Download Substitution Rates in a New Silene latifolia Sex

Substitution Rates in a New Silene latifolia Sex-Linked Gene, SlssX/Y
Dmitry A. Filatov
School of Biosciences, The University of Birmingham, Edgbaston, Birmingham, UK
Dioecious white campion Silene latifolia has sex chromosomal sex determination, with homogametic (XX) females and
heterogametic (XY) males. This species has become popular in studies of sex chromosome evolution. However, the lack
of genes isolated from the X and Y chromosomes of this species is a major obstacle for such studies. Here, I report the
isolation of a new sex-linked gene, Slss, with strong homology to spermidine synthase genes of other species. The new
gene has homologous intact copies on the X and Y chromosomes (SlssX and SlssY, respectively). Synonymous
divergence between the SlssX and SlssY genes is 4.7%, and nonsynonymous divergence is 1.4%. Isolation of
a homologous gene from nondioecious S. vulgaris provided a root to the gene tree and allowed the estimation of the
silent and replacement substitution rates along the SlssX and SlssY lineages. Interestingly, the Y-linked gene has higher
synonymous and nonsynonymous substitution rates. The elevated synonymous rate in the SlssY gene, compared with
SlssX, confirms our previous suggestion that the S. latifolia Y chromosome has a higher mutation rate, compared with the
X chromosome. When differences in silent substitution rate are taken into account, the Y-linked gene still demonstrates
significantly faster accumulation of nonsynonymous substitutions, which is consistent with the theoretical prediction of
relaxed purifying selection in Y-linked genes, leading to the accumulation of nonsynonymous substitutions and genetic
degeneration of the Y-linked genes.
Introduction
Sex chromosomes are not as common in plants as in
animals, but they have been found in several phylogenetically distant groups, such as Rumex, Cannabis, and Silene
(Westergaard 1958). The genus Silene contains over
500 species. Most of these are gynodioecious or hermaphroditic, but there are two clusters of dioecy that, apparently,
evolved independently from each other (Desfeux et al.
1996). One such cluster is represented by five very closely
related dioecious species (Silene latifolia, S. diclinis,
S. dioica, S. heuffelii, and S. marizii), all of which have
male heterogametic sex determination (Westergaard 1958).
Silent nucleotide divergence of these species from nondioecious Silene species is about 15% (Filatov and
Charlesworth 2002), suggesting that the common ancestor
of these species diverged from a nondioecious ancestor
about 10 to 20 MYA. The recent divergence of the sex
chromosomes in S. latifolia provides an opportunity to
study early stages of sex chromosome evolution, and so
S. latifolia became a popular model species for such studies
(Guttman and Charlesworth 1998; Filatov et al. 2000,
2001; Atanassov et al. 2002; Filatov and Charlesworth
2002; Moore et al. 2003; Matsunaga et al. 2003).
Despite their independent origins, the properties of
sex chromosomes in different groups of organisms are
quite similar: recombination is restricted between the Y
and the X chromosomes, and Y chromosomes are usually
genetically degenerate (Bull 1983), containing few
functional genes (Skaletsky et al. 2003). Degeneration is
thought to occur because of reduced the efficacy of
selection on the nonrecombining Y chromosome (reviewed in Charlesworth and Charlesworth [2000]).
Deleterious mutations may be carried to fixation by linked
advantageous mutations (‘‘selective sweeps,’’ [Rice 1987])
or by ‘‘Muller’s ratchet’’ (stochastic loss of chromosomes
Key words: Silene latifolia, sex chromosomes, substitution rates,
spermidine synthase, segregation analysis.
E-mail: [email protected]
Mol. Biol. Evol. 22(3):402–408. 2005
doi:10.1093/molbev/msi003
Advance Access publication October 6, 2004
with the fewest mutations [Gordo and Charlesworth
2000]), and selective elimination of deleterious mutations
(‘‘background selection’’) may accelerate the stochastic
fixation of mildly detrimental mutations (Charlesworth
1994). These processes should lead to reduced effective
population size and sequence diversity in actively degenerating Y chromosomes (Charlesworth and Charlesworth
2000), which was indeed reported for several animal and
plant species (Zurovcova and Eanes 1999; Yi and
Charlesworth 2000; Filatov et al. 2000, 2001).
Although there is fairly good evidence for genetic
degeneration of animal Y chromosomes, in plants the
situation is less clear. The evidence for genetic degeneration of the Silene latifolia Y chromosome is based
only on the finding of a degenerate Y-linked copy
belonging to the MROS3 gene family (Guttman and
Charlesworth 1998), which has functional copies on the X
chromosome and autosomes (Kejnovsky et al. 2001), and
on the fact that YY S. latifolia plants (having no X) are
usually inviable (Ye et al. 1990). The degenerate Y-linked
copy of the MROS3 gene could be a pseudogene that
originated because of translocation or (retro)transposition
of an autosomal copy, rather than a remnant of a functional
Y-linked MROS3 gene. Inviability of the YY plants may
be the result of a breakdown of gene regulation (e.g., in sex
determination system), rather than caused by degeneracy
of the Y chromosome. Thus, although suggestive, these
findings cannot be taken as a solid evidence for Y chromosome degeneration in S. latifolia. Moreover, it is not
clear whether the plant Y chromosomes can degenerate:
active gene expression in haploid pollen (e.g., Engel et al.
