Download Class11 POGIL Translation Full Win17 all pages

Bio200 POGIL Cell Biology POGIL5 - Translation
(Developed by M. Schivell)
MODEL 1:
= "codon"
= "anticodon"
Critical Thinking Questions
5. Label as many components of the cartoon as you can.
6. Label the 5' and 3' sides of each codon and anticodon.
7. a. How many nucleotides are there in a codon? __________ in an anticodon? __________
b. Do codons overlap? __________
c. Which molecule contains codons? ___________ Which contains anticodons? __________
d. How many amino acids does each tRNA carry? ______
8. a. Define the term "codon":
b. Define the term "anticodon":
9. Translation ALWAYS begins with a tRNA carrying the amino acid Met.
From the picture above, what is the sequence of the "Start Codon"?
Label with 5' and 3'. _________________
10. In which direction must the ribosome move ("translocate") along the mRNA?
Circle one: From 5' to 3'
or
from 3' to 5'?
1
Bio200 POGIL Cell Biology POGIL5 - Translation
(Developed by M. Schivell)
MODEL 2:
Initiation of translation (from Freeman, 4e)
11. a. The ribosome contains a small segment of RNA that binds loosely to the ribosome
binding site (RBS) in the mRNA. Complementary sequence in the ribosome is not exact, but is
a pyrimidine-rich region. Circle the likely RBS in this mRNA.
a. Is the RBS closer to the 5' or 3' end of the mRNA? _____
b. Which are more common in the RBS binding part of the mRNA, pyrimidines or purines?
c. What types of bonds associate between the mRNA and small ribosomal subunit? _______
d. Why might an RBS be useful for translation in the complex environment of the cell?
12. a. Does the first tRNA bind before or after the ribosome is completely formed? ____________
b. What is a name for the 3-base sequence that the first tRNA binds to? ______________
13. a. How many nucleotides are there between...
... the RBS and the start codon? _______
... the 5' end of the mRNA's and the start codon? ______
b. Are either of your answers in "a" multiples of 3? _______
c. What establishes the "frame" of triplet codons for translation? ___________________
14. In the mRNA sequence below, circle and label a likely RBS and the exact start codon.
5' UCUUAAGAAGGAUCUGUAAUGUCUGUAUGUCUGUAGUGUAUGUCUUGUAUCG 3'
2
Bio200 POGIL Cell Biology POGIL5 - Translation
(Developed by M. Schivell)
MODEL 3:
This model shows the molecular changes
to amino acids and tRNAs during translation.
amino acid
15. Which end of the tRNA is attached
to the amino acid, 5' or 3'?
tRNA with the
nucleotide at one
end shown much
larger than the rest
of the molecule
16. a. In the top half of the model...
... circle the two atoms that will be connected
by a new bond.
... draw a slash through the bond that will be
broken.
b. In the bottom half of the model, circle
the newly formed bond.
17. If all of the proteins were taken away from the ribosome,
it could still catalyze the reaction shown above (although much
more slowly). What type of molecule is catalyzing the reaction?
18. The drawing to the right shows a short protein of 8 amino acids
that is complete, but is still in the ribosome.
a. Circle the bond that needs to be broken before the protein
can be used.
b. Label the amino terminus and the soon-to-be-carboxyl terminus
of the protein.
c. Draw a square around a peptide bond.
3
Bio200 POGIL Cell Biology POGIL5 - Translation
(Developed by M. Schivell)
MODEL 4:
Termination of translation (from Freeman, 4e)
"release
factor"
19. Compare the two tRNAs in this model with release factor. List two things that release
factor does NOT have that the tRNAs do have (or had at some point).
________________________
________________________
20. Release factor is NOT a nucleic acid, yet it is capable of catalysis.
What is it most likely made of? _______________
21. One covalent bond is broken in the figure above.
a. What two things are held together by that covalent bond? ____________________________
b. What is the catalyst that breaks that bond? ______________________________
22. What is the nucleotide sequence of the codon that binds release factor? ___________
(This is called a "stop codon".)
23. Using the codon table on page 7, list two different codons that a release factor can bind to:
(include 5' and 3' labels)
______________
_____________
24. Is release factor an enzyme? _______ What is your reasoning for this answer (see question
17 for help.)
4
Bio200 POGIL Cell Biology POGIL5 - Translation
(Developed by M. Schivell)
MODEL 5:
This diagram shows an amino-acyl tRNA (top), and four different amino-acyl tRNA
synthetase enzymes. These enzymes are responsible for attaching the appropriate amino acid
to a tRNA.
tRNA (light gray)
amino acid
4 different
"amino-acyl
tRNA
synthetase"
enzymes
(dark gray)
www.pdb.org
25. Draw a square around the part of the tRNA (at the top) that contains the anti-codon.
26. a. Using the name "amino-acyl tRNA synthetases" as
a guide, name two different substrates of these enzymes: ____________
_______________
b. These enzymes also require ATP as a substrate. Explain.
27. The aa-tRNA synthetases (an abbreviation) are a large family of enzymes found in every
living cell.
a. What parts of the enzymes must be different between different members of this family?
b. Are the reactions catalyzed by different members of this family the same or different?
How do you know?
28. How many different aa-tRNA synthetase
enzymes are needed (at the very least) by a cell? _________
5
Bio200 POGIL Cell Biology POGIL5 - Translation
On your own:
1. This is the sequence of a complete mRNA from a bacterial cell:
(Developed by M. Schivell)
5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3'
a. Write the protein sequence that is translated from this mRNA on the line below, and label
the amino (N) and carboxyl (C) termini of the protein.
b. How many tRNAs will bind to the ribosome to make this protein? _________
c. Which of the following sequences within the mRNA most likely contains the ribosome
binding site? (Circle ONE)
5'UAGCUAGCA3'
5'UUAAUGG3'
5'AAGGAGGC3'
2. For each different mutant cell described below, assume that ONE specific molecule or part
of a molecule is mutated in that cell so that the molecule’s function has changed. Name as
many molecules that could result in the description (but remember that for the mutant
phenotype, you are considering each mutation by itself).
Cell 1: In many different types of proteins, there is the amino
acid Thr (threonine) where an Ala (alanine) should be.
Cell 2: Many different types of proteins are much shorter than
in a normal cell, but have the correct sequence up to that
point. tRNA levels are normal in the cell.
Cell 3: mRNAs are bound to small ribosomal subunits, but
nothing else is attached. Large ribosomal subunits are
floating in the cytoplasm, and no proteins are made.
________________________
________________________
________________________
3. Should there be tRNAs in the cell that can base pair with a stop codon? Why or why not?
6