Download RhoA Regulates G1-S Progression of Gastric Cancer Cells by

RhoA Regulates G1-S Progression of Gastric Cancer Cells
by Modulation of Multiple INK4 Family Tumor Suppressors
Siyuan Zhang,1 Qiulin Tang,1 Feng Xu,1 Yan Xue,1 Zipeng Zhen,1 Yu Deng,1 Ming Liu,1
Ji Chen,1 Surui Liu,1 Meng Qiu,1 Zhengyin Liao,1 Zhiping Li,1 Deyun Luo,1
Fang Shi,1 Yi Zheng,2 and Feng Bi1
1
Division of Abdominal Cancer and the Laboratory of Signal Transduction and Molecular Targeting Therapy,
State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu, Sichuan Province,
People's Republic of China and 2Division of Experimental Hematology and Cancer Biology,
Children's Hospital Research Foundation, University of Cincinnati, Cincinnati, Ohio
Abstract
Introduction
RhoA, a member of the Rho GTPase family, has been
extensively studied in the regulation of cytoskeletal
dynamics, gene transcription, cell cycle progression, and
cell transformation. Overexpression of RhoA is found in
many malignancies and elevated RhoA activity is associated
with proliferation phenotypes of cancer cells. We reported
previously that RhoA was hyperactivated in gastric cancer
tissues and suppression of RhoA activity could partially
reverse the proliferation phenotype of gastric cancer cells,
but the underlying mechanism has yet to be elucidated. It
has been reported that RhoA activation is crucial for the cell
cycle G1-S procession through the regulation of Cip/Kip
family tumor suppressors in benign cell lines. In this study,
we found that selective suppression of RhoA or its effectors
mammalian Diaphanous 1 and Rho kinase (ROCK) by small
interfering RNA and a pharmacologic inhibitor effectively
inhibited proliferation and cell cycle G1-S transition in
gastric cancer lines. Down-regulation of RhoA-mammalian
Diaphanous 1 pathway, but not RhoA-ROCK pathway,
caused an increase in the expression of p21Waf1/Cip1 and
p27Kip1, which are coupled with reduced expression and
activity of CDK2 and a cytoplasmic mislocalization of
p27Kip1. Suppression of RhoA-ROCK pathway, on the other
hand, resulted in an accumulation of p15INK4b, p16INK4a,
p18INK4c, and p19INK4d, leading to reduced expression and
activities of CDK4 and CDK6. Thus, RhoA may use two
distinct effector pathways in regulating the G1-S progression
of gastric cancer cells. (Mol Cancer Res 2009;7(4):570–80)
Gastric cancer is a disease of poor prognosis and high mortality. Although a recent decline in both incidence and mortality
has been noted, it is the fourth most commonly occurring cancer
and the second leading cause of cancer-related death worldwide
(1, 2). There is a marked geographic variation in incidence of
gastric cancer: China, Japan, and Korea have high rates of
gastric cancer and account for more than half of all cases worldwide, whereas countries in North America, western Europe,
Australasia, and Africa have found lower gastric cancer rates (2).
Rho family GTPases contribute to the regulation of multiple
biological processes including cell size, cell cycle progression,
apoptosis/survival, morphology, cell polarity, cell adhesion, and
membrane trafficking (3). There are 23 mammalian members
of Rho GTPases, with RhoA, Rac1, and Cdc42 as the best
characterized ones. Like Ras, Rho GTPases act as molecular
switches to control signal transduction pathways by cycling
between a GDP-bound, inactive form and a GTP-bound, active
form. Once activated, Rho GTPases bind to and activate several
downstream effectors, leading to their biochemical responses
(4). For RhoA GTPase, several proteins including protein
kinase N, rhophilin, rhotekin, mammalian Diaphanous 1
(mDia1), Rho kinase (ROCK), and citron kinase have been
identified as direct effectors. Both mDia1 and ROCK have been
recognized as key mediators of the RhoA effect on cell actin
reorganization, cell proliferation, and cytokinesis (5). Upregulation of RhoA activity has often been associated with
tumorigenesis (6). Overexpression of either RhoA itself or its
upstream or downstream signaling elements has been detected
in several human tumors, including pancreatic cancer, noninflammatory breast cancer, melanomas, lung cancer, colorectal
cancer, and gastric cancer (7, 8). Inhibitory mutants of RhoA
can prevent Ras-induced transformation of fibroblasts, whereas
overexpression of a constitutively active mutant of RhoA can
transform NIH 3T3 cells and promote the invasive potential of
cultured rat hepatoma cells (9, 10). When RhoA was inhibited
by the Clostridium botulinum C3 toxin or by a dominantnegative mutant in Swiss 3T3 cells, the G1-S cell cycle progression was significantly impaired. Furthermore, active RhoA
mutant could induce G1-S-phase progression in serum-starved
quiescent cells (11, 12). RhoA has thus been suggested to
contribute to cancer cell transformation.
Abundant observations indicate that RhoA may regulate cell
cycle progression by affecting several critical components of
Received 5/27/2008; revised 11/24/2008; accepted 12/9/2008; published online
4/16/09.
Grant support: National Natural Science Funds for Distinguished Young
Scholar grant 30325039 and Doctoral Fund of Ministry of Education of China
grant 20060610068.
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Feng Bi, Division of Abdominal Cancer and the
Laboratory of Signal Transduction and Molecular Targeting Therapy, State Key
Laboratory of Biotherapy, West China Hospital, Sichuan University, Chengdu
610041, Sichuan Province, People's Republic of China. Phone: 86-2885423609; Fax: 86-28-85164046. E-mail: [email protected]
Copyright © 2009 American Association for Cancer Research.
doi:10.1158/1541-7786.MCR-08-0248
570
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
RhoA Regulates Cell Cycle by Modulating INK4 Family
protein alterations in the human gastric AGS cell line, which
has elevated RhoA expression and activity. Our results show
that suppression of RhoA or its effectors, mDia1/ROCK, inhibits the gastric cancer cell growth and causes G1-S cell cycle
arrest. This effect is due to increased INK4 family proteins as
well as an accumulation of the Cip/Kip family proteins. We
conclude that RhoA may use ROCK and mDia1 effector pathways in regulating G1-S progression of gastric cancer cells by
modulation of the INK4 family cell cycle inhibitors.
Results
RhoA Expression in Gastric Cancer Cell Lines and the
Normal Gastric Mucosal Epithelial Cell Line GES-1
RhoA expression in three gastric cancer cell lines and normal gastric mucosal epithelial cell line GES-1 were investigated
by Western blotting (Fig. 1A). Significantly increased expression of RhoA in all three gastric cancer cell lines, SGC7901,
AGS, and MKN45, by comparison with that of the GES-1 cell
line, was observed. This is consistent with our previous results
showing that RhoA-GTP level in these cancer cells is also
elevated (7). We chose to use the AGS cell line as our experimental model in the following studies.
FIGURE 1. Expression of RhoA in gastric cancer cell lines and effects of
RhoA and mDia1 siRNAs. A. Expression of RhoA in three gastric cancer
cell lines and normal gastric mucosal epithelial cell line GES-1 were examined by Western blotting. There were higher expressions of RhoA in the
three gastric cancer cell lines, SGC7901, AGS, and MKN45, compared with
that of the GES-1 cell line. B. Gastric cancer AGS cells were transiently
transfected with three stealth duplexes of siRNA of RhoA or mDia1, respectively, by Lipofectamine and nonspecific duplex was taken as the control.