2003) may help to efficiently eliminate deleterious
mutations from plant Y-linked genes. This may explain
why, despite the clear evidence for drastic reduction of
genetic diversity on the S. latifolia Y chromosome (Filatov
et al. 2000, 2001; Laporte et al. 2004), the previous study
of substitution rates in S. latifolia sex-linked genes (Filatov
and Charlesworth 2002) found no evidence for relaxation of
purifying selection in the S. latifolia Y-linked SlY4 gene,
compared with its X-linked homolog SlX4. The effect of
reduced effective population size upon the nonsynonymous
Molecular Biology and Evolution vol. 22 no. 3 Ó Society for Molecular Biology and Evolution 2004; all rights reserved.
Isolation and Analysis of SlssX/Y Gene 403
replacement rate depends on the distribution of the mutation
selection coefficients, which is unknown (Keightley 1998).
The SlX4/Y4 genes encode fructose-2,6-bisphosphatases
(Atanassov et al. 2002), and selection against amino acid
replacements in this housekeeping gene may be strong
enough to remove most mutations, despite more than
10-fold reduction in the effective population size on the Y
chromosome. Thus, more S. latifolia sex-linked genes have
to be analyzed to detect the expected relaxation of purifying
selection on the Y chromosome.
Despite substantial efforts by several laboratories to
isolate S. latifolia sex-linked genes (reviewed in Filatov
[2004]), only three genes with intact X-linked and Ylinked copies are known: SlX1/SlY1 (Delichère et al.
1999), SlX4/SlY4 (Atanassov et al. 2002), and DD44X/Y
(Moore et al. 2003). In addition, an autosomal Slap3 gene
was reported to have a functional Y-linked homolog
(Matsunaga et al. 2003), and a MROS3 gene family has at
least one active copy on the X chromosome (Guttman and
Charlesworth 1998, Kejnovsky et al. 2001) and a degenerate nonfunctional copy on the Y chromosome (Guttman
and Charlesworth 1998). The reasons for the low success
rate with isolation of S. latifolia sex-linked genes are
discussed in detail elsewhere (Filatov 2004).
Here, I report isolation of new S. latifolia sex-linked
genes, using segregation analysis of random cDNA clones.
Unlike previous approaches used to search for sex-linked
genes (Desfeux et al. 1996; Atanassov et al. 2002; Moore
et al. 2003) this method is technically simple and does not
depend on X/Y divergence of the homologous copies. The
analysis of silent and nonsilent substitution rates in the
new X-linked and Y-linked genes demonstrated accelerated accumulation of nonsynonymous substitutions in the
Y-linked gene and is consistent with the theoretical prediction of relaxed purifying selection on the Y chromosome.
Methods
Plant Material
Five families for use in segregation analyses were
produced by crosses between three male S. latifolia plants
(mSa9, mCB26, and mBM11), four S. latifolia females
(fSa12, fBM4, fCB7, and fCB24), and one S. dioica female
(fSd7): family 1 (fBM43mCB26), family 2 (fCB73mBM11),
family 3 (fCB243mBM11), family 4 (mSa93fSa12), and
family 5 (mSa93fSd7). The parent S. latifolia and S. dioica
plants were either grown from seeds collected by Dr. J.
Ironside in Cluj botanic garden (CB plants), Romania and
in Oradea, on the Czech/Romanian border (BM plants), or
were provided by Prof. D. Charlesworth (Sa and Sd plants).
The single S. vulgaris individual, which was used as an
outgroup in molecular evolution analyses was grown from
seeds provided by Prof. D. Charlesworth.
Genomic DNA was isolated from the leaves of
S. latifolia parents and F1 progeny, as well as from a single
S. vulgaris plant using Plant DNAzol reagent (Invitrogen),
according to the manufacturer’s instructions.
Segregation Analysis of S. latifolia cDNA Clones
Analysis of the previous work devoted to the isolation
of plant sex-linked genes suggested that the most
Table 1
Primers Used for PCR Amplification and Sequencing
Name
c2B1211
c2B12–2
c2B12–4
c2B12–5
c2B1216deg
c2B1219
c2B12X110
c2B12X–11
c2B12–12
c2B12–13
c2B12119
59 Sequence 39
GTCCGTTGCAAAGGCTCTTC
ACTCACGGACAGGTCTTTTGC
CAAAAGTAGATTGACGGAAACAGC
CTAGGGTATGTTGGAACTGTAGTCC
GARATNAGYCCNATGTGGCCNG
GTAATCATTTTGCCATCATCTCTT
CCAAGGGAAGTCAAAGTAYCAGG
CTACCCCTGGAAGTGAAGAGTC
AAAGTGTTGGATAGAGATTCCATAT
CTCTTGGTATGCACACTCATCC
GAGTTGCATTCTTGAAGGTAGC
NOTE.—Orientation of the primer is indicated by the ‘‘1’’ (forward) or ‘‘–’’
(reverse) in the name of the primer. In the degenerate primers, ‘‘N’’ corresponds to A
or T or to G or C, ‘‘R’’ corresponds to A or G, and ‘‘Y’’ corresponds to T or C.
promising approach is segregation analysis of random
genes (Filatov 2004). Currently, there are a limited number
of S. latifolia genes available in GenBank, many of which
have been tested for sex-linkage previously (Guttman and
Charlesworth 1998; Laporte and Charlesworth 2001).
