Download Homozygous Deletions of the p15

From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
RAPID COMMUNICATION
Homozygous Deletions of the p15 (MTS2) and p16 (CDKN2/MTS1) Genes in
Adult T-cell Leukemia
By Yoshihiro Hatta, Toshiyasu Hirama, Carl W. Miller, Yasuaki Yamada, Masao Tomonaga, and H. Phillip Koeffler
Adult T-cell leukemia (ATL) is associated with priorinfection
with human T-cell leukemia virus type I (HTLV-I). Twenty
t o 40 years often elapse from viral infection t o overt ATL,
suggesting that other genetic events must occur t o produce
frank leukemia. The p15 (MTS2) and p16 (CDKNZIMTSl)
genes located on chromosome 9p have been implicated as
candidate tumor-suppressor genes in several types of tumors. We examined for alterations of these genes in ATL
using Southern blot and polymerase chain reaction-singlestrand conformation polymorphism analyses. Both p15 and
p16 genes were homozygously deleted in 4 of 23 acute/
lymphomatous ATL (17%).An additional3 (13%) and 4 (17%)
acute/lymphomatous samples had hemizygous deletions in
a t least one exon of p15 and p16, respectively. One of 14
chronic ATL samples had a homozygously deleted p16 gene
and another had a hemizygous deletion of p16. Neither homozygous nor hemizygous deletions of the p15 gene were
found in chronic ATL. In total, 10 of 37 (27%) ATL samples
had loss of the p15 and/or p16 genes. No point mutations
of the p15 and p16 genes were found. The ATLpatient with
a homozygously deleted p16 in the chronic phase rapidly
progressed t o acute ATL and died within 6 months of the
initial diagnosis. One instructive patient had no detectable
deletion of the p15 and p16 genes during thechronic phase
of ATL but hada homozygous deletions of both genes when
she progressed t o acute ATL. Our results suggest an association of p15/p16 deletions with development of acute ATL.
0 7995 by The American Societyof Hematology.
T
Although we have previously shown an association between
development of a p53 mutation in the HTLV-I-infected T
lymphocytes and the transition from chronic to acute ATL,25
few other details are known concerning the genetic events
leading to ATL.
To determine if the loss of p15 and/or p16 function plays
a role in the occurrence of ATL or in the transition from
chronic to acute ATL, we evaluated 37 ATL samples for
p15 and p16 alterations using Southern blot and polymerase
chain reaction-single-strand conformation polymorphism
(PCR-SSCP) analyses.
HE CELL CYCLE is regulated by cyclin-dependent kinases (CDKs), which are activated by a family of proteins called cyclins. The impaired regulation of the cell cycle
may cause abnormal cell growth and hence cellular transformation.' One of the cyclins, cyclin D l , is overexpressed in
some cancers2 and can behave as an oncogene.334On the
other hand, CDK inhibitors (CDKIs) may act as tumor suppressors, and their inactivation might contribute to development of cancer. The CDKIs bind to either their respective
CDKs or CDK-cyclin complexes and inhibit kinase activity.
Among the known CDKIs, the pl6/CDKN2/MTSl gene
is an inhibitor of CDK4 and CDK65,6;it was recently cloned
and mapped to chromosome 9 ~ 2 1 . ~The
. * p16 gene is deleted
or mutated in about 75% of melanoma cell lines and in
50% of 290 other cancer cell lines from a wide variety
of histologically different types of cancer^.^ Furthermore,
mutations and/or deletions of the p16 gene were identified
in 52% of esophageal squamous cell carcinomas:30%to
70% of non-small-cell lung carcinomas,lO."72% of familial
melanoma kindreds," 79% of xenografts from pancreatic
adenocarcinoma^,'^ and 19%of primary bladder carcinom a ~ .Others
'~
and ourselves have also found that about 75%
of primary T-acute lymphocytic leukemias (T-ALL) and
21% of primary B-ALL in children had homozygous deletions of the p16 gene (Takeuchi, manuscript in press).15 The
p15 (MTS2) gene, which is located within 25 kb of the p16
gene, contains sequences highly homologous to exon 2 of
p16. The CDK4 and CDK6 kinase activities are inhibited
also by ~ 1 5 . ' ~Recently,
*'~
deletions of p15 were reported in
glioblastomas" and leukemias." These investigations suggested that both of these genes might play an important role
in tumorigenesis.