Forty-eight hours later, total proteins were extracted and subjected to analysis on 15% or 8% SDS-PAGE followed by Western blotting. Membranes
were probed with anti-RhoA, mDia1, and β-actin antibodies followed by
peroxidase-conjugated appropriate secondary antibodies and visualized
by enhanced chemiluminescence detection system. Efficiency of inhibition
of siRNA oligonucleotides of RhoA and mDia1 was >90%. Representative
experiment of three determinations with similar results.
the cell cycle machinery, including the activities of cyclindependent kinases (CDK) and CDK inhibitors (CKI). Activated
Ras was unable to promote the G1-S progression in Swiss 3T3
fibroblasts when RhoA activity was suppressed, which in part
was attributed to an accumulation of high level of p21Waf1/Cip1
(13, 14). Similarly, there is evidence suggesting that RhoA
activation is crucial for p27Kip1 down-regulation and RhoAmediated activation of ROCK and mDia1 can promote G 1
progression through Skp2-mediated degradation of p27Kip1
(15-18). However, dominant-negative CDK2 can prevent the
down-regulation of p27 Kip1 in response to the expression
of an active RhoA mutant, which suggests that RhoA may
also promote p27Kip1 degradation via the activation of cyclin
E/CDK2 complex (19). It is possible that RhoA regulates cell
proliferation and cell cycle progression through p21Waf1/Cip1
and p27Kip1.
Within the CKI family, whether INK4 proteins have a role in
the RhoA-mediated cell cycle progression has yet to be examined. In the present study, by using specific small interfering
RNA (siRNA) and small-molecule inhibitors, we have assessed
the effect of the suppression of RhoA or its effectors on cell
growth, cell cycle progression, and the associated cell cycle
Effect of RhoA and Effector Knockdown on Gastric
Cancer Cell Proliferation
Previous studies have shown that RhoA contributes to cell
proliferation in many cell types. We used specific siRNA
against RhoA or mDia1, and the ROCK inhibitor Y27632, to
specifically block RhoA and its signaling pathways. The efficiency of inhibition by the respective siRNA oligonucleotides
was >90% as determined by immunoblotting (Fig. 1B). After
treatment with the siRNAs or Y27632, cell growth rates were
quantified as described in Materials and Methods. All treated
cells showed significantly reduced growth (P < 0.01) compared
with the untreated groups. Although both the siRNAs and
Y27632 can inhibit AGS cell growth, a significantly stronger
inhibitory effect was observed in the cells with double suppression of mDia1 and ROCK compared with inhibition of mDia1
alone. In addition, the growth inhibition of Y27632-treated
cells was more evident than the mDia1 knockdown group
(Fig. 2). These results indicate that RhoA, through its effectors
mDia1 and ROCK, play a key role in AGS cell proliferation.
Regulation of Cell Cycle Progression
To further understand the mechanisms of the growth inhibition, the effect of the suppression of RhoA or its effectors on
the cell cycle regulation of AGS cells was analyzed by propidium iodide staining and flow cytometric analysis (Fig. 3). To
varying extents, the cell cycle was found accumulated at the G1
phase after the application of the RhoA, mDia1, or ROCK inhibitors, which is associated with a corresponding decrease in S
and G2-M phases when compared with the untreated control
cells. Consistent with the results of cell growth modulation,
double suppression of mDia1 and ROCK showed an accumulation of 53.0% in the G1 phase, whereas 49.2%, 46.3%, and
50.3% cells in the G1 phase were found in the RhoA, mDia1,
and ROCK suppressed cells, respectively. There is a statistical
significance between each of treated groups and the untreated
groups. Furthermore, double suppression of mDia1 and ROCK
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
571
572 Zhang et al.
group of cells showed significant difference from that of the
cells treated with siRNA of mDia1 alone. These results suggest
that the growth-inhibitory effect of RhoA inhibition is the
result of a block in the cell cycle at G1 phase and that both
ROCK and mDia1 contribute to the RhoA regulated
G1-S-phase progression.
Alteration of Cip/Kip Family Proteins and INK4 Family
Proteins
CKIs are well known to interfere with cell cycle progression
and their deregulation can cause cell cycle phase-specific arrest.
These cell cycle kinase inhibitors perturb the phosphorylation
regulation of their target proteins, CDKs. The protein levels of
Cip/Kip family members are crucial for the regulation of G1-S
progression. We next investigated the expression patterns of the
Cip/Kip family members under the RhoA pathway-specific
inhibitors by Western analysis (Fig. 4A and B). Both siRNAs
against RhoA and mDia1 caused a significantly accumulation
of p21Waf1/Cip1 and p27Kip1 proteins compared with AGS control cells. On the contrary, Y27632 did not significantly alter
the expression of p21 Waf1/Cip1 or p27 Kip1 . These findings
suggest that RhoA-mediated p21Waf1/Cip1 and p27Kip1 expression is likely through mDia1-dependent, but not the ROCKdependent, pathway in the AGS cells.
The INK4 family members are differentially expressed during mammalian development. The diversity in the patterns of
FIGURE 2. Growth-inhibitory effect of selective suppression of RhoA or
its effectors on AGS cells. Gastric cancer AGS cells were treated with transient transfection of siRNA of RhoA or mDia1 (5 pmol) by Lipofectamine
and nonspecific duplex was taken as the control; ROCK inhibitor Y27632
was used at 10 μmol/L. Cell Counting Kit-8 assay was used to measured
relative cell growth rate. Growths of the AGS cells were significantly inhibited by siRNA of RhoA or mDia1 and Y27632 at different extent. Mean ±
SD of three independent experiments. Statistical significance was determined by one-way ANOVA: *, P < 0.01, significant difference compared
with AGS cells control; &, P < 0.01, significant difference compared with
the siRNA transfectant of mDia1 cells. Y, Y27632.
FIGURE 3. Effects of suppression of RhoA, mDia1, and/or ROCK on
cell cycle progression. AGS cells were treated with siRNAs of RhoA and
mDia1, and Y27632, and then collected by trypsinization. Cells were fixed
and stained with propidium iodide. Flow cytometry was done, and cell cycle
distribution was analyzed. Mean ± SE from three repetitions. Statistical
significance was determined by one-way ANOVA: *, P < 0.01, statistical
difference from either of untreated controls; &, P < 0.01, statistical difference from siRNA of mDia1-treated group.
expression of INK4 genes suggests that this family of cell cycle
inhibitors may have cell lineage-specific or tissue-specific functions. Apart from their physiologic roles, the INK4 proteins are
often inactivated in cancer, and they are established tumor suppressors (20, 21). Although prior studies have shown that INK4
proteins have an important role in the regulation of the cell cycle, little is known with respect to whether they are involved in
the regulation of cell cycle progression by RhoA. Next, we investigated their possible alteration at both mRNA and protein
levels in our model system. By real-time PCR (RT-PCR), we
found that the mRNA levels of all INK4 family members were
significantly increased in the RhoA or effector inhibited cells
comparing with control cells (Fig. 4E-H). This phenomenon
is more evident in the mDia1 and ROCK double-blocking cells
with an increase of ∼10.24-fold in p15 INK4b , 17.9-fold in
p16INK4a, and 18.05-fold in p18INK4c, and higher mRNA expression of p19INK4d was also found in the Y27632-treated
cells. The changes of the INK4 family member expression appear to be more modest in the mDia1 cells than that of other
experimental groups. In support of these observations, the protein expression patterns of the four INK4 family members were
found to be altered in a similar trend as the mRNAs (Fig. 4C
and D). These results suggest that RhoA may modulate the
INK4 family members through the ROCK pathway, which is
distinct from the mechanism of regulation of the Cip/Kip
family proteins.