Thus, as the first step in the search for new sex-linked
genes, I sequenced 96 random cDNA clones taken from an
S. latifolia male flower bud cDNA library (provided by
Dr. S. Grant). Clones with homology to transposable
elements, and without open reading frames (ORF), were
excluded. Only 36 clones with long ORF (.150 amino
acids) and encoding proteins with homology to known
proteins were selected for further analysis. The sequences
of these cDNA clones were used to design pairs of primers
for PCR amplification of the corresponding genes from
genomic DNA of the parents of the genetic families. Only
primers yielding one or two PCR products in parents were
used for further segregation analysis. If the PCR products
amplified from parent genomic DNA differed in size (e.g.,
fig. 1), the size differences were used as markers in segregation analysis. Otherwise, the parental PCR products
were sequenced and single-nucleotide polymorphisms
(SNP) fixed between parents were used as genetic markers.
In the former case, the segregation in the F1 progeny was
tested in 1% to 2% agarose gels, whereas in the later case,
PCR products of the F1 progeny were sequenced directly
from one primer, and sex linkage was inferred from the
pattern of SNP inheritance.
Isolation and Sequencing of SlssX and SlssY Genes
Amplification of shorter (;1 kb) fragments of the
SlssX/Y gene was conducted with c2B1211 and c2B12–2
primers (table 1) using Promega Taq polymerase. The
PCR products were separated on 2% agarose gels under
low voltage (overnight) to ensure good separation of fast
and slow bands in males. The bands were isolated from the
gel using the Qiagen gel extraction kit and sequenced
directly from c2B1211 and c2B12–2 primers using the
ABI BigDye version 3.1 sequencing kit and an ABI3700
automatic sequencer.
The PCR amplification of the longer (;4kb) regions
was conducted using the c2B1216deg and c2B12–4
primers and the ExpandTM Long-Range PCR System
404 Filatov
(Roche). PCR products were separated on 1% agarose
gels, isolated from the gel using Qiagen gel extraction kit,
cloned using the TOPO TA Cloning Kit (Invitrogen), and
sequenced using the ABI BigDye version 3.1 sequencing
kit and the ABI3700 automatic sequencer. The sequencing
of the SlssX and SlssY genes was conducted using the
following primers (table 1): universal M13F and M13R,
c2B1219, c2B12–13, c2B12110, c2B12–12, c2B12–5,
and c2B1211. In addition, sequencing of the longer SlssY
gene required c2B12–11 and c2B12119 to cover the
entire region. The same primers and conditions were used
for isolation and sequencing of the Svss gene from
S. vulgaris. GenGank accession numbers for the SlssX,
SlssY, and Svss genes are AY705437, AY705438, and
AY705436, respectively.
The sequence traces were checked, base calls were corrected, and contigs were assembled using ProSeq software
(Filatov 2002). The sequences of SlssX, SlssY, and Svss
genes were aligned by the mcalign program (Keightley and
Johnson 2004).
The intron-exon structures and coding regions of the
SlssX, SlssY, and Svss genes were inferred by aligning
them with the sequences of the S. latifolia cDNA clone
c2B12 and with cDNA sequences of spermidine synthases
of Arabidopsis (NM_102230), Pisum (AF043108), Coffea
(AB015599), Malus (AB072915), and Datura (Y08253).
Nucleotide Substitution Rates
Intronic, synonymous, and nonsilent pairwise divergence values were calculated using MEGA version 2
software (Kumar et al. 2000). MEGA2 was also used to
conduct the Tajima’s (1993) relative-rates test. Synonymous and nonsynonymous divergence was estimated using
the Nei-Gojobori method (Nei and Gojobori 1986) with
Jukes-Cantor correction (Jukes and Cantor 1969). The
Kimura’s two-parameter distance (Kimura 1980) was used
for divergence in intron regions.
To compare substitution rates in introns, the baseml
program from the PAML version 3.13d software package
(Yang 2001) was used. The ‘‘local clock’’ mode (Yoder and
Yang 2000) was used to test the significance of substitution
rate difference between the SlssX and SlssY lineages. To
estimate the silent (Ks) and nonsilent (Ka) substitution rates
and the Ka/Ks ratios for the X-linked and the Y-linked genes,
the codeml program from the PAML package was used,
assuming the phylogeny in figure 2. Each branch was
assumed to have a separate substitution rate (‘‘no clock
mode’’), and three Ka/Ks ratios were assigned as shown in
figure 2 by different branch shadings. For the likelihoodratio test, the model with three Ka/Ks ratios was compared
with a model with just two ratios, one for autosomal and one
for the X-linked and the Y-linked genes.
Results
Isolation of the SlssX/Y Genes
To isolate more S. latifolia sex-linked genes, I
conducted segregation analysis of random cDNA clones
isolated from male flower bud cDNA library (provided by
Dr. Sarah Grant), as described in the Methods. In total,
21 clones were tested for sex linkage, and one of the
FIG. 1.—Segregation analysis of the SlssX/Y gene in the family 5.