Adult T-cell leukemia (ATL) is initiated by the human Tcell leukemia virus type I (HTLV-I)'9,20and is prevalent in
the Kyushu area (Southwestern Japan) and Caribbean basin.2' However, the incidence of ATL is very low even in
HTLV-I carriers,22and those who develop the disease usually
have a 20- to 40-year latency period from the time of infection to progression to ATL.23,24
Therefore, multiple genetic
changes may be required for development of the disease.
Blood, Vol 85. No 10 (May 15). 1995: pp 2699-2704
MATERIALS AND METHODS
Samples. Thirty-seven samples from 35 patients were examined
in this study. Samples were collected predominantly from Kyushu,
Japan, where ATL is epidemic. They consisted of 23 acute-phase, 14
chronic-phase, and 2 lymphomatous ATL samples. Three sequential
samples in chronic and acute phase from the same patient (patient
no. 19) were included in this study.
Mononuclear cells from patients with ATL were obtained by density gradient separation from the peripheral blood of chronic and
acute ATL patients, lymph nodes from lymphomatous ATL samples,
and pleural effusions from patients with acute and lymphomatous
From the Department of Medicine, Division of Hematology/Oncology, UCLA School of Medicine, Cedars-Sinai ResearchInstitute,
L o s Angeles, CA; and the Department of Hematology, Atomic Disease Institute, Nagasaki University School of Medicine, Nagasaki,
Japan.
Submitted January 30, 1995; accepted March 4, 1995.
Supported in part by National Institutes of Health Grants No.
DK42792, CA42710, and DK41936; by the Parker Hughes Foundation; by Concern Foundation; and by the Louis Sushan Fund.
Address reprint requests to Yoshihiro Hatta,MD,Division
of
Hematology/Oncology, UCLA School of Medicine, Cedars-Sinai Research Institute, 8700 Beverly Blvd, L o s Angeles, CA 90048.
The publication costsof this article were defrayedin part by page
chargepayment. This article must therefore behereby marked
"advertisement" in accordance with I8 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
0006-4971/9.5/8510-0038$3.00/0
2699
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2700
H A n A ET AL
ATL. Most samples had greater than 75% CD4' cells. Bone marrow
DNA from a normal individual was used as a standard for normal
p15 and p16 genes. DNA from the K562 cell line, which has a
homozygous deletion of the p16 gene,* was also used as a negative
control. DNA wasextracted by a standard methodology using phenol
and chloroform extractions."
Southern blot hybridization. Southern blotting was performed
for 37 tumor samples (23 in acutellymphomatous phase and 14 in
chronic phase of ATL). Five micrograms of each DNA was digested
with EcoRI (GIBCO-BRL, Gaithersburg, MD), separated on 0.7%
agarose gels, and transferred to nylon membranes (Hybond-N; Amersham, Amersham, UK). The p15 exon 1 was detected with a 466bp DNA fragment that was prepared by PCR using primers 4BSO
(GGACTCCGCGACGGTCCGCA) and
4BA1
(CCTCCCGAAACGGTTGACTCC). The probe specific for exon 1 of p16 was
obtained byPCR with primer pairs p16-XlS4 (GGAGAGGGGGAGAACAGACAACGG) and pl6-Xl AI (GCGCTACCTGATTCCAATTC; same as 1180R7),which yields a fragment of 270 bp
encompassing the entire coding sequence of exon 1. Exon 2s of p1 5
andp16 were detected simultaneously by probing with a 212-bp
PCR product that was prepared by a pair of oligonucleotides (p162s2 [ACCCTGGCTCTGACCATTCTGITCT] and p16-1AI [GTCCGTAGCGCGTGCAGGTC]) designed to amplify exon 2s of both
p15 and p16. In addition, we used a Kpn I restriction fragment of
p16 cDNA representing the 3"coding portion of p16 exon 2 as a
probe, which is specific for exon 2 of p16 and does not detect the
p15 gene. The p16 cDNA was generously provided by David Beach
(Howard Hughes Medical Institute, New York, NY). All DNA fragments were labeled with [(Y-~*P]~CTP
(ICN, Imine, CA) using a
Radprime kit (GIBCO-BRL). Blots were hybridized with each of
the probes at 68°C overnight and then washed sequentially with
decreasing concentrations of SSC with a final wash of 0.5X SSC at
68°C. The blotswere rehybridized with a probe for the myeloperoxidase gene (MPO)" to assure that equal amounts of DNA were applied to each lane. The intensities of signal were assessed by
Ultrascan XL laser densitometer (PharmaciaLKB, Freiburg, Germany).