Subcellular Localizations of p27Kip1 and p21Waf1/Cip1
The subcellular localizations of p27Kip1 and p21Waf1/Cip1 are
closely tied to their functions. p27Kip1 is mostly localized in the
nuclei under normal physical conditions but is largely excluded
from the nuclei in many tumor cells. There is considerable evidence showing that the cytoplasmic localization of p27Kip1
correlates with high tumor grade and poor prognosis (22-24).
With this in mind, we performed immunofluorescence assays
to investigate the subcellular localization of p21Waf1/Cip1 and
p27Kip1 proteins in AGS cells after blocking RhoA pathways
(Fig. 5). The number of p21Waf1/Cip1- and p27Kip1-positive
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
RhoA Regulates Cell Cycle by Modulating INK4 Family
cells, as well as increased staining intensity of p21Waf1/Cip1
and p27Kip1, was found higher in the RhoA or mDia1 siRNAtreated cells than in control cells. Abundant p27Kip1 appeared in
the cytoplasm after RhoA or mDia1 suppression, whereas
p21Waf1/Cip1 was mostly localized in the nucleus. As controls,
both p21Waf1/Cip1 and p27Kip1 were found only in the nucleus
with significantly lower levels in Y27632-treated cells or
untreated control cells. These observations raise the possibility
that the RhoA-mDia1 pathway is involved in regulating
p27Kip1, but not p21Waf1/Cip1, nucleus localization.
Alteration of Cyclins and CDKs
It is well known that CDK2, CDK4/6, cyclin D, and cyclin E
cooperate to promote G1-phase progression. Generally, these
CDKs are negatively regulated by CKIs, including the INK4
family members. We found that by blocking RhoA, mDia1, or
ROCK, the protein levels of CDK2 and CDK4/6 were downregulated (Fig. 6A and B), whereas the cyclin D1 and cyclin
E levels appeared unaffected (data not shown). Additionally,
the activities of CDK2 and CDK4/6 were analyzed by an in vitro
kinase assay using a Rb-C fusion protein as a substrate. This
FIGURE 4. Expression of CKIs after
selective suppressions of RhoA or its
effectors in AGS cells. A to D. Effects
of selective inhibition of RhoA and its
effectors on p15INK4b, p16INK4a, p18INK4c,
and p19 INK4d protein expressions were
analyzed by Western blotting. Total cell
lysates were prepared from the treated
AGS cells and subjected to analysis on
15% SDS-PAGE followed by Western
blotting. Loading volume was normalized
with respective protein contents. A. Expression of p15INK4b, p16INK4a, p18INK4c,
and p19INK4d were analyzed by Western
blotting. β-Actin was used as a loading
control. Representative blot of each protein from three independent experiments
that yielded similar results, respectively.
B. Protein expression levels of INK4 family members were measured by quantitative Western blotting as described in
Materials and Methods. Densitometry
data presented in graphical form are
“fold change” compared with AGS cells
control after normalization with respective
loading control (β-actin). Mean ± SD
(n = 3). Statistical significance was determined by one-way ANOVA: *, P < 0.05,
statistically significant difference compared with AGS cells control. C. Expression of p21 Waf1/Cip1 and p27 Kip1 were
analyzed by Western blotting. β-Actin
was used as a loading control. Representative blot of each protein from three
independent experiments that yielded similar results, respectively. D. Protein expression levels of p21 W a f 1 / C i p 1 and
p27Kip1 were quantified by densitometric
analysis of Western blotting. Densitometry
data presented in graphical form are
“fold change” compared with AGS cells
control after normalization with respective
loading control (β-actin). Mean ± SD
(n = 3). *, P < 0.05 versus AGS cells control. E to H. Effects of selective inhibition
of RhoA and its effectors on p15 INK4b ,
p16INK4a, p18INK4c, and p19INK4d mRNA
expressions were analyzed by RT-PCR.
Total RNA was extracted from the treated
AGS cells 48 h after the transfection and
24 h after using Y27632. RT-PCR products of the GAPDH were chosen as the
internal standard for RNA quantity and integrity. Relative RNA levels of INK4 family
compared with the GAPDH in each group
are expressed as mean ± SD (n = 3), respectively. Similar results were obtained in
three independent experiments. *, P <
0.01, statistically significant difference
compared with AGS cells control; &, P <
0.05, statistical difference from siRNA of
mDia1-treated group.
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
573
574 Zhang et al.
FIGURE 5. Subcellular localization of p21Waf1/Cip1 and p27Kip1. AGS cells were cultured in 6-well plate with coverslips and treated with the different inhibitors
separately. Forty-eight hours later, cells were then detected by immunofluorescence with anti-p21Waf1/Cip1 and p27Kip1 antibodies followed by secondary
antibodies conjugated to Alexa Fluor 594 (red) dyes. Coverslips were mounted on slides using Vectashield mounting medium containing 4′,6-diamidino-2phenylindole. Cells were visualized by Olympus IX81 microscope (×60 objectives). Similar results were obtained in three independent experiments.
substrate fusion protein contains maltose-binding protein, the
COOH-terminal region (701-928) of pRb, which can be phosphorylated by various cyclin-CDK complexes. Because pRb
residue Ser795 is preferentially phosphorylated by CDK2 or
CDK4/6 (25), we measured CDK activities by detecting
Ser795-specific phosphorylation of Rb-C by Western blot analysis. As shown in Fig. 6C and D, the activity of CDK2 was
strongly reduced in the siRNA mDia1 cell group as well as in
the RhoA knockdown cells but not in the ROCK-targeted
cells, suggesting that RhoA regulates CDK2 activity through
the mDia1 pathway. A significant inhibition of CDK4/CDK6
expression and activities in the Y27632-treated cells was
observed, similar to the RhoA-targeted cells, suggesting that
CDK4/CDK6 is modulated by the RhoA-ROCK pathway.
Overall, our data suggest that RhoA and its effectors mDia1
and ROCK regulate the CDK2 and CDK4/6 at the expression
and/or activity level, which may involve multiple inputs through
cyclins and CKIs as well as transcriptional machineries.
Regulation of the E2F Family Transcriptional Factors
The E2F/Rb pathway is a major regulatory component for
genes that are required for S-phase entry. Hypophosphorylated
Rb binds to and occludes the transactivation potential of E2F
transcription factors. To determine the functional consequences
of persistently hypophosphorylated Rb proteins at late G1-S
transition, during which a complex is formed by Rb with
E2F, the expressions of E2F1, E2F2, and E2F3 in the wholecell lysates were investigated, and the Rb-bound E2Fs were analyzed by immunoprecipitation. There was a marked increase
in the complex formation of Rb/E2F1, Rb/E2F2, and Rb/
E2F3 in all treated cells compared with control cells (Fig. 8C
and D), whereas the protein expression levels of E2F1, E2F2,
and E2F3 were unaffected (Fig. 8A and B). These results indicate that RhoA and its effectors regulate the binding of Rb to
the E2F family members but do not affect the expression of
these proteins. The complex formation of Rb with E2F regulated by RhoA requires both the mDia1 and the ROCK pathways.
Phosphorylation and Induction of Rb Family Proteins
CKIs regulate the activity of CDKs, which in turn regulate
phosphorylation of several substrates, including pRb. Rb is a
key regulator of cell cycle G1-S progression. Phosphorylation
of specific pRb serine or threonine residues has been shown to
regulate the binding of Rb with different targets, including E2F
family members, and inhibit their activities. Next, the phosphorylation status of Rb was examined by immunoblotting
using antibodies directed against phosphorylated Rb (Ser780,
Ser795, and Ser807/Ser811) and Rb (Fig. 7A and B). As expected,
phosphorylation at Ser795 and Ser807/Ser811 was preferentially
inhibited by RhoA or mDia1 knockdown, whereas a relatively
milder change was found in the ROCK inhibitor-treated cells.
