Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Supplementary information
Document related concepts
no text concepts found
Transcript
Fig. S1. Increase of RUNX1 staining in EC culture. Triple staining showing the use of human AcLDL uptake to reveal the ECs in green, the RUNX1 transcription factor expression as revealed by immunofluorescence in pink and the DAPI stained nuclei in blue at day 1 (A), 2 (B) and 3 (C) of culture. Note the growing number of RUNX1 positive nuclei with time. Development • Supplementary information Development 143: doi:10.1242/dev.126714: Supplementary information Development 143: doi:10.1242/dev.126714: Supplementary information Fig. S2. Comparison between PSM, somites and lateral plate mesoderm isolated from from one representative experiment. FACS analysis could not be performed for the lateral plate due to the low number of cells obtained. The dot plots are the result of 2000 events analyzed. Development • Supplementary information embryos at the same somitic stage for their capacities to give rise to ECs. Dot plots are Fig. S3. PSM cultures in different growth factor conditions. In the absence of VEGF, PSM cells readily differentiate into flat, EC-like cells that are reminiscent of the cells obtained when PSM cells are placed in the absence of FCS (Figure 5C,D). When VEGF alone was added, an accelerated EC differentiation was observed quickly followed by a round, hematopoietic cell production. Cultures have been run from day (D) one to either D2 to 5 depending on the development of the culture. Development • Supplementary information Development 143: doi:10.1242/dev.126714: Supplementary information Development 143: doi:10.1242/dev.126714: Supplementary information Development • Supplementary information Movie 1. Isolation of the PSM. Development 143: doi:10.1242/dev.126714: Supplementary information Movie 2. Spreading of a piece of PSM onto a collagen I-coated substrate during the first day of culture. Culture was followed over a period of 24 hours, at 37°C under 5% CO2. The Development • Supplementary information culture was imaged every ten minutes. Development 143: doi:10.1242/dev.126714: Supplementary information Movie 3. Multiplication of the non-adherent cell fraction followed over a period of 24 Development • Supplementary information hours. Development 143: doi:10.1242/dev.126714: Supplementary information Movie 4. EHT tracking during the fourth day of culture over a period of 15h10. Cells undergoing EHT are numbered, circled in yellow and followed thereafter. Cell movement characteristics of EHT are clearly visible. Sequences displaying EHT have been decelerated to Development • Supplementary information show specific individual cell movements. Development 143: doi:10.1242/dev.126714: Supplementary information Development • Supplementary information Movie 5. EHT tracking during the fourth day of culture over a period of 13h50. Development 143: doi:10.1242/dev.126714: Supplementary information Development • Supplementary information Movie 6. EHT tracking during the fourth day of culture over a period of 18h. Development 143: doi:10.1242/dev.126714: Supplementary information Table S1. Primers Primers for semi-quantitative RT-PCR: Gene Brachyury FLK1 SCL CD31 CD144 CD34 vWF RUNX1 PU1 CD45 c-KIT GAPDH Orientation Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Sequence TCCTCACTCTCAGTTTGGAGCACC ACTCACGGACCATAAGTTCGGG AGGCTAAACATAGGCTGGGC AGAAGGCAGAGTGGCTTTCG GAATGAAACATAGGGCTGTGG AGAAGGGAAAGGAAAGGGG CACTTTTCTCTGCTCTGTGGAAG AATCATCACTCCTGCGATAGG ATGTGTCCGTGCTCAACTCC GTCCCCAGTCATTTAGGAAGTC ATCTGGTGGTGTCAGCAAGC AGCCTTTCTTACAGCATCGG GGTGTCATCCAATCCATCCACTG CAGCACTTTCAATAAATGCCCG CCGATGGGACGCTGGTCAC GTGGGTTGGGTGTGGGGG TTACAGAACTGCAGAGCGTACAGC CTTGCGATTGCCTTTCTGTATGCC GACCCTCTTGGAAAGTGCAGAAAC CCCCTTATTGGTATCTGCAGCCTT CCCTTGCAGAGACCCACATTCAAA CCACTCAAACATCTTCGCGTACCA CAGGTGCTGAGTATGTTGTGGAGTC CTTCTGTGTGGCTGTGATGGC Localisation 845 1133 4602 4984 1467 1667 1506 1794 2088 2381 719 1251 4801 5129 735 1109 201 624 3438 3759 2679 2880 78 351 Product size 289 383 201 289 294 533 350 374 423 321 201 274 Primers used for QPCR: Orientation Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Foward Reverse Sequence GCGTTCCTCCTCCAAACATC CAGCCCTCCATCTTCTTTCC ACCACATCACGTTGGCAAGCTCAC TGTCGCCATCGTACCCTTGCACT TGACCTCTGCCAGCTCTCTCTCCT GGCTGTGGGAGAGGCACCAGT CCCCTCATTCCCCCTCCCTCTGA CTCACTGTGCACGTGGTGTGGATG ACTGCCAAAGTGAGAGTGACAAGGC GCTCCTCCGCTCAGGCAAAGC AACTTTTCCACTCCGCCTTC TCTTCCAGATGCCACTCAAAC AAAGGAGCACTCAGAAAGCCAGCC CGAATTCTGCCTCCAGCTCCCTCA ACCAGCGCAGCTCCTACCTCC GACTCCCGGTCAGGCGGGTA CACACAAGAGCGGGTCCGGG CGGATCGGTTGTGGTTGATGATGCT TCCCCGAGACCCAGTTCATCGC GGTTGTCTCCCGCTTCCTCCATCA Localisation 2093 2220 291 407 173 291 258 407 264 413 2768 2899 631 746 105 247 99 206 625 774 Product size 127 116 118 149 149 131 115 142 107 149 Development • Supplementary information Gene FLK1 L2093 FLK1 R2220 CD144 gal L291 CD144 gal R407 CD45 gal L173 CD45 gal R291 PU1 gal L258 PU1 gal R407 QS17 Ga F 264 QS17 Ga R 413 CKIT gal L2768 CKIT gal R2899 MEOX1 Ga F631 MEOX1 GA R 746 QGATA2 Ga F 105 QGATA2 Ga R 247 QRUNX1 Ga F 99 QRUNX1 Ga R206 BRA Gal L625 BRA Gal R774
Related documents