PCR-SSCP. All 37 samples were screened for exons I and 2 of
p15 and p16 with PCR-SSCP. The exon 1 of p15 was amplified with
primers 4BS1 (CTGCGCGTCTGGGGGCTGC) and 4BA1, which
yielded a fragment of 150 bp. Primers 4BS2 (CCCGGCCGGCATCTCCCATA) and 4BA2 (CGTTGTGGGCGGCTGGGGAACCT)
were used toobtain a 320-bp fragment of exon 2 of p15. The primers
for exon 1 of p16 were the same as those described above. The
primers for exon 2 of p16 were p16-X2S2 (ACCCTGGCTCTGACCATTCTGTTCT) and p16-X2A2 (GTACAAATTCAGATCATCAGTCC), which yielded a PCR product of 37 I bp. All the primers
were synthesized by the Cedars-Sinai Research Institute Molecular
Biology Core.
Table 1. Deletions of the p15 and p16 Gene in ATL
p15
Disease
Exon Exon Exon Exon
1
Acute/lymphornatous (n = 23)
Homo
Hemi
Chronic (n = 14)
Homo
Hemi
p16
2
1
2
4 (17)
3 (13)
4 (17)
3 (13)
4 (17)
4 (17)
4 (17)
3 (13)
0 (0)
0 (0)
0 (0)
0 (0)
1 (7)
1 (7)
1 (7)
1 (7)
Numbers in parentheses indicate percentages.
Abbreviations: Homo, homozygous deletion; Hemi, hemizygous deletion.
Table 2. Southern Blot Analysis: Samples With Altered p15 and
p16 Genes in ATL
p15
p16
Sample
No.
Disease/
Stage
Exon 1
Exon 2
Exon
1
Exon 2
2
3
6
Acute
Acute
Acute
Acute
Acute
Acute
Acute
Lymphomla
Chronic
Chronic
Hemi
Homo
Hemi
Hemi
Homo
Homo
Intact
Homo
Intact
Intact
Hemi
Homo
Hemi
Hemi
Homo
Homo
Intact
Homo
Intact
Intact
Hemi
Homo
Hemi
Hemi
Homo
Homo
Hemi
Homo
Hemi
Homo
Hemi
Homo
Hemi
Intact
Homo
Homo
Hemi
Homo
Hemi
Homo
a
19A
32
3a
14
15
33
Abbreviations: Hemi, hemizygous deletion; Homo, homozygous deletion.
Each reaction contained 100 ng of sample DNA, 0.7 pmol of each
primer, 5 pmol of each of the four deoxyribonucleotide triphosphates
(Pharmacia, Stockholm, Sweden), 0.5 U of Taq DNA polymerase
(GIBCO-BRL), and 3 pCi of [(u-~*P]~CTP
(ICN) in 20 pL of the
specified buffer. The conditions for exons 1 and 2 of p15 were 30
cycles of 94°C for 30 seconds, 57°C for 30 seconds, and 72°C for
60 seconds. The PCR condition for p16 exon 1 was 35 cycles of
95°C for 45 seconds, 52.5"C for 30 seconds, and 72°Cfor 60 seconds.
The condition for p16 exon 2 was 35 cycles of 95°C for 40 seconds,
55°C for 30 seconds, and 72°C for 35 seconds. The MgClz concentrations were 1.0 mmol/L and 0.75 mmol/L for exons 1 and 2 of p15
and 1.5 mmol/L and 1.25 mmol/L for those of p16, respectively.
The PCR products were denatured and electrophoresed through a
nondenaturing 5% polyacrylamide Mutation Detection Enhancement
(MDE; J.T. Baker Inc, Phillipsburg, NJ) gel at 400 V for 24 hours,
dried, and exposed to Kodak X-OMAT AR film (Kodak, Rochester,
NY) at -80°C.