In contrary, the changes of phosphorylation at Ser780 did not
appear to be significantly affected. These observations suggest
that phosphorylation of Rb at Ser795 and Ser807/Ser811 can be
regulated by the RhoA-mDia1 pathway in AGS cells.
Discussion
Several studies have shown that RhoA is overexpressed in
cancer tissues compared with that of normal tissues (7, 8).
Overexpression of RhoA in NIH 3T3 cells causes the cells to
become tumorigenic in nude mice. Transformation by RasV12
can be suppressed by dominant-negative RhoA. These evidence strongly suggest that RhoA plays an important role in
tumorigenesis (6, 26-28). Our previous work has shown that
RhoA was overexpressed and highly activated in seven gastric
cancer cell lines (7). In the present study, we further show that
there is elevated expression of RhoA in three gastric cancer cell
lines and found that RhoA-specific siRNA could significantly
inhibit the proliferation and tumorigenesis of AGS cells (29).
Previous studies have indicated that RhoA mainly regulates
the G 1 -S cell cycle procession through Cip/Kip family
(18, 30), and RhoA has also been linked to transcription of
p21Waf1/Cip1 (13) and cyclin D1 (31, 32) and the degradation
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
RhoA Regulates Cell Cycle by Modulating INK4 Family
of p27Kip1 through regulation of cyclin E/CDK2 activity (19,
32, 33). However, these studies were conducted in fibroblast
cells, and the mechanistic role of RhoA in the proliferation of
cancer cells remains unclear. By using the gastric cancer cell
line AGS as a cell model, we show here that not only
p21Waf1/Cip1 and p27Kip1, but also the INK4 family members,
may be intimately involved in RhoA regulation of G1-S cell
cycle progression, and RhoA depends on mDia1 and ROCK
differentially in this process.
Accumulating evidence suggest that the INK4 family could
have important roles in tumor suppression. The INK4 class
of cell cycle inhibitors, p15INK4b , p16 INK4a , p18 INK4c , and
p19INK4d, are homologous inhibitors of the CDKs, CDK4 and
CDK6, which promote cell proliferation (21, 34, 35). Knockout
studies of mice specifically deficient for p15INK4b and p16INK4a
have revealed that they are more prone to spontaneous cancers
than wild-type littermates (36). Overexpression of p15INK4b and
p16INK4a in mice also maintains its role in tumor suppression
(37). Latres et al. reported that p18INK4c-null mice also exhibit
hyperplasia and pituitary tumors (38). In the current study, we
found the expression of four INK4 family members all increased
to a different extent, in both the protein and the mRNA levels,
after the RhoA pathways were blocked. In fact, loss of p15INK4b,
p16INK4a, and p18INK4c by gene mutation, deletion, and/or methylation has been reported in a variety of human cancers (39, 40).
Clinical findings have revealed that loss of p16INK4a function
is correlated with a poor prognosis in some human cancers
(41). These studies have suggested that INK4 family members
might play a negative role in the progression and prognosis
of human cancers. Accordingly, our study indirectly supports
these findings. We found that there were mild elevations of
the INK4 family members in RhoA or mDia1 knockdown cells,
but remarkable changes were found in the double suppression
of mDia1 and ROCK or ROCK alone, suggesting that RhoA regulates the expression of INK4 family members through the
ROCK pathway.
In addition to the INK4 proteins, up-regulation of p21Waf1/Cip1
and p27Kip1 was found in RhoA or mDia1 knockdown cells but
FIGURE 6. Effects of inhibition of RhoA and its effectors on the expression and activities of CDKs in AGS cells. Cells were treated with the different
inhibitors separately. At the end of the treatments, whole-cell lysates were prepared and subjected to immunoblotting and immunoprecipitation. Loading
volume was normalized with respective protein contents. A. Expression of CDK2, CDK4, and CDK6 was analyzed by Western blotting. β-Actin was used
as a loading control. Representative blot of each protein from three independent experiments that yielded similar results. B. Protein expression levels of
CDK2, CDK4, and CDK6 were measured by quantitative Western blotting. Densitometry data presented in graphical form are “fold change” compared with
AGS cells control after normalization with respective loading control (β-actin). Mean ± SD (n = 3). *, P < 0.05 versus AGS cells control. C. CDK2, CDK4, and
CDK6 were immunoprecipitated from whole-cell lysates by using specific antibodies. Their activities were tested by the kinase assay employing Rb fusion
protein as a substrate. Samples were subjected to be analyzed by 12% SDS-PAGE and immunoblotting with anti-pRb-Ser795 antibody. β-Actin was used as a
loading control. Representative blot from three independent experiments that yielded similar results. D. Activities of CDK2, CDK4, and CDK6 were quantified
by densitometry. All data of relative activity presented in graphical form are “fold change” compared with AGS cells control after normalization with respective
loading control (β-actin). Mean ± SD (n = 3). *, P < 0.05 versus AGS cells control.
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
575
576 Zhang et al.
not in the Y27632-treated cells. There is abundant evidence suggesting that RhoA regulates the expression of p21Waf1/Cip1 and
p27Kip1, which influence the progression of the G1-S cell cycle.
For example, RhoA represses p21Waf1/Cip1 expression in oncogenic Ras-induced G1-S-phase progression in Swiss 3T3 fibroblasts (13). Inhibition of RhoA and ROCK resulted in increased
p21Waf1/Cip1 expression through an extracellular signal-regulated
kinase-dependent pathway and decreased smooth muscle cell
proliferation (42, 43). However, similar to our results, in Rastransformed fibroblasts or colon cancer cell lines, suppression
of p21Waf1/Cip1 mediated by RhoA does not require ROCK,
suggesting that the modulation of p21Waf1/Cip1 expression
by RhoA is mediated by cell type-dependent signaling pathways (44-46). Suppression of RhoA has been reported to
elevate p27 Kip1 protein levels (19, 33), but when shaperestricted capillary cells on low fibronectin were treated with
Y27632, the p27Kip1 expression decreased (18). Zuckerbraun
et al. reported that RhoA did not appear to be involved in
the regulation of p27Kip1 expression in smooth muscle cells
(42), whereas Mammoto et al. reported that RhoA-mediated
activation of ROCK and mDia1 can promote G1 progression
by inhibiting p27Kip1 (18). Our results suggest that RhoA
modulates the expression of p21Waf1/Cip1 and p27Kip1 through
the mDia1 pathway in AGS cells. The inconsistencies in the
literature may be due to the fact that different cell lines were
examined and suggest that the modulation mechanism of
p21Waf1/Cip1 and p27Kip1 expression by RhoA warrants further
study in specific cell lineages.
Recent studies provide in vivo evidence that, in addition to
their roles as tumor suppressors, p21Waf1/Cip1 and p27Kip1 may
also function as oncogenes in certain tumor cells when they
mislocalize to the cytoplasm (47, 48). Cytoplasmic localization of p27Kip1 was shown to correlate with high tumor grade
and poor prognosis in human cancers, which suggests an
active tumor-promoting function of p27Kip1 in the cytoplasm
(22-24). Likewise, when p21 Waf1/Cip1 translocated to the
cytoplasm, it can inhibit caspase-3, thus inhibiting apoptosis
(49). In our study, significant cytoplasmic localization of
p27Kip1 was observed in AGS cells on RhoA down-regulation.
