Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
The Signal Sequence Coding Region Promotes Nuclear Export of mRNA Supplementary Figures and Information Figure S1. Translocated-ftz-i sequence. Note that the sequence of the intron is underlined. Figure S2. The SSCR promotes nuclear export and ER targeting of mRNA in COS7 cells. COS-7 cells were microinjected with the indicated mRNA and FITC-conjugated 70kD dextran (inserts) and then incubated for 60min. Cells were fixed and probed for ftz mRNA. Figure S3. Nucleotide and amino acid sequences of SSCR mutant constructs. Note that the longest no-A-tracts in the H2-K1 and insulin SSCRs are underlined and that point mutaions and resulting amino acid changes are in bold. For fs-ftz, the nucleotide addition is in bold while the position of the nucleotide deletion is represented by “-”. Figure S4. mRNAs containing SSCRs are efficiently exported and do not accumulate in cytoplasmic stress granules. COS-7 cells were transfected with plasmids containing the indicated genes, incubated 1218 hrs, fixed and probed for ftz mRNA by FISH (top row, green in overlay) and TIA-1 protein by immunostaining (middle row, red in overlay). Note that a portion of the cytoplasmic c-ftz-Δi, c-ftz-i and 7A-ftz-Δi accumulated in cytoplasmic foci that were enriched in TIA-1. Scale Bar = 15μm. 1 Figure S5. mRNA export is unidirectional. t-ftz-Δi transcript and FITC conjugated 70kD dextran (inset) were microinjected into a single nucleus of a binucleate NIH 3T3 cell. After 3hrs the cell was fixed, probed for ftz mRNA and imaged. Note that although t-ftz-Δi mRNA was exported from the injected nucleus (labeled “Inj”) into the cytoplasm, it did not get imported into the uninjected nucleus (labeled “U”). Scale Bar = 15μm. Figure S6. eIF4AIII siRNA treatment. Hela cells were treated with siRNA oligonucleotides directed against eIF4AIII or with control oligonucleotides (Mock) for 48 hours. Cell lysates were collected and separated by SDS-PAGE. eIF4AIII and UAP56 were detected by western blotting. Figure S7. The percent adenine deficiency in the SSCR ascribed to codon bias and similar amino acid bias. To calculate the decrease in adenine percentage in the first 69nts of SSCR-containing ORFs due to codon bias, the difference between the expected number of adenines in the SSCR and the actual number of adenines caused by codon bias in the SSCR (see Figure 6G) was divided by the total decrease in adenines (see Figure 6A). To calculate the decrease in adenine due to similar amino acid bias, the drop in adenine levels caused by various amino acid substitutions in the SSCR (leucine for isoleucine [see Figure 6C], arginine for lysine [see figure 6D], serine for threonine, aspartate for glutamate, 2 glutamine for asparagines and cystein for methionine [excluding the start codon]) was divided by the total decrease in adenines. The remaining drop in adenine percentage was ascribed to the prevalence of hydrophobic amino acids in the SSCR. Protocol S1. SSCR analysis program. Pearl script to determine the nucleotide, amino acid, and codon content, of the first 69 and middle 69 nucleotides (offset towards the start to maintain frame as needed). The script also determined the longest no-adenine and one adenine tracks completely contained in the each 69 nucleotide segment. 3 Figure S1 t-Ftz-i GGGAGACCCAAGCTTGTCGACGCCGCCACCATGGTACCGTGCACGCTGCTCCTGCTGTTGGCGGCCGCCCT GGCTCCGACTCAGACCCGCGCGACCATGGGGTGTTGTCCCGGCTGTTGTGACTACAAGGACGACGATGACA AAGGCAGGCTCGACTACTTGGACGTCTACTCGCCCCAGTCGCAGACGCAGAAGCTGAAGAATGGCGACTTT GCCACCCCTCCGCCAACCACGCCCACCTCTCTGCCGCCCCTCGAAGGCATCAGCACGCCACCCCAATCGCC GGGGGAGAAATCGTCGTCAGCTGTCAGCCAGGAGATCAATCATCGAATTGTGACAGCCCCGAATGGAGCCG GCGATTTCAATTGGTCGCACATCGAGGAGACTTTGGCATCAGGTAGGCATCACACACGATTAACAACCCCT AAAAATACACTTTGAAAATATTGAAAATATGTTTTTGTATACATTTTTGATATTTTCAAACAATACGCAGT TATAAAACTCATTAGCTAACCCATTTTTTCTTTGCTTATGCTTACAGATTGCAAAGACTCGAAACGCACCC GTCAGACGTACACCCGCTACCAGACCCTGGAGCTCGAAGGGTACCCATACGATGTTCCAGATTACGTCCTG CAGTAAGCTCGCTTTCTTGCTGTCCCAATTTCTATTAAACTCGAG Figure S3 Name Comment SSCR Region, nucleotide/amino acid sequence t-ftz Translocated ftz containing the SSCR from the H2-K1 gene AUGGUACCGUGCACGCUGCUCCUGCUGUUGGCGGCCGCCCUGGCUCCGACUCAGACCCGCGCGACCAUG M V P C T L L L L L A A A L A P T Q T R A T M c-ftz cytoplasmic ftz AUG M 3R-ftz 3 arginine mutations AUGGUACCGUGCACGCUGCUCCUGCGGUUGCGGGCCGCCCUGGCUCCGACUCAGACCCGCGCGACCAUG M V P C T L L L R L R A R L A P T Q T R A T M fs-ftz Frame shift mutation AUGGGUACCGUGCACGCUGCUCCUGCUGUUGGCGGCCGCCCUGGCUCCGACUCAGACCCG-GCGACCAUG M G T V H A A P A V G G R P G S D S D P A T M UUG-ftz Start codon mutation UUGGUACCGUGCACGCUGCUCCUGCUGUUGGCGGCCGCCCUGGCUCCGACUCAGACCCGCGCGACCAUG M 7A-ftz 7 silent A mutations AUGGUACCAUGCACACUGCUACUGCUAUUGGCAGCCGCACUAGCUCCGACUCAGACCCGCGCGACCAUG M V P C T L L L L L A A A L A P T Q T R A T M insulin ins-ftz insulin SSCR AUGGCCCUGUGGAUGCGCCUCCUGCCCCUGCUGGCGCUGCUGGCCCUCUGGGGACCUGACCCAGCCGCAGCC M A L W M R L L P L L A L L A L W G P D P A A A 5A-insulin 5 silent A mutations AUGGCACUGUGGAUGCGCCUACUGCCACUGCUGGCACUGCUGGCCCUAUGGGGACCUGACCCAGCCGCAGCC M A L W M R L L P L L A L L A L W G P D P A A A