RESULTS
Tables 1 and 2 summarize the results. UsingSouthern blot
analysis, we examined 23 acute/lymphomatous-phase ATL
samples and 14 chronic-phaseATLsamples. Four of 23
(17%) acute/lymphomatous-phase samples and 1 of 14 (7%)
chronic-phase samples were homozygously deleted in both
exons l and 2 of the p16 gene (Fig 1). ThechronicATL
patient with homozygous p16 deletion progressed to acute
ATL and died within 6 months (sample no. 33). All acute/
lymphomatous-phasesampleswithhomozygouslydeleted
p16 also had homozygous deletions of p15. However, the
chronic-phase ATL sample with homozygous
loss of p16 had
an intact p15 gene. One instructive case had no detectable
deletions of the p15 and p16 genes in the ATL cells during
thechronicphase
of the disease(samplesno.
19C1and
19C2), but, during the acute phase of the disease, the ATL
homozygous deletions of
cells from thesamepatienthad
these genes (sample no. 19A; Fig2). This sample had homozygous deletions of both p15 and p16 genes as determined
by densitometry, because the intensities of signals of these
genes were less than one eighth of those of the control.
Hemizygous deletionof the p16 gene in at least one exon
was foundin 4 of 23 (17%) acute/lymphomatous-phasesam-
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
p15 AND p16 IN ATL
2701
c
L N
5I
%
Fig 1. Southern blot analysis
of the p16 gene in ATL. Genomic
DNAs from ATLsamples from
various patients were digested
with &&I,
electrophoresedon
0.7% agarosegels 15 pgllane),
transferred to nylon membranes,
and hybridized with either M P 0
cDNA (control), p16 exon1,or
exon 2 after 32P-labeling.Lanes 3
and 14 show homozygous deletions of the p16 exons 1 and 2.
Lanes 2,6, 8, and 15 (lower blot)
andlanes2,6,
and 15(upper
blot) show hemizygous deletions ofexons 1 and 2 ofp16,
respectively. The asterisk shows
the cross-hybridizing bandswith
p16 exon 1. Both human normal
bone marrow (HNBM) and K562
cell line (K562). which has a homozygously deleted p16 gene,
servedascontrols.Only
representative samples are shown.
y
1
3 4 S 6
2
7
8
9 19111213 l 4 1 5 l 6 l 7 1 8
- MP0
- p1 6 exon 2
.
. ”
ples and I of 14 (7%) chronic-phase ATL samples. Hemizygous deletions of both p15 exons 1 and 2 were detected in
3 acute-phase ATL samples and in none of the chronic-phase
ATL samples (Tables 1 and 2).
Using a p16 exon I probe. a cross-hybridizing band that
was larger than p16 exon I wasdetected in everysample.
suggesting that another unidentified gene may have homology with exon 1 of p16 (Fig 1 ). A band of similar size on
Southern blots after EcoRI digestion has been also noted by
other investigators.’”
To detect the presence of small deletions or point mutations, we performed PCR-SSCP analysis for pl 5 and p16.
None of the 37 samples had detectable mutations or small
deletions of these genes (data not shown).
DISCUSSION
Theclose associationbetween ATLand HTLV-I virus
has been established. Nevertheless, themechanisms of development of ATL after HTLV-I infection have not been claritied. Although HTLV-I does not haveanoncogene.2x,2‘ it
contains the tux region in addition to the genes common to
all retroviruses:’” The Tax protein encoded from this region
is required for viral replication” and activates the expression
ofseveral cytokines and cytokine receptorsincluding interleukin-2 (IL-2) and the a subunit of IL-2 receptor (IL2Ra).” The Tax-mediated induction of NF-KB protein that
binds to the IL-2Ra promoter may contribute to polyclonal
or oligoclonal expansion of HTLV-l-infected T cells.” In
t a x can transform RAT-l
addition,theoverexpressionof
cells.’‘ These in vitro results strongly implicate the involvement of Tax in the progression toward development of ATL.
However, this does not explain the 20 to 40 years of latency
frominfection todevelopment of ATL. In addition, ATL
-*
- p1 6 exon 1
cells usually do not express tar in vivo.’” Therefore. additional genetic changes are probably required for progression
to ATL.
In thisstudy. we determined for the first time that p15
and p16 genes are altered in ATL. Four of 23 (17%) acute/
lymphomatous ATL samples had homozygous deletions of
both the p15 and p16 genes. Among 14 chronic-phase samples. homozygousdeletions of p16 werefound in I case
(14%). but deletions of p15 were not found. This chronic
ATL patient rapidly progressed to acute ATL and died. suggesting that the sample obtained from thepatient in the
“chronic” phase was in a “pre-acute” phase. Another instructive patient had no deletions of the p15 and p16 genes
in the ATL cells in the chronic phase but had homozygous
deletions of both genes in the acute phase, indicating that the
deletions were acquired during the transition from chronic to
acute ATL.The association of thesegenetic events with
acute but not chronic ATL suggests to us that homozygous
deletions of these genes may be frequently acquired abnormalities during the development of the acute phase of ATL.