However, p21Waf1/Cip1 was found mostly in the nucleus in
these cells. We caution that the anti-p27 antibody we employed for immunofluorescence studies needs more careful
examination for specificity. Besson et al. found that the
p27Kip1CK-/CK- knock-in mice, a mutant p27Kip1 that can no
longer bind with cyclin/CDKs, developed a whole range of
hyperplastic and neoplastic lesions, including lung adenocarcinomas and pituitary tumor. Intriguingly, the p27Kip1CK-/CKmutant also localizes in the cytoplasm, further suggesting
that a cytoplasmic function might mediate the oncogenic
effect (48). How our observed cytoplasmic localization of
p27Kip1 in the RhoA or mDia1 knockdown AGS cells affects
the RhoA-mediated function will require further examination
by p27Kip1 suppression.
Consistent with our previous observations, siRNA suppression of RhoA slowed the growth of gastric cancer AGS cells.
The suppression of either ROCK or mDia1 can also inhibit
AGS cell growth, but it seems that Y27632 is more efficient
than the mDia1 siRNA in the inhibition of the AGS cell proliferation. Fluorescence-activated cell sorting analysis revealed
FIGURE 7. Suppressions of RhoA, mDia1, and/or ROCK inhibit Rb
phosphorylation in AGS cells. Cells were treated with the different inhibitors separately. Forty-eight hours later, total cell lysates were prepared and
subjected to immunoblotting with Phosphoplus anti-Rb: Ser780, Ser795, and
Ser807/Ser811 antibodies and anti-Rb antibody. Loading volume was normalized with respective protein contents. A. Representative Western blots.
B. Quantification of three independent experiments. Densitometry data
presented in graphical form are “fold change” compared with AGS cells
control after normalization with respective “loading control” (total protein
of Rb). Mean ± SD (n = 3). *, P < 0.05 versus AGS cells control.
that the cell cycle was arrested by suppression of RhoA and
its downstream effectors at the G1-S-phase transition. Other
studies have shown that RhoA and its effectors promoted cell
cycle progression of G1-S (18, 32). Our data indicate both
mDia1 and ROCK are important mediators in this pathway
and both the Cip/Kip family and the INK4 family are involved
in the regulation of G1-S transition in AGS cells. It is possible
that the RhoA-ROCK-INK4 pathway plays an important role in
the G1-S transition in the gastric cancer AGS cells. Another
study reported that p27Kip1 showed a greater antitumor effect
than that of the other CKIs (p16INK4a, p18INK4c, p19INK4d,
and p21Waf1/Cip1) in malignant glioma cells (50), raising the
possibility that the involvement of INK4 versus Cip/Kip in
tumor cell growth may be cell type specific.
CKIs are tumor suppressor proteins that down-regulate cell
cycle progression by binding to active cyclin/CDK complexes,
thereby inhibiting their kinase activities (51, 52). We observed
that the INK4 family and Cip/Kip family members are upregulated by RhoA down-regulation, which attenuates the
activities of the cyclin/CDK complexes. The predominant
cyclin/CDK complexes are cyclin D/CDK4, cyclin D/CDK6,
and cyclin E/CDK2 during G1 progression and G1-S transition
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
RhoA Regulates Cell Cycle by Modulating INK4 Family
(53). Our data revealed that the expression and activities of
CDK2, CDK4, and CDK6 were reduced to a different extent
by blocking of RhoA, mDia1, or ROCK, and this effect was
associated with the hypophosphorylation of Rb protein. Previous studies have reported that RhoA activation is associated
with activation of the cyclin D1 promoter in mammary epithelial cells and functions as the master regulator of cyclin D1
expression and G1 progression in NIH 3T3 cells (30, 32). We
did not find detectable changes of cyclin D1 or cyclin E but
observed an inactivation of related CDKs in our system.
Furthermore, we found that the phosphorylation of Rb at
Ser780, Ser795, and Ser807/Ser811 sites were decreased, and the
binding of Rb to E2F was elevated. Because Rb sequesters
the E2F family transcription factors, the E2F family regulating
proteins required for S-phase DNA synthesis are reduced by
RhoA inhibition, affecting G1-phase progression.
In summary, suppression of RhoA and its effectors, mDia1
and/or ROCK, results in G 1 -S cell cycle arrest in gastric
cancer AGS cells. The INK4 family members, p15 INK4b ,
p16INK4a, p18INK4c, and p19INK4d, as well as the p21Waf1/Cip1
and p27Kip1, are all up-regulated after the suppression. In this
process, RhoA regulates the INK4 family members through the
ROCK pathway, but the Cip/Kip family members are regulated
by the RhoA-mDia1 pathway. The alterations cause changes in
the expression and activation of related CDKs, allowing Rb
proteins to sequester E2F family transcription factors. Our
study provides insight into the regulatory function of RhoA
in gastric cancer cell growth and suggests new molecular
targeting therapies in the fight against gastric cancer.
Materials and Methods
Antibodies
Antibodies against p15INK4b (sc-612), p16INK4a (sc-9968),
p18INK4c (sc-9965), p19INK4d (sc-1063), mDia1 (sc-10886),
and RhoA (sc-418) were from Santa Cruz Biotechnology. Antibodies to p21Waf1/Cip1 (2946), p27Kip1 (2552), CDK2 (2546),
Rb (Ser780, Ser795, and Ser807/Ser811), Kit (9300), and β-actin
FIGURE 8. Effect of suppression of RhoA, mDia1, and ROCK on the expression of E2F and the binding of Rb to E2F in AGS cells. Cells were treated with
the different inhibitors separately. At the end of the treatments, whole-cell lysates were prepared and subjected to immunoblotting and immunoprecipitation.
Loading volume was normalized with respective protein contents. A. Expression of E2F1, E2F2, and E2F3 were analyzed by Western blotting. β-Actin was
used as a loading control. Representative blot of each protein from three independent experiments that yielded similar results, respectively. B. Protein
expression levels of E2F family members were quantified by densitometric analysis of Western blotting. Densitometry data presented in graphical form
are “fold change” compared with AGS cells control after normalization with respective loading control (β-actin). Mean ± SD (n = 3). *, P < 0.05 versus
AGS cells control. C. Total protein extracts were subjected to immunoprecipitation with anti-Rb antibody followed by SDS-PAGE on 12% gels and Western
blotting. Membranes were probed with anti-E2F1, anti-E2F2, anti-E2F3, and anti-Rb antibody separately followed by peroxidase-conjugated appropriate
secondary antibody and visualization by the enhanced chemiluminescence detection system. Representative blot of each protein from three independent
experiments that yielded similar results, respectively. D. Binding levels of Rb to E2F family members were quantified by densitometric analysis. Densitometry
data presented in graphical form are “fold change” compared with AGS cells control after normalization with total Rb protein. Mean ± SD (n = 3). *, P < 0.05
versus AGS cells control. IP, immunoprecipitation; WB, Western blotting.
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
577
578 Zhang et al.
(4970) were from Cell Signaling Technology. Antibodies
against CDK4 (06-139) and E2F3 (05-551) were from Upstate
Biotechnology. Antibodies against E2F1 (554312) and E2F2
(556525) were from BD Pharmingen Technical. Antibody to
CDK6 (AHZ0242) was from Biosource. Antibodies against
cyclin D1 and cyclin E are from Calbiochem. Goat anti-mouse
and goat anti-rabbit horseradish peroxidase-conjugated antibodies were from Pierce.