PCR amplification was conducted using c2B1211 and c2B12–2 primer
pairs. Lanes 8 and 10 correspond to male and female parents,
respectively. Lanes 1 to 7 correspond to male F1 progeny, and lanes 11
to 18 correspond to female F1 progeny.
clones, c2B12 (accession number AY705439), appeared to
correspond to a sex-linked gene. PCR primers c2B1211
and c2B12–2, designed using the sequence of the c2B12
cDNA clone, amplified an approximately 1-kb region from
all male and female S. latifolia and S. dioica individuals. In
addition, male S. latifolia individuals had a second
PCR product, which was slightly longer (fig. 1). Malespecificity of the longer fragment suggested that it might
be Y linked. Y linkage of this fragment was confirmed by
segregation analysis in five families (36 male and 34
female F1 individuals in total), which demonstrated that
this fragment is always inherited from father to sons but
not to daughters (fig. 1). To find molecular markers for the
segregation analysis of the shorter PCR product, it was
sequenced directly for the female fBM4 and male mCB26
plants used as parents of family 1. This revealed two
nucleotide differences, with mCB26 hemizygous for the T
and fBM4 homozygous for C in both polymorphic sites.
None of the nucleotide differences affected restriction
sites, so the PCR products from eight female and seven
male F1 progeny from family 1 were sequenced directly.
All the female F1 progeny were heterozygous for paternal
and maternal alleles (A/C), whereas the male F1 progeny
were hemizygous for the maternal variant (C). Thus, the
gene corresponding to the shorter PCR product is X
linked.
Although the smaller and the larger PCR products
demonstrate X linkage and Y linkage, there remains
a possibility that these genes are located in the pseudoautosomal region. If so, the X-linked and Y-linked copies
should occasionally recombine with each other. However,
sequencing of the X-linked and Y-linked genes demonstrated that intron divergence among the X-linked and the
Y-linked genes exceeds 8% (see below), which is too high
to be accounted for by divergence between the recombining alleles. Also, the male specificity of the longer PCR
product (over 30 males from wild populations were tested
[data not shown]) makes the pseudoautosomal location
unlikely.
Isolation and Analysis of SlssX/Y Gene 405
to the fragment of the SlssY gene amplified with c2B1211
and c2B12–2 primers, and the smaller fragment corresponded to SlssX sequence. Segregation analysis in the
family 1 (seven male and eight female F1 progeny) also
confirmed that the larger (4.5 kb long) band is Y linked.
The X linkage of the smaller (;4 kb long) PCR product
was confirmed by partial direct sequencing of the fragment
amplified from the maternal (fBM4) and paternal (mCB26)
individuals and the same set of F1 offspring of family 1, as
used for the segregation of the smaller 1-kb PCR product,
amplified with c2B1211 and c2B12–2 primers. As
expected, all the male F1 progeny inherited the maternal
allele but not the paternal allele, whereas all the female F1
progeny inherited maternal and paternal alleles.
Exon-Intron Structure of the SlssX/SlssY Genes
FIG. 2.—The gene tree used in the ML analyses. Different shading
shows the separate Ka/Ks rates used for SlssX, SlssY, and Svss genes. The
number of amino acid replacements and synonymous substitutions in
every lineage is shown as nominator and denominator, respectively.
Sequencing of the longer (Y-linked) and the shorter
(X-linked) PCR fragments amplified by the c2B1211 and
c2B12–2 primers confirmed that both fragments are homologous to the c2B12 cDNA clone. This clone has strong
(over 80% DNA sequence identity) homology to coding
regions of spermidine synthase genes from Arabidopsis
(accession number NM_102230), Pisum (accession number
AF043108), Coffea (accession number AB015599), Malus
(accession number AB072915), and Datura (accession
number Y08253). Thus, the X-linked and Y-linked genes
amplified by the c2B1211 and c2B12–2 primers were
assumed to encode S. latifolia spermidine synthase and were
named SlssX and SlssY, respectively.
To isolate a longer region of the SlssX and SlssY
genes, I used the sequences of the coding regions of plant
spermidine synthase genes to design a degenerate forward
primer, c2B1216deg, which was used in a pair with
c2B12–4 to amplify the region from intron 1 to the 39
untranslated region of the SlssX and SlssY genes. These
primers amplified a single band of approximately 4 kb in
S. latifolia females, and two bands of approximately 4 kb
and approximately 4.5 kb in S. latifolia males. The larger
and the smaller fragments were cloned and sequenced as
described in the Methods section. As expected, the sequence of the 39 region of the larger fragment was identical
The alignment of sequences of the SlssX and SlssY
genomic fragments and the cDNA clone revealed the presence of three insertions of 80, 370, and 250 nt in the genomic fragments. According to the position in the cDNA
sequence, these insertions correspond to the introns 6, 7,
and 8 of the A. thaliana spermidine synthase I gene. As the
S. latifolia cDNA clone c2B12 contained only the 39
portion of the spermidine synthase coding region (exons 9
to 6 and 12 nt of exon 5), the exon-intron structure of the
59 region of the SlssX and SlssY genes had to be established from the comparisons with spermidine synthases of
the other plant species. Alignment of the SlssX and SlssY
genomic fragments with the sequences of coding regions
of Arabidopsis, Pisum, Coffea, Malus, and Datura
spermidine synthase genes allowed the positions of the
other introns and exons to be established. The presence of
splice-site consensus sequences (59-GT...AT-39) supports
the position of introns in the SlssX and SlssY genes, except
intron 7, which had a rare (GC) 59 splice site. In the case of
intron 7, the position of the intron was unambiguously
established from the comparison of the cDNA and
genomic sequences.