We havefound that all samples with homozygousp15
deletions also had homozygous p16 deletions: however, one
sample had a homozygous deletion and two samples had a
hemizygous deletionof p16 with anormalappearingp15
gene. These datasuggest that p 16 rather than p 1 S may be the
deletions
target of thesedeletion.Potentially.hemizygous
of the pIYp16 genes coupled with point mutations of the
undeletedallelecould
also inactivatethesegenes. This is
the frequent mechanism of inactivation of the p53 gene.3f’.37
However, we were unable to detect any point mutations of
the p15 and p16 genes in our samples. Because we did not
analyze the promoter regionand exon 3of p16. which is
only 14 bp.’ we do not know if this part of the gene is altered
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HATTA ET AL
2702
- p16 exon 1
- p1 5 exon 1
- p1 5 exon 2
- p1 6 exon 2
Fig 2. Southern blot analysis of p15 and p16 gene in ATL. Techniques are similar to those described in legend for Fig
l . Lanes labeled
19C1and19C2 are chronic-phasesamples from the same patient
showing intact p15 andp16 genes. Lane 19A.which is a sample from
the same patient during the acute-phase A T 1 shows deletionsof the
p15 and p16 genes. Sample 19A was determined to have homozygous deletions for both the p15 and p16 genes, because the signal
intensities of thesegenes were less than one eighth of thoseof
control, as determined by densitometry. Both lanes 20 and 21 are
ATL samples and have intact p15 and p16 genes.
in ATL. In addition, mutations and genetic rearrangements
in the second intron of p16 could potentially lead to aberrant
splicing and loss of exon 3.L2~'"15~'8
Because our ATL samples were contaminated with normal
cells, we may have underestimated the number of cases with
homozygous and hemizygous deletions. In addition, in another study, the p16 protein was not detected in some cancers
with an intact p16 gene,39suggesting that mechanisms other
than genetic alteration of this gene might inactivate p16.
Thus, the inactivation of p15/p16 might be more frequent
than shown in this study.
Others as well as ourselves have found that p16 deletions
occurred in about 75% of T-ALL and 20% of B-ALL cases
(Takeuchi, manuscript in press)." In contrast, alterations of
p15 and p16 genes in both T- and B-cell lymphomas and
acute and chronic myeloid leukemias are infrequent (<6%;
Gombert and Nakamaki, manuscript submitted):" Among
the common hematopoietic malignancies, the reasonwhy
ALL and ATL have a high incidence of alterations of the
p15 and p16 genes is unclear.
Another CDKI family consists of p21 (also known as
WAF1, MDA-6, CIP1, SDI1, and CAP20) and p27 (also
known as KIP1). The p21 gene had no abnormalities when
over 350 primary tumors from 14 types of malignancies
were studied:' Furthermore, of 305 primary tumors from 11
types of malignancies, we have found only 1 case of ATL
with a p27 mutation (Kawamata and Morosetti, manuscript
in press). Taken together, these findings indirectly suggest
that p15 and p16 proteins have a different function than the
p21 and p27 family of CDKIs.
We have determined that certain point mutations in the
ankyrin repeats of p16 result in a p16 that can no longer
inactivate the CDK4 kinase activity in vitro (Yang, manuscript in preparation); furthermore, several cancers have
these same point mutations such as familial melanoma" and
pancreatic cancers." In contrast, some tumors such as the
hematopoietic malignancies, including T- and B-ALL and
ATL, rarely have p15 and p16 point mutations but, instead,
have deletions of these genes.'s."~40"2Why the method of
inactivation of the ~ 1 5 1 ~ genes
1 6 varies in cancers of different tissue types is unexplained at this time.