Cell Lines and Cell Culture
Gastric cancer cell lines SGC7901, AGS, and MKN45 and
immortal gastric mucosal epithelial cell line GES-1 were all
preserved in our institute (7). All cell lines were maintained
in RPMI 1640 (Invitrogen) supplemented with 10% fetal
bovine serum (Life Technologies), 100 units/mL penicillin G
sodium, and 100 μg/mL streptomycin sulfate (Sigma). Cells
were grown at 37°C in a humidified atmosphere containing
5% CO2.
siRNA Transfection
Three duplexes of siRNA sequences against RhoA and
mDia1 molecules were chemically synthesized by Invitrogen.
siRNA oligonucleotides were prepared following the manufacturer's instructions. In preliminary experiments, we investigated
the expression of RhoA in the gastric cancer cell lines and normal GES-1 cell line with Western blotting. Subsequently, we optimized conditions for efficient transfection and determined the
efficacy of siRNA oligonucleotides using Western blotting. We
selected one duplex from the three, which had the strongest interfering effect. The efficiencies of inhibition of both RhoA
(sense 5′-UGAGCAAGCAUGUCUUUCCACAGGC-3′ and
antisense 5′-GCCUGUGGAAAGACAUGCUUGCUCA-3′)
and mDia1 (sense 5′-AAAGCUCUCACUCUUACGUAACUCC-3′ and antisense 5′-GGAGUUACGUAAGAGUGAGAGCUUU-3′) were >90%.
In transfection experiments, cells were plated on dishes
containing antibiotic-free medium and incubated overnight.
When the cells were at 40% to 50% confluence, siRNA oligonucleotides transfection was done with Lipofectamine 2000
(Invitrogen) according to the manufacturer's protocol, and a
nonspecific duplex was used as the control. After 24 h, the
medium was replaced with the fresh medium. Y27632 (Sigma),
an inhibitor of ROCK, was dissolved in water and used at
10 μmol/L. The cells were treated either in the presence or
absence of 10 μmol/L Y27632 for 24 h.
Western Blotting
For analysis of cell cycle proteins, cultured cells were prepared as described above, placed on ice, and rinsed three times
with 10 mL ice-cold PBS. The cells were lysed on the plate
by the addition of radioimmunoprecipitation assay buffer
[150 mmol/L NaCl, 1% NP-40, 50 mmol/L Tris-HCl (pH
7.4), 1 mmol/L phenylmethylsulfonyl fluoride, 1 μg/mL leupeptin, 1 mmol/L deoxycholic acid, and 1 mmol/L EDTA]
containing a cocktail of protease inhibitors and phosphatase
inhibitors (Calbiochem) on a rotating shaker for 30 min.
Next, lysates were sonicated for 10 s and centrifuged at 4°C,
13,000 rpm for 30 min. The protein concentration in the supernatant was determined by BCA protein assay kit (Pierce) and
the lysates were stored at -70°C. Equal amounts of lysate pro-
teins were subjected to SDS-PAGE on 8%, 12%, or 15% gels
and transferred to polyvinylidene fluoride membrane (Millipore) through semidry transfer. The membrane was blocked
with 5% nonfat milk in TBS-0.05% Tween 20 for 2 h and
incubated with a primary antibody in TBS-0.05% Tween 20
overnight at 4°C followed by secondary antibodies for 2 h at
room temperature. Immunoreactivity was detected using Super
Signal West Pico Chemiluminescent Substrate and Super
Signal West Dura Extended Duration Substrate (Pierce).
Immunoprecipitation
Harvested cells were incubated in immunoprecipitation
buffer [50 μmol/L Tris-HCL (pH 7.4), 200 μmol/L NaCl,
0.1% Triton X-100] containing a cocktail of protease inhibitors
and phosphatase inhibitors as described previously. Samples of
total protein (1 mg) were incubated with anti-Rb primary antibody and rotated end-up overnight at 4°C followed by incubation with Gammabind plus Sepharose (GE Healthcare) for 2 h.
The protein complexes were washed three times with immunoprecipitation buffer and released from the Sepharose beads by
boiling in loading buffer for 5 min and then centrifuged. The
immune complexes were subjected to 12% SDS-PAGE and
transferred to polyvinylidene fluoride membrane. The membrane was blocked with 5% nonfat milk and incubated with
primary anti-E2F1, E2F2, E2F3, and Rb antibodies.
CDK Activity Assay
The cells were incubated in a nondenaturing cell lysis buffer
[20 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1 mmol/L
Na2EDTA, 1 mmol/L EGTA, 1% Triton X-100, 2.5 mmol/L
sodium pyrophosphate, 1 mmol/L β-glycerophosphate,
1 mmol/L Na3VO4, 1 μg/mL leupeptin] containing a cocktail
of protease inhibitors and phosphatase inhibitors. Total lysates
were prepared and immunoprecipitated with anti-CDK2, antiCDK4, and anti-CDK6 antibodies as described above followed
by incubation with Gammabind plus Sepharose. The bead complexes were washed three times in immunoprecipitation buffer
and then three times in kinase buffer [25 mmol/L Tris-HCl
(pH 7.5), 5 mmol/L β-glycerophosphate, 2 mmol/L DTT, and
0.1 mmol/L Na3VO4, 10 mmol/L MgCl2]. Kinase reactions
were done at 30°C for 30 min in a kinase buffer by using
Rb-C fusion protein (Cell Signaling Technology) as a substrate
at a concentration of 2 μg/20 μL reaction containing 200 μmol/L
ATP followed as per the manufacturer's protocol. The reaction was halted by adding 5× SDS loading buffer. After boiling for 5 min, the reaction products were electrophoretically
separated on a 12% SDS-PAGE gel, and phosphorylated proteins were detected by anti-Ser795 antibody.
Densitometry Analysis
Autoradiograms of the immunoblots were scanned using a
Bio-Rad Image Analyzer System. The blots were adjusted for
brightness and contrast for minimum background, and the
mean density for each band was analyzed using the Bio-Rad
Quantity One Analyzer software. β-Actin was used as a loading control. Samples after siRNA oligonucleotide or Y27632
treatment were normalized to the densitometry value of the
AGS cells without treatment, and the comparative data are presented as “fold change.” Both autoradiograms and respective
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
RhoA Regulates Cell Cycle by Modulating INK4 Family
Table 1. Sequences of PCR Primers, Length of PCR
Products, and Optimal Annealing Temperature
Genes
Primers (5′-3′)
p15
F: CGTGGGAAAGAAGGGAAGAGT
R: CTTGTTCTCCTCGCGCATTC
p16
F: CAGACATCCCCGATTGAAAGAAC
R: GGTAGTGGGGGAAGGCATATATCT
p18
F: TGAAACTTGGAAATCCCGAG
R: GCAGGTTCCCTTCATTATCC
p19
F: CAGTCCAGTCCATGACGCAG
R: CATCAGGCACGTTGACATCAG
GAPDH F: GAAGGTGAAGGTCGGAGTC
R: GAAGATGGTGATGGGATTTC
Template
(bp)
Annealing
(°C)
100
60
60.8
62.5
62.1
57.6
56.2
59.3
59.5
60.1
61.2
195
183
89
225
densitometry data are representative of three independent
experiments with reproducible findings.