Divergence Between the SlssX and SlssY Genes
Overall, 837 nt of coding region and 2,554 nt of
intron sequences were analyzed after exclusion of insertion/deletion (indel) regions and regions of uncertain
alignment in the first exon and in the 39 UTR. Most indels
were located in the first intron, including the 481 bp long
insertion in SlssY, resulting in a substantial length
difference between the SlssX and SlssY PCR products.
Synonymous divergence between the SlssX and SlssY
genes is 4.7% 6 1.6%, and divergence in introns is much
higher, 8.1% 6 0.6%. The higher divergence in introns
may partly be caused by misalignment in the first intron,
which contains multiple insertions and deletions. However, exclusion of the first intron from the analysis does
not reduce the divergence; in fact it slightly increases
divergence (8.8% 6 0.8%).
There are only nine nonsynonymous differences
between the SlssX and SlssY genes, and the nonsynonymous divergence is 1.4% 6 0.5%, substantially lower
than synonymous divergence, suggesting that at least one
406 Filatov
of these genes is under purifying selective constraint.
Interestingly, the sequence of the S. latifolia c2B12 cDNA
clone is identical to the exons of the SlssY and differs from
SlssX by 12 nt. Thus, the Y-linked copy of the S. latifolia
spermidine synthase gene is actively transcribed. The open
reading frame is preserved in both X-linked and Y-linked
copies of the gene, strengthening the evidence that both
copies are functional or had been functional until very
recently.
Substitution Rates in the SlssX and SlssY Genes
If one of the copies of the SlssX/Y gene became
nonfunctional after the X-linked and Y-linked copies
stopped recombining with each other, it would be expected
to accumulate multiple nonsynonymous substitutions. Even
if both copies are functional, theory predicts that purifying
selection should be less efficient in the nonrecombining
Y-linked copy, and it is expected to accumulate more nonsynonymous substitutions than the X-linked copy (reviewed in Charlesworth and Charlesworth [2000]).
To detect whether the mutations in the SlssX or in the
SlssY lineages disproportionately contributed to nonsilent
and silent divergence between the two copies, I PCRamplified and sequenced a homologous region (referred
below as Svss) from nondioecious Silene vulgaris, using
the c2B1216deg and c2B12–2 primers. Using the
sequence of the S. vulgasis Svss gene, it is possible to
root the gene tree for the S. latifolia SlssX and SlssY genes
and to establish how many of the nine amino acid
differences between the SlssX and SlssY genes occurred in
the X-linked and in the Y-linked genes. Interestingly, in all
nine cases, the amino acid in the SlssX gene matched that
in the Svss; thus, all nine of the nonsynonymous changes
have probably occurred along the SlssY lineage. The
excess of nonsynonymous substitutions in the Y-linked
gene is significant (v2¼ 7.0, 1df, P ¼ 0.008) by the
Tajima’s relative-rate test (Tajima 1993) and is consistent
with relaxed selective constraint on the nonrecombing Y
chromosome, as suggested by theory. Interestingly, one of
the mutations in SlssY (the Asn!Gly at the position 173 of
the protein sequence alignment shown in figure 3 in
Korolev et al. [2002]) is especially likely to disrupt the
spermidine synthase activity of the protein encoded by the
Y-linked copy of the gene, because according to crystal
structure of the bacterial enzyme, this residue interacts
with the substrate (Korolev et al. 2002).
Alternatively, the elevated nonsilent substitution rate
in the SlssY gene could be caused by a higher mutation rate
on the S. latifolia Y chromosome (Filatov and Charlesworth
2002). Pairwise Svss/SlssX and Svss/SlssY synonymous
divergence is 9.9% 6 2.4% and 11.6% 6 2.6%, respectively, suggesting that the Y-linked gene accumulates
synonymous substitutions (and probably mutates) faster
than the X-linked homolog. To test whether the mutation
rate is indeed higher in the SlssY than in the SlssX gene, I
conducted a maximum-likelihood ratio test to compare
substitution rates in introns (Ki) of these genes. The model
with three substitution rates (KiX, KiY, and KiA) was
compared with the model with two rates (KiX ¼ KiY and
KiA). The likelihoods for these models were calculated
using baseml program with local molecular clock (Yoder
and Yang 2000), and the significance was tested using the
likelihood-ratio test. The model with three rates fits the
data significantly better than the model with two rates
(2lnL ¼ 5.75, P , 0.05), demonstrating that the intron
substitution rate in the SlssY gene (KiY¼ 0.058) is
significantly elevated, compared with that in the SlssX
gene (KiX¼ 0.04). The difference in the substitution rates,
however is not as drastic as for the SlX4/SlY4 genes
reported previously (Filatov and Charlesworth 2002).