We previously reported that p53 mutations occurred in
only 2%of childhood lymphoid malignancies of bothBand T-cell type: whereas the frequency of p53 mutation in
acute ATL was about 40%.25,44.45
Studies in other tissue types
have found that the p16 gene is often mutated or deleted in
cell lines containing wild-type p53 and it is often intact in
cell lines containing mutated p53 genes.I4Furthermore, studies in lung cancer cell lines also showed that these cells
usually have a normal p16 when the Rb gene is inactivated
either by mutation or by a DNA-transforming viral protein.''.39Perhaps a cellular growth advantage leading to ATL
requires inactivation of either the pWp16, p53, or Rb gene.
Further studies are required to determine if this hypothesis
is correct.
Taking these data together, we hypothesize that the development of ATL maybe as follows; tar expression in T
cells infected by HTLV-I induces an LL-2/IL-2R autocrine
stimulatory loop leading to slow polyclonal proliferation of
these cells. At this stage, patients are in a pre-ATL or HTLVI carrier state that can continue over a long period of time,
generally more than 40 years. In some cases, the cells may
lose factor-dependence, proliferate autonomously, become a
clonal disorder, and evolve to chronic ATL. These cells
probably acquire one or several genetic changes such as loss
of p16 with or without loss of p15 and/or mutations of p53,
resulting in acute ATL.
ACKNOWLEDGMENT
We are extremely grateful to Dr David Beach for providing the
p16 cDNA clone. We also thank Adrian F. Gombert, Seisho Takeuchi, Tsuyoshi Nakamaki, and Norihiko Kawamata for helping to
determine the PCR conditions andEmily Y. Pham for excellent
technical assistance.
REFERENCES
1. Hunter T, Pines J: Cyclins and cancer. Cell 66: 1071, 1991
2. Motokura T, Arnold A: Cyclin D and oncogenesis. C u r Opin
Genet Dev 3:5, 1993
3. Hinds PW, Dowdy SF, Eaton EN, Arnold A, Weinberg RA:
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2703
p15 AND p16 IN ATL
Function of a human cyclin gene as an oncogene. Proc Natl Acad
Sci USA 91:709, 1994
Zuckerberg L, Lees E, Arnold A,
4. Wang TC, Cardiff
Schmidt EV: Mammary hyperplasia and carcinoma in MMTV-cyclin
D l transgenic mice. Nature 369:669, 1994
5. Serrano M, Hannon GJ, Beach D: A new regulatory motif in
cell-cycle control causing specific inhibition of cyclin DKDK4. Nature 366:704, 1993
6. Bates S, Bonetta L, MacAllan D, Parry D, Holder A, Dickson
C, Peters G: CDK6 (PLSTIRE) and CDK4 (PSK-J3) are a distinct
subset of the cyclin-dependent kinases that associate with cyclin Dl.
Oncogene 9:71, 1994
7. Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q , Harshman K,
Tavtigian SV, Stockert E, Day RS3, Johnson BE, Skolnick MH: A
cell cycle regulator potentially involved in genesis of many tumor
types. Science 264:436, 1994
8. Nobori T, Miura K,Wu DJ, Lois A, Takabayashi K, Carson
DA: Deletion ofthe cyclin-dependent kinase-4 inhibitor gene in
multiple human cancers. Nature 368:753, 1994
9. Mori T, Miura K, Aoki T, Nishihara T, Mori S, Nakamura Y:
Frequent somatic mutation of the MTSUCDK41 (Multiple tumor
suppressor/cyclin-dependent kinase 4 inhibitor) gene in esophageal
squamous cell carcinoma. Cancer Res 54:3396, 1994
IO. Hayashi N, Sugimoto Y, Tsuchiya E, Ogawa M, Nakamura
Y: Somatic mutations of the MTS (Multiple tumor suppressor) I/