Quantitative RT-PCR
Total cellular RNA was extracted using Trizol (Invitrogen)
according to the manufacturer's protocol and quantified by
spectrophotometer (A260/A280; Bio-Rad). The primers used
for SYBR Green PCR were designed with the assistant of
Primer Software version 5.0, listed in Table 1. All primers were
checked by running a virtual PCR, and the amplifications were
analyzed for the expected product. RT-PCR was done using the
iQ5 RT-PCR Detection System (Bio-Rad). All reactions were
run in triplicate and contained SYBR PrimeScript RT-PCR
Kit (Takara) according to the manufacturer's instruction, which
fluoresces when intercalated with DNA, with GAPDH used as
the internal standard. The reactions were carried out in a 25 μL
reaction volume. The thermal profile for all SYBR Green PCRs
consisted of an initial incubation of 10 s at 95°C followed by 45
cycles of 5 s at 95°C, 25 s at 54°C, and 15 s at 72°C. After the
completion of the 45 cycles, there were two additional incubations of 1 min at 95°C and 1 min at 55°C. Next, a melting curve
for the temperatures between 55°C and 95°C with 0.5°C increments was recorded using the samples. Amplification, detection, and data analysis were done with iCycler IQ5 Optical
System software (Bio-Rad). The expression of each mRNA
was normalized to that of GAPDH and analyzed by the comparative threshold cycle (Ct) method.
Cell Cycle Assay
Cells were harvested by trypsinization, washed three times
with ice-cold PBS, and fixed with 70% ethanol overnight at
4°C. The fixed cells were rehydrated in PBS, resuspended in
protease RNase (125 units/mL; Calbiochem) in PBS, and incubated for 30 min at 37°C. DNA was then stained with propidium iodide (50 mg/mL; Sigma-Aldrich) for 30 min at room
temperature in the dark. Samples were analyzed with FACScan
(Beckman Coulter; EPICS ELITE ESP model). The percentage
of cells in each phase of the cell cycle was estimated using
ELITE software.
Cell Proliferation Assay
The cells were cultured in 96-well plates under proper
stimuli. After 1, 2, 3, or 4 day growth, cell medium was
changed with fresh medium containing 10 μL Cell Counting
Kit-8 reagent (WST-8[2-(2-methoxy-4-nitrophenyl)-3-(4nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt]; DOJINDO Lab) for 2 h at 37°C according to
the manufacturer's instructions. After incubation with Cell
Counting Kit-8, the formazan dye generated by the activity
of dehydrogenases in the cells was proportional to the number
of living cells and the absorbance was measured using a
microplate reader at 490 nm with a reference at 630 nm.
Absorbances were converted to percentages by comparisons
with the untreated control. Cell numbers were determined
from a standard plot of known cell numbers versus the
corresponding absorbance density.
Immunofluorescence Microscopy
For analysis of the intracellular location of p21Waf1/Cip1 and
p27Kip1 proteins, AGS cells were cultured in 6-well plates with
coverslips and stimulated as described previously. Forty-eight
hours later, the cells grown on coverslips were fixed with 4%
paraformaldehyde and 4% sucrose for 30 min and then washed
with PBS. Cells were then permeabilized in PBS containing
0.25% Triton X-100, preblocked for 90 min with 3% bovine
serum albumin in PBS, and incubated with the primary antibodies of p21Waf1/Cip1 and p27Kip1 for 90 min at room temperature. After washing, cells were incubated with secondary
antibodies conjugated to Alexa Fluor 594 (red) dyes (Invitrogen) for 90 min. The coverslips were washed and then mounted
on slides using ProLong Gold antifade with 4′,6-diamidino2-phenylindole (Invitrogen). Cells were visualized with an
Olympus IX81 microscope (60× objectives).
Statistical Analysis
Experimental results were expressed as mean ± SD (n = 3)
from data of at least three independent experiments. Statistical
significance was evaluated using a one-way ANOVA test.
P < 0.05 was considered statistically significant.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Acknowledgments
We thank Drs. Juan Huang, Jitao Zhou, Yajie Zhu, and Xiangzheng Chen
for technical assistance and Drs. Bo Xiao, Xiaoxia Du, and Yan Li for helpful
discussions.
References
1. Parkin DM, Pisani P, Ferlay J. Global cancer statistics. CA Cancer J Clin
1999;49:33–64, 1.
2. Parkin DM. International variation. Oncogene 2004;23:6329–40.
3. Etienne-Manneville S, Hall A. Rho GTPases in cell biology. Nature 2002;420:
629–35.
4. Ridley AJ. Rho family proteins: coordinating cell responses. Trends Cell Biol
2001;11:471–7.
5. Shimokawa H, Takeshita A. Rho-kinase is an important therapeutic target in
cardiovascular medicine. Arterioscler Thromb Vasc Biol 2005;25:1767–75.
6. Boettner B, Van Aelst L. The role of Rho GTPases in disease development.
Gene 2002;286:155–74.
7. Pan Y, Bi F, Liu N, et al. Expression of seven main Rho family members in
gastric carcinoma. Biochem Biophys Res Commun 2004;315:686–91.
8. Gomez del Pulgar T, Benitah SA, Valeron PF, Espina C, Lacal JC. Rho
GTPase expression in tumourigenesis: evidence for a significant link. Bioessays
2005;27:602–13.
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
579
580 Zhang et al.
9. Avraham H, Weinberg RA. Characterization and expression of the human
rhoH12 gene product. Mol Cell Biol 1989;9:2058–66.
supports growth factor-stimulated cell cycle progression. J Cell Biol 2000;151:
1413–22.
10. Yoshioka K, Nakamori S, Itoh K. Overexpression of small GTP-binding
protein RhoA promotes invasion of tumor cells. Cancer Res 1999;59:2004–10.
32. Croft DR, Olson MF. The Rho GTPase effector ROCK regulates cyclin A,
cyclin D1, and p27Kip1 levels by distinct mechanisms. Mol Cell Biol 2006;26:
4612–27.
11. Yamamoto M, Marui N, Sakai T, et al. ADP-ribosylation of the rhoA gene
product by botulinum C3 exoenzyme causes Swiss 3T3 cells to accumulate in the
G1 phase of the cell cycle. Oncogene 1993;8:1449–55.
12. Olson MF, Ashworth A, Hall A. An essential role for Rho, Rac, and Cdc42
GTPases in cell cycle progression through G1. Science 1995;269:1270–2.
13. Olson MF, Paterson HF, Marshall CJ. Signals from Ras and Rho GTPases
interact to regulate expression of p21Waf1/Cip1. Nature 1998;394:295–9.
14. Weber JD, Hu W, Jefcoat SC, Jr., Raben DM, Baldassare JJ. Ras-stimulated
extracellular signal-related kinase 1 and RhoA activities coordinate plateletderived growth factor-induced G1 progression through the independent regulation
of cyclin D1 and p27. J Biol Chem 1997;272:32966–71.
15. Rivard N, Boucher MJ, Asselin C, L'Allemain G. MAP kinase cascade is
required for p27 downregulation and S phase entry in fibroblasts and epithelial
cells. Am J Physiol 1999;277:C652–64.
16. Laufs U, Marra D, Node K, Liao JK. 3-Hydroxy-3-methylglutaryl-CoA reductase inhibitors attenuate vascular smooth muscle proliferation by preventing
Rho GTPase-induced down-regulation of p27(Kip1). J Biol Chem 1999;274:
21926–31.
17. Hu ZY, Madamanchi NR, Rao GN. cAMP inhibits linoleic acid-induced
growth by antagonizing p27(kip1) depletion, but not interfering with the extracellular signal-regulated kinase or AP-1 activities. Biochim Biophys Acta 1998;
1405:139–46.
18. Mammoto A, Huang S, Moore K, Oh P, Ingber DE. Role of RhoA, mDia,
and ROCK in cell shape-dependent control of the Skp2-27kip1 pathway and the
G1-S transition. J Biol Chem 2004;279:26323–30.