The higher mutation rate in the Y-linked gene could
have elevated the nonsynonymous substitution rate and
has to be taken into account when comparing the SlssX and
SlssY genes. For this purpose, I used the codeml program
(Yang 2001) to compare two models, one with three Ka/Ks
ratios (separate ratios for branches) and the other with the
ratios for SlssX and SlssY genes forced to be equal. The
former model fits the data significantly better that the latter
model (2lnL ¼ 4.003, P , 0.05), demonstrating that,
taking into account the possible differences in underlying
mutation rates between the SlssX and SlssY genes, the
Y-linked gene accumulates nonsynonymous substitutions
significantly faster than the X-linked homolog. The Ka/Ks
ratios are well below unity for both genes (0.000 and 0.519
for the SlssX and SlssY, respectively), consistent with both
genes being functional and subject to purifying selective
constraint.
Discussion
Here, I reported isolation of a new pair of
homologous X-linked and Y-linked genes, SlssX and
SlssY, from S. latifolia. This is the fourth known pair of
S. latifolia sex-linked genes with intact homologous copies
on the X and Y chromosomes. Previous genes were
isolated using fairly sophisticated molecular biology
methods: screening of a S. latifolia cDNA library with
a Y-specific probe, obtained using microdissection of the
chromosomes (SlX1/Y1 and SlX4/Y4 genes [see Delichère
et al. f1999g and Atanassov et al. f2003g]) and
differential display (DD44X/Y genes [Moore et al.
2003]). The current study demonstrates that a much
simpler approach, segregation analysis of random
S. latifolia genes, obtained from a male flower bud cDNA
library may be successfully used to isolate new S. latifolia
sex-linked genes. A similar approach has already been
used by Guttman and Charlesworth (1998), who found an
X-linked gene, MROS3X, after testing only four genes for
sex linkage. Laporte and Charlesworth (2001), however,
have found no sex-linked genes after testing six genes. In
this study, I tested over 20 genes before a single sex-linked
gene was discovered. This plant species has 11 pairs of
autosomes and a pair of sex chromosomes (2n ¼ 22 1 XX
or XY). Assuming that all the chromosomes contain
approximately the same number of genes, every 12th gene
taken at random should be sex linked. However, as the Y
chromosome is the largest, and the X chromosome is the
second largest, the proportion of sex-linked genes should
be higher than 1/12. To isolate the SlssX/Y gene pair, I
tested 21 genes for sex linkage. Assuming that the
proportion of sex-linked genes is 10%, according to the
Isolation and Analysis of SlssX/Y Gene 407
binomial distribution, the probability of such an outcome
is about 25%. One may need to test as many as 30 genes to
reduce the chance of failure to find a sex-linked gene to
below 5%.
The new sex-linked genes encode proteins with
strong homology to spermidine synthase, an enzyme that
catalyzes the biosynthesis of spermidine (a ubiquitous polyamine). Thus, similar to the previously isolated SlX1/Y1,
SlX4/Y4, and DD44X/Y genes, the new gene belongs to
a group of housekeeping genes with X-linked and Y-linked
copies resident singly on X and Y chromosomes. Such
sex-linked genes were called class I by Lahn, Pearson, and
Jegalian (2001) and are thought to represent the genes
originally located on the protosex chromosomes that have
evolved into X and Y chromosomes.
Although I have not isolated the 59 region of the new
genes (the first exon and the 59 UTR), the low Ka/Ks ratio
and the absence of stop codons in the coding sequence
suggests that the SlssX and SlssY genes are functional.
Moreover, the original c2B12 cDNA clone corresponds to
the SlssY gene, demonstrating that this gene is actively
transcribed. However, the comparison with the amino acid
sequences of the human, Arabidopsis, and bacterial
spermidine synthases revealed that three highly conserved
residues are mutated in the protein encoded by the SlssY
gene (at positions 161, 167, and 173 in the amino acid
alignment shown on figure 3 in Korolev et al. [2002]),
suggesting that its activity may be highly reduced.
Exon-intron structure also corresponds to that in the
spermidine synthase genes of other plant species. Interestingly, the sequence of the SlssY gene is longer than
that of the SlssX gene because of an approximately 0.5 Mb
long insert into the first intron. This resembles the situation
in the other S. latifolia sex-linked genes. With the
exception of SlX1/Y1 gene, which has low X/Y divergence
(Delichère et al. 1999; Filatov and Charlesworth 2002), all
the other Y-linked genes are substantially longer than their
X-linked homologs. Perhaps, this reflects the general trend
on the Y chromosome and may explain why the Y
chromosome ‘‘overgrew’’ in size the originally homologous X chromosome. The tendency of the S. latifolia Y
chromosome to accumulate junk DNA is in line with
theoretical predictions and empirical observations on the Y
chromosomes of other species (Charlesworth, Sniegovski,
and Stephan 1994; Junakovic et al. 1998).
