcc aga gcc tac gtg tgc atg cat gaa gtg tac atc gtt ggg acc cag ctc ctg gaa agc gaa ccg atg cct cag act cct gcc gag gga gtg atg aca tgt gag agc atc aag aag ggg gtc aac gac cca gca ggc tgc gtg atc cgc aat ccc tgt ctg gcc cct tcc cgt gat tcc cct gag aac gat gag cca agc acg cag tac tgc ttg tat aac gaa tgt cac tct ggg gcc aaa gac 12 13 ccc gtt att gct gcc tac tac ctg aag tca cgt gag agt gac cct cac ccc cgt cag aag tca cct ctg gaa gct ccc ggt tcc tgg cag gat gtg ccg tcc tcc ggg gag cag gag gct ggt gac 14 15 ctg tcc caa ccc tcc ttc cct gtt tca agc gag cct tgc agt aga ctg cca cgc ggg cag tga agt ccc tgg cgc tgg cgt gcc gat cag gat tat gag atg ggt gac ccc aag ttc aag tct 16 17 18 19 cag ttg ttc gtg ccc ctg ctc tcc cac ggt ttg gtt ggc aat cgg cca aag gag gag acc gaa ccg act gcc ctg ggc aac aca atg ctg gat ggc ggc cta cgc ggg aaa atg cca tcc aca tcc gaa cct tca ttc aag ccc acg gcc gac tct atg ctg aca agc cca ttc ggg cgc ttt caa gac gca tct ttg atg ccg gag cct aga gac aac gga gag act ctg cga ggg cat Name of presentation Month 2009 Now, copy below the highlighted primer region and pick out the mutation site. In this particular sequence, the codon being mutated is as follows: GAC With ‘G’ being mutated Using your codon table, identify which amino acid ‘GAC’ codes for and write it below. GAC codes for the amino acid Aspartic acid. From your primer sequence, you can notice that ‘G’ has been replaced by ‘C’. This mutation will now change the codon to encode for: CAC which codes for the amino acid Histidine. EXAMPLE PRIMER SEQUENCE tgatgctgtccccgcacgatattgaacaa Name of presentation Month 2009 Results Thus we know that at the 48 amino acid position, the codon ‘gac’ is being mutated to ‘cac’ which means that an aspartic acid is being converted into a histidine amino acid. This can be written in notations as below: D48H Name of presentation Month 2009 EXERCISE A protein’s secondary structures may be visualized in 3D using various softwares like DeepView. These structures are generated using different techniques, for e.g. x-ray crystallography and published in various journals. All these structures are also available in databases like RCSB protein data bank (see below). In this exercise, we shall look into the p53 protein structure and observe the mutations being introduced in this project. Name of presentation Month 2009 I have previously downloaded the p53 homotetramer structure, PDB ID: A2HI. Open this structure using the DeepView software. We can see the various control and visualization panels below: Name of presentation Month 2009 We can un-highlight a single p53 protein using the control panel (right). Name of presentation Month 2009 Now, we can highlight a particular mutation, for e.g. R248G which is a change from Arginine to Glycine at the 248th position, using the control panel. In this structure we can observe Arginine at the 248th position. In the PCR we did yesterday, one set of primers introduced a change in this particular Arginine and changed it into a Glycine. Name of presentation Month 2009 FUTURE EXERCISE You can also study how this would affect various changes like DNA binding effects (if the mutation is in the DBD domain), electrostatic potentials, creation and deletion of different types of bonds, etc using this software. A pdf manual for this software is available for your perusal in your downtime. You may also find other p53 structures with other mutations in the RCSB database. Some examples are below: 1) V143A - http://www.rcsb.org/pdb/explore.do?structureId=2j1w PDB ID code 2J1W 2) R248G - http://www.nature.com/onc/journal/v26/n15/fig_tab/1210291f1.html#figure-title PDB ID code 2AHI 3) R175H - http://www.nature.com/onc/journal/v26/n15/fig_tab/1210291f1.html#figure-title PDB ID code 2AHI Name of presentation Month 2009
Related documents