33. Vidal A, Millard SS, Miller JP, Koff A. Rho activity can alter the translation
of p27 mRNA and is important for RasV12-induced transformation in a manner
dependent on p27 status. J Biol Chem 2002;277:16433–40.
34. Ohtani N, Yamakoshi K, Takahashi A, Hara E. The p16INK4a-RB pathway:
molecular link between cellular senescence and tumor suppression. J Med Invest
2004;51:146–53.
35. Sharpless NE. INK4a/ARF: a multifunctional tumor suppressor locus. Mutat
Res 2005;576:22–38.
36. Sharpless NE, Ramsey MR, Balasubramanian P, Castrillon DH, DePinho
RA. The differential impact of p16(INK4a) or p19(ARF) deficiency on cell
growth and tumorigenesis. Oncogene 2004;23:379–85.
37. Matheu A, Pantoja C, Efeyan A, et al. Increased gene dosage of Ink4a/Arf
results in cancer resistance and normal aging. Genes Dev 2004;18:2736–46.
38. Latres E, Malumbres M, Sotillo R, et al. Limited overlapping roles of p15
(INK4b) and p18(INK4c) cell cycle inhibitors in proliferation and tumorigenesis.
EMBO J 2000;19:3496–506.
39. Nobori T, Miura K, Wu DJ, Lois A, Takabayashi K, Carson DA. Deletions of
the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature
1994;368:753–6.
40. Morishita A, Masaki T, Yoshiji H, et al. Reduced expression of cell cycle
regulator p18(INK4C) in human hepatocellular carcinoma. Hepatology 2004;
40:677–86.
41. Todd R, Hinds PW, Munger K, et al. Cell cycle dysregulation in oral cancer.
Crit Rev Oral Biol Med 2002;13:51–61.
19. Hu W, Bellone CJ, Baldassare JJ. RhoA stimulates p27(Kip) degradation
through its regulation of cyclin E/CDK2 activity. J Biol Chem 1999;274:
3396–401.
42. Zuckerbraun BS, Shapiro RA, Billiar TR, Tzeng E. RhoA influences the nuclear localization of extracellular signal-regulated kinases to modulate p21Waf/Cip1
expression. Circulation 2003;108:876–81.
20. Pei XH, Xiong Y. Biochemical and cellular mechanisms of mammalian CDK
inhibitors: a few unresolved issues. Oncogene 2005;24:2787–95.
21. Ortega S, Malumbres M, Barbacid M. Cyclin D-dependent kinases, INK4
inhibitors and cancer. Biochim Biophys Acta 2002;1602:73–87.
43. Lai JM, Wu S, Huang DY, Chang ZF. Cytosolic retention of phosphorylated
extracellular signal-regulated kinase and a Rho-associated kinase-mediated signal
impair expression of p21(Cip1/Waf1) in phorbol 12-myristate-13-acetate-induced
apoptotic cells. Mol Cell Biol 2002;22:7581–92.
22. Slingerland J, Pagano M. Regulation of the cdk inhibitor p27 and its deregulation in cancer. J Cell Physiol 2000;183:10–7.
44. Sahai E, Ishizaki T, Narumiya S, Treisman R. Transformation mediated by
RhoA requires activity of ROCK kinases. Curr Biol 1999;9:136–45.
23. Philipp-Staheli J, Payne SR, Kemp CJ. p27(Kip1): regulation and function of
a haploinsufficient tumor suppressor and its misregulation in cancer. Exp Cell Res
2001;264:148–68.
45. Sahai E, Olson MF, Marshall CJ. Cross-talk between Ras and Rho signalling
pathways in transformation favours proliferation and increased motility. EMBO J
2001;20:755–66.
24. Liang J, Zubovitz J, Petrocelli T, et al. PKB/Akt phosphorylates p27, impairs
nuclear import of p27 and opposes p27-mediated G1 arrest. Nat Med 2002;8:
1153–60.
46. Roovers K, Assoian RK. Effects of Rho kinase and actin stress fibers on
sustained extracellular signal-regulated kinase activity and activation of G(1)
phase cyclin-dependent kinases. Mol Cell Biol 2003;23:4283–94.
25. Connell-Crowley L, Harper JW, Goodrich DW. Cyclin D1/Cdk4 regulates
retinoblastoma protein-mediated cell cycle arrest by site-specific phosphorylation.
Mol Biol Cell 1997;8:287–301.
47. Roninson IB. Oncogenic functions of tumour suppressor p21(Waf1/Cip1/
Sdi1): association with cell senescence and tumour-promoting activities of stromal fibroblasts. Cancer Lett 2002;179:1–14.
26. Qiu RG, Chen J, McCormick F, Symons M. A role for Rho in Ras transformation. Proc Natl Acad Sci U S A 1995;92:11781–5.
48. Besson A, Hwang HC, Cicero S, et al. Discovery of an oncogenic activity in
p27Kip1 that causes stem cell expansion and a multiple tumor phenotype. Genes
Dev 2007;21:1731–46.
27. Khosravi-Far R, Solski PA, Clark GJ, Kinch MS, Der CJ. Activation of
Rac1, RhoA, and mitogen-activated protein kinases is required for Ras transformation. Mol Cell Biol 1995;15:6443–53.
28. Prendergast GC, Khosravi-Far R, Solski PA, Kurzawa H, Lebowitz PF,
Der CJ. Critical role of Rho in cell transformation by oncogenic Ras. Oncogene 1995;10:2289–96.
29. Liu N, Bi F, Pan Y, et al. Reversal of the malignant phenotype of gastric
cancer cells by inhibition of RhoA expression and activity. Clin Cancer Res
2004;10:6239–47.
30. Liberto M, Cobrinik D, Minden A. Rho regulates p21(CIP1), cyclin D1, and
checkpoint control in mammary epithelial cells. Oncogene 2002;21:1590–9.
31. Danen EH, Sonneveld P, Sonnenberg A, Yamada KM. Dual stimulation of
Ras/mitogen-activated protein kinase and RhoA by cell adhesion to fibronectin
49. Blagosklonny MV. Are p27 and p21 cytoplasmic oncoproteins? Cell Cycle
2002;1:391–3.
50. Komata T, Kanzawa T, Takeuchi H, et al. Antitumour effect of cyclindependent kinase inhibitors (p16(INK4A), p18(INK4C), p19(INK4D), p21
(WAF1/CIP1) and p27(KIP1)) on malignant glioma cells. Br J Cancer
2003;88:1277–80.
51. Morgan DO. Principles of CDK regulation. Nature 1995;374:131–4.
52. Hunter T, Pines J. Cyclins and cancer. II. Cyclin D and CDK inhibitors come
of age. Cell 1994;79:573–82.
53. Viallard JF, Lacombe F, Belloc F, Pellegrin JL, Reiffers J. Molecular mechanisms controlling the cell cycle: fundamental aspects and implications for oncology. Cancer Radiother 2001;5:109–29.
Mol Cancer Res 2009;7(4). April 2009
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.
RhoA Regulates G1-S Progression of Gastric Cancer Cells
by Modulation of Multiple INK4 Family Tumor Suppressors
Siyuan Zhang, Qiulin Tang, Feng Xu, et al.
Mol Cancer Res 2009;7:570-580.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://mcr.aacrjournals.org/content/7/4/570
This article cites 53 articles, 22 of which you can access for free at:
http://mcr.aacrjournals.org/content/7/4/570.full.html#ref-list-1
This article has been cited by 9 HighWire-hosted articles. Access the articles at:
/content/7/4/570.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2009 American Association for Cancer Research.