Synonymous divergence between the SlssX and SlssY
genes (4.7%) is higher than for SlX1/Y1 genes (3%) but
lower than for DD44X/Y (8%) and SlX4/Y4 (16%) genes. If
the X/Y divergence of homologous genes corresponds to
the order of the genes on the sex chromosomes, as
suggested by the ‘‘evolutionary strata’’ theory (Lahn,
Pearson, and Jegalian 2001), then according to synonymous SlssX/SlssY divergence, the new gene should be
located between the SlX1/Y1 and DD44X/Y. However, the
SlssX/SlssY divergence in introns is higher than synonymous divergence, and according to intronic divergence, the
new genes may fall into the same stratum as the DD44X/Y
genes.
The rate of silent divergence in the SlssY gene is
significantly higher than in SlssX gene, suggesting that the
S. latifolia Y-linked gene accumulates substitutions, and
probably mutates, faster than the X-linked homolog. This
is consistent with the previous report of an elevated
mutation rate on the S. latifolia Y chromosome (Filatov
and Charlesworth 2002). However, the difference in silent
substitution rates between the SlssX and SlssY genes is
much lower than in the SlX4 and SlY4 genes reported
previously, suggesting that the mutation rate may vary
across the Y chromosome. Interestingly, all the amino acid
replacements, which differ between the SlssX and SlssY
genes, apparently occurred in the Y-linked gene. Some of
these mutations affect highly conserved amino acid
residues and are likely to disrupt the function of the SlssY
gene. This is consistent with the theoretical prediction of
relaxed purifying selection on the nonrecombining degenerating Y chromosomes (Charlesworth and Charlesworth
2000). Drastically reduced diversity in the S. latifolia
Y-linked genes (Filatov et al. 2000, 2001; Laporte et al.
2004) should result in reduced efficacy of selection on the
Y chromosome. The previous studies, however, have not
been able to detect any evidence for this. The elevated
nonsilent substitution rate was previously reported in the
SlY4 gene (Filatov and Charlesworth 2002). However,
because of a very high silent substitution rate in this gene,
the Ka/Ks ratio does not differ significantly between the
SlX4 and SlY4 genes, and the elevation of nonsilent
substitution rate in SlY4 was attributed to a higher mutation
rate in this gene.
Acknowledgments
I thank Sarah Grant for providing the S. latifolia male
flower bud cDNA library, Deborah Charlesworth and Joe
Ironside for providing Silene seeds, and Joe Ironside and
Dave Gerrard for critical reading of the manuscript. This
work was funded by the BBSRC.
Literature Cited
Atanassov, I., C. Delichère, D. A. Filatov, D. Charlesworth, I.
Negrutiu, and F. Moneger. 2002. Analysis and evolution of
two functional Y-linked loci in a plant sex chromosome
system. Mol. Biol. Evol. 18:2162–2168.
Bull, J. J. 1983. Evolution of sex determining mechanisms. The
Benjamin/Cummings Publishing Company, Menlo Park,
Calif.
Charlesworth, B. 1994. The effect of background selection
against deleterious alleles on weakly selected, linked variants.
Genet. Res. 63:213–228.
Charlesworth, B., and D. Charlesworth. 2000. The degeneration
of Y chromosomes. Philos. Trans. R. Soc. Lond. B Biol. Sci.
355:1563–1572.
Charlesworth, B., P. Sniegovski, and W. Stephan. 1994. The
evolutionary dynamics of repetitive DNA in eukariotes.
Nature 371:215–220.
Delichère, C., J. Veuskens, M. Hernould, N. Baarbacar, A.
Mouras, I. Negrutiu, and F. Monéger. 1999. SlY1, the first
active gene cloned from a plant Y chromosome, encodes
a WD-repeat protein. EMBO J. 18:4169–4179.
Desfeux, C., S. Maurice, J. P. Henry, B. Lejeune, and P. H.
Gouyon. 1996. Evolution of reproductive systems in the
genus Silene. Proc. R. Soc. Lond. B Biol. Sci. 263:409–414.
Engel, M. L., A. Chaboud, C. Dumas, and S. McCormick. 2003.
Sperm cells of Zea mays have complex complement of
mRNAs. Plant J. 34:697–707.
408 Filatov
Filatov, D. A. 2002. A software for preparation and evolutionary
analysis of DNA sequence data sets. Mol . Ecol. Notes 2:
621–624.
———. 2004. Isolation of genes from plant Y chromosomes.
Meth. Enzymol. (in press).
Filatov, D. A., and D. Charlesworth. 2002. Substitution rates in
the X-link and Y-linked genes of the plants, Silene latifolia
and S. dioica. Mol. Biol. Evol. 19:898–907.
Filatov, D. A., V. Laporte, C. Vitte, and D. Charlesworth. 2001.
DNA diversity in sex linked and autosomal genes of the plant
species Silene latifolia and S. dioica. Mol. Biol. Evol.
18:1442–1454.
Filatov, D. A., F. Moneger, I. Negrutiu, and D. Charlesworth. 2000.
Low variability in a Y-linked plant gene and its implications for
Y-chromosome evolution. Nature 404:388–390.
Gordo, I., and B. Charlesworth. 2000. On the speed of Muller’s
ratchet. Genetics 156:2137–2140.
Guttman, D. S., and D. Charlesworth. 1998. An X-linked gene
with a degenerate Y-linked homologue in a dioecious plant.