CDK4I (cyclin-dependent kinase-4 inhibitor) gene in human primary
non-small cell lung carcinomas. Biochem Biophys Res Commun
202: 1426, 1994
11. Otterson CA, Kratzke RA, Coxon A, Kim YW, Kaye FJ:
Absence of p16INK4protein is restricted to the subset of lung cancer
lines that retains wildtype RB. Oncogene 9:3375, 1994
12. Hussussian CJ, Struewing JP, Goldstein AM, Higgins PAT,
Ally DS, Sheahan MD, Clark WH Jr. Tucker MA, Dracopoli NC:
Germline p16 mutations in familial melanoma. Nat Genet 8:15, 1994
13. Caldas C, Hahn SA, da Costa LT, Redston MS, Schutte M,
Seymour AB, Weinstein CL, Hruban RH, Yeo CJ, Kern SE: Frequent somatic mutations and homozygous deletions of the p16
(MTSI) gene in pancreatic adenocarcinoma. Nat Genet 8:27, 1994
14. Spruck CH 111, Gonzalez-Zulueta M, Shibata A, Simoneau
AR, Lin M, Gonzales F, Tsai YC, Jones PA: p16 gene in uncultured
tumors. Nature 370:183, 1994
15. Hebert J, Cayuela JM, Berkeley J, Sigaux F: Candidate tumorsuppressor genes MTSl (p161NK4*)and MTS2 (p151NK4')display
frequent homozygous deletions in primary cells from T- butnot
from B-cell lineage acute lymphoblastic leukemias. Blood 84:4038,
1994
16. Hannon GJ, Beach D: ~ 1 5is a' potential
~ ~ effector
~ ~ of TGF&induced cell cycle arrest. Nature 371257, 1994
17. Guan K-L, Jenkins CW, Li Y, Nichols MA, Wu X, O'Keefe
CL, Matera AG, Xiong Y: Growth suppression by p18, a
~ 1 6 ' ~ and
~p14'NK4B/MTSZ-related
~ ~ ~ ~ ' CDK6 inhibitor, correlates
with wild-type pRb function. Genes Dev 82939, 1994
18. Jen J, Harper JW, Bigner SH, Bigner DD, Papadopoulos N,
Markowitz S, Willson JKV, Kinzler KW, Vogelstein B: Deletion of
p16 and p15 genes in brain tumors. Cancer Res 54:6353, 1994
19. Miyoshi I, Kubonishi T, Yoshimoto S, Akagi I, Ohtsuki Y,
Shiraishi Y, Nagata K, Hinuma Y: Type C virus particles in a cord
T-cell line derived by co-cultivation of normal human cord leukocytes and human leukemic T-cells. Nature 294:770, 1981
20. Yoshida M, Miyoshi I, Hinuma Y: Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and
its implication in the disease. Proc Natl Acad Sci USA 79:2031,
1982
21. Levine PH, Cleghorn F, Manns A, Jaffe ES, Navarro-Roman
L, Blattner WA, Hanchard B, De Olivera MS, Matutes E, Catovsky
RD.
D: Adult T-cell leukemiallymphoma: Working point-score classification for epidemiological studies. Int J Cancer 59:491, 1994
22. Yamaguchi K, Takatsuki K:
Adult
T cell leukaemialymphoma. Clin Haematol 6:899, 1993
23. Kondo T, Kono H, Nonaka H, Miyamoto N, Yoshida R,
Bando F, Inoue H, Miyoshi I, Hinuma Y, Hanaoka M: Risk of adult
T-cell leukemiallymphoma in HTLV-1 carriers. Lancet 2159, 1987
24. Tokudome S, Tokunaga 0, Shimamoto Y, Miyamoto Y, Sumida I, Kikuchi M, Takeshita M, Ikeda T, Fujiwara K, Yoshihara
M, Yanagawa T, Nishizumi M: Incidence of adult T-cell leukemid
lymphoma among human T-lymphotropic virustype 1 carriers in
Saga, Japan. Cancer Res 49:226, 1989
25. Sakashita A, Hattori T, Miller CW, Suzushima H, Asou N.
Takatsuki K, Koeffler HP: Mutation of p53 gene in adult T-cell
leukemia. Blood 79:477, 1992
26. Sambrook J, Fritsh E, Maniatis T: Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1989
27. Johnson KR, Nausseef WM, Care A, Wheelock MJ, Shane
S, Hudson S, Koeffler HP, Selsted M, Miller C, Rovera G: Characterization of cDNA clones for human MPO: Predicted amino acid