Nature 393:263–266.
Jukes, T. H., and C. R. Cantor. 1969. Evolution of protein
molecules. Pp. 21–132 in N. H. Munro, ed. Mammalian
protein metabolism. Academic Press, New York.
Junakovic, N., A. Terrinoni, C. Di Franco, C. Vieira, and C.
Loevenbruck. 1998. Accumulation of transposable elements
in the heterochromatin and on the Y chromosome of
Drosophila simulans and Drosophila melanogaster. J. Mol.
Evol. 46:661–668.
Keightley, P. D. 1998. Inference of genome-wide mutation rates
and distributions of mutation effects for fitness traits:
a simulation study. Genetics 150:1283–1293.
Keightley, P. D., and T. Johnson. 2004. MCALIGN: stochastic
alignment of noncoding DNA sequences based on an
evolutionary model of sequence evolution. Genome Res.
14:442–450.
Kejnovsky, E., J. Vrana, S. Matsunaga, P. Soucek, J. Siroky, J.
Dolezel, and B. Vyskot. 2001. Localisation of malespecifically expressed MROS genes of Silene latifolia by
PCR and flow-sorted sex chromosomes and autosomes.
Genetics 158:1269–1277.
Kimura, M. 1980. A simple method for estimating evolutionary
rate of base substitutions through comparative studies of
nucleotide sequences. J. Mol. Evol. 16:111–120.
Korolev, S., Y. Ikeguchi, T. Skarina, S. Beasley, C. Arrowsmith,
A. Edwards, A. Joachimiak, A.E. Pegg, and A. Savchenko.
2002. The crystal structure of spermidine synthase with
a multisubstrate adduct inhibitor. Nat. Struct. Biol. 9:
27–31.
Kumar, S., K. Tamura, I. Jacobsen, and M. Nei. 2000. MEGA2:
molecular evolutionary genetics analysis. Version 2.0. Pennsylvania and Arizona State Universities, University Park,
Pa. and Tempe, Ariz.
Lahn, B. T., N. M. Pearson, and K. Jegalian 2001. The human Y
chromosome, in the light of evolution. Nat. Rev. Genet. 2:
207–216.
Laporte, V., and D. Charlesworth. 2001. Non-sex-linked, nuclear
cleaved amplified polymorphic sequences in Silene latifolia.
J. Hered. 92:357–359.
Laporte, V., D. A. Filatov, E. Kamau, and D. Charlesworth.
2004. Indirect evidence from DNA sequence diversity for
genetic degeneration of the Y-chromosome in dioecious
species of the plant Silene. J. Evol. Biol. (in press).
Matsunaga, S., E. Isono, E. Kejnovsky, B. Vyskot, J. Dolezel, S.
Kawano, and D. Charlesworth. 2003. Duplicative transfer of
a MADS box gene to a plant Y chromosome. Mol. Biol. Evol.
20:1062–1069.
Moore, R. C., O. Kozyreva, S. Lebel-Hardenack, J. Siroky, R.
Hobza, B. Vyskot, and S. R. Grant. 2003. Genetic and
functional analysis of DD44, a sex-linked gene from the
dioecious plant Silene latifolia, provides clues to early events
in sex chromosome evolution. Genetics 163:321–334.
Nei, M., and T. Gogobori. 1986. Simple methods for estimating
the numbers of synonymous and nonsynonymous nucleotide
substitutions. Mol. Biol. Evol. 3:418–426.
Rice, W. R. 1987. Genetic hitchhiking and the evolution of
reduced genetic activity of the Y sex chromosome. Genetics
116:161–167.
Skaletsky, H., T. Kuroda-Kawaguchi, P. J. Minx et al. (40 coauthors). 2003. The male-specific region of the human Y
chromosome is a mosaic of discrete sequence classes. Nature
423:825–837.
Tajima, F. 1993. Simple methods for testing molecular clock
hypotheses. Genetics 135:599–607.
Westergaard, M. 1958. The mechanism of sex determination in
dioecious flowering plants. Adv. Genet. 9:217–281.
Yang, Z. 2001. Phylogenetic analysis by maximum likelihood
(PAML), version 3e. University College London.
Ye, D., P. Installe, D. Ciupercescu, J. Veuskens, Y. Wu, G.
Salesses, M. Jacobs, and I. Negrutiu. 1990. Sex determination
in the dioecious Melandrium. I. First lessons from androgenic
haploids. Sex. Plant Reprod. 3:179–186.
Yi, S., and B. Charlesworth. 2000. Contrasting patterns of molecular
evolution of the genes on the new and old sex chromosomes of
Drosophila miranda. Mol. Biol. Evol. 17:703–717.
Yoder, A., and Z. Yang. 2000. Estimation of primate speciation dates
using local molecular clocks. Mol. Biol. Evol. 17:1081–1090.
Zurovcova, M., and W. F. Eanes. 1999. Lack of nucleotide
polymorphism in the Y-linked sperm flagellar dynein gene
Dhc-Yh3 of Drosophila melanogaster and D. simulans.
Genetics 153:1709–1715.
Brandon Gaut, Associate Editor
Accepted October 4, 2004