sequence and evidence for multiple mRNA species. Nucleic Acids
Res 15:2012, 1987
28. Wong-Staal F, Gallo RC: Human T-lymphotropic retroviruses. Nature 317:395, 1985
29. Norley SG, Kurth R: Retroviruses and malignant lymphoma.
Blut 58:221, 1989
30. Seiki M, Hattori S, Hirayama Y, Yoshida M: Human adult
T-cell leukemia virus: Complete nucleotide sequence of the provirus
genome integrated in leukemia cell DNA. Proc Natl Acad Sci USA
80:3618, 1983
31. Sodroski J, Rosen C, Goh WC, Haseltine W: A transcriptional
activator protein encoded by the x-lor region of the human T-cell
leukemia virus. Science 228:1430, 1985
32. Wan0 Y, Feinberg M, Hosking JB, Bogerd H, Greene WC:
Stable expression of the tax gene of type I human T-cell leukemia
virus in human T-cells activates specific cellular genes involved in
growth. Proc Natl Acad Sci USA 85:9733, 1988
33. Lanoix J, Lacoste J, Pepin N, Rice N, Hiscott J: Overproduction of NFKB2 (lyt-lo) and c-Rel; a mechanism for HTLV-I Taxmediated trans-activation via the NF-kB signalling pathway. Oncogene 9:841, 1994
34. Tanaka A, Takahasbi C, Yamaoka S, Nosaka T, Maki M,
Hatanaka M: Oncogenic transformation by the tax gene of human
T-cell leukemia virus type-l in vitro. Proc Natl Acad Sci USA
87:1071, 1990
35. Yip MT, Chen ISY: Modes of transformation by the human
T-cell leukemia viruses. Mol Bio Med 7:33, 1990
36. Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R,
Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T,
Collins FS, Weston A, Modali R, Hanis CC, Vogelstein B: Mutations in p53 gene occur in diverse human tumor types. Nature
342:705, 1989
37. Sugimoto K, Toyoshima H, Sakai R, Miyagawa K, Hagiwara
K, Ishikawa F, Takaku F, Yazaki Y, Hirai H: Frequent mutations
in the p53 gene in human myeloid leukemia cell lines. Blood
79:2378, 1992
38. Cheng JQ, Jhanwar SC, Klein WM, BellDW, Lee W-C,
Altomare DA, Nobori T, Olopade 01, Buckler AJ, Testa JR: p16
alterations and deletion mapping of 9~21-22in malignant mesothelioma. Cancer Res 54:5547, 1994
39. Okamoto A, Demetrick DJ, Splillare EA, Hagiwara K, Hussain SP, Bennett WP, Forrester K, Gerwin B, Serrano M, Beach D,
Harris CC: Mutations and altered expression ofp161NK4in human
cancer. Proc Natl Acad Sci USA 91:11045, 1994
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2704
40. Ogawa S, Hirano N, Sat0 N, Takahashi T, Hangaishi A, Tanaka K, Kurokawa M, Tanaka T, Mitani K,Yazaki Y, HiraiH:
Homozygous loss of the cyclin-dependent kinase 4-inhihitor (p16)
gene in human leukemia. Blood 84:2431, 1994
41. Shiohara M, El-Deiry WS, Wada M, Nakamaki T, Takeuchi
S, Yang R, Chen D, Koeffler HP: Absence of WAF1 mutations in
a variety of human malignancies. Blood 84:3781, 1994
42. Walker DJ, Duan W, Popovic EA, Kaye AH, Tomlinson FH,
Lavin M: Homozygous deletions of the multiple tumor suppressor
gene I in the progression of human astrocytomas. Cancer Res 55:20,
1995
43. Wada M, Bartram CR. Nakamura H, Hachiya M, Chen D,
HATTA ET AL
Borenstein J, Miller CW, Ludwig L, Hansen-Hagge TE, Ludwig W,
Reiter A, Mizoguchi H, Koeffler H P Analysis of p53 mutations in
a large series of lymphoid hematologic malignancies of childhood.
Blood 82:3163, 1993
44. Nagai H, Kinoshita T, Imamura J, Murakami Y, Hayashi K,
Mukai K, Ikeda S, Tobinai K, Saito H, Shimoyama M, Shimotohno
K: Genetic alteration of p53 in some patients with adult T-cell leukemia. Jpn J Cancer Res 82: 1421, 1991
45. Yamato K, Oka T, Hiroi M, Iwahara Y, Sugito S, Tsuchida
N, Miyoshi I: Aberrant expression of the p53 tumor suppressor gene
in adult T-cell leukemia and HTLV-1-infected cells. Jpn J Cancer
Res 84:4, 1993
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1995 85: 2699-2704
Homozygous deletions of the p15 (MTS2) and p16 (CDKN2/MTS1)
genes in adult T-cell leukemia
Y Hatta, T Hirama, CW Miller, Y Yamada, M Tomonaga and HP Koeffler
Updated information and services can be found at:
http://www.bloodjournal.org/content/85/10/2699.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.