Download Chronic renal failure in a mouse model of human adenine

Chronic renal failure in a mouse model
of human adenine phosphoribosyltransferase deficiency
MICHAEL G. STOCKELMAN,1 JOHN N. LORENZ,2 FROST N. SMITH,3 GREGORY P. BOIVIN,3
AMRIK SAHOTA,4 JAY A. TISCHFIELD,4 AND PETER J. STAMBROOK1
Departments of 1Cell Biology, Neurobiology, and Anatomy, 2Molecular and Cellular
Physiology, and 3Pathology and Laboratory Medicine, University of Cincinnati, College
of Medicine, Cincinnati, Ohio 45267; and 4Department of Medical and Molecular
Genetics, Indiana University School of Medicine, Indianapolis, Indiana 46202-5251
chronic kidney failure; purine metabolism; kidney calculi;
allopurinol; sex factors
enine (DHA) via an 8-hydroxyadenine intermediate
(40). Adenine and DHA are excreted in the urine.
However, the very low solubility of DHA can lead to its
precipitation in the tubules of the kidney (8).
APRT deficiency occurs in the human population as
an autosomal recessive trait. The major clinical consequence associated with the defect is development of
DHA nephrolithiasis, characterized by kidney stones,
crystalluria, hematuria, dysuria, and urinary tract
infections (29). The appearance of this condition is
highly variable. APRT-deficient patients may develop
severe renal problems in early childhood or may remain
asymptomatic throughout life (28). Allopurinol, an XDH
inhibitor (9), reduces DHA formation from adenine.
Allopurinol treatment is effective in the control of DHA
lithiasis in APRT-deficient patients (30).
We have used gene targeting in embryonic stem cells
to generate a mouse model of APRT deficiency. In our
first report (12), we described the production of a
germ-line mutation in Aprt via embryonic stem cells.
We reported that mice homozygous for the targeted null
mutation have disturbances of purine composition in
the urine, including the excretion of macroscopic crystals of DHA, exhibit deposition of crystals in the kidney,
and are prone to deterioration in health.
In the present study, we investigated extent of renal
lesion in the mice and functional consequences of renal
pathology resulting from APRT deficiency. We found
that, as in human cases of APRT deficiency, severity of
symptoms varied widely among mice homozygous null
for APRT. We report a sex difference in the severity of
symptoms and show an amelioration of pathology in
mice treated with allopurinol.
METHODS
phosphoribosyltransferase (APRT, EC 2.4.2.7)
is a highly conserved (5) purine salvage enzyme that
catalyzes the conversion of adenine and 5-phosphoribosyl-1-pyrophosphate to AMP. In mammals, APRT is
present in all tissues and provides the only known
mechanism for the metabolic salvage of adenine (29).
Intracellular adenine is produced as a by-product of
polyamine biosynthesis (38); dietary sources high in
purines can also contribute significantly to adenine
levels (17). Normally, adenine is efficiently salvaged by
APRT and is present at very low levels in blood and
urine (12, 29). In mammalian metabolism, when adenine is present in excess, it becomes a significant
substrate for xanthine dehydrogenase (XDH, EC
1.2.3.2), which can oxidize adenine to 2,8-dihydroxyad-
ADENINE
F154
Mice. APRT-deficient mice were produced from an embryonic stem cell line carrying a targeted disruption of the Aprt
locus in one allele (12). The colony used in these experiments
was founded by a cross of 129/Sv chimeras with Black Swiss
breeders, and later generations were bred by sibling matings.
Mice were genotyped at age 2 wk from tail biopsies. To
determine Aprt genotypes, genomic DNA isolated from collected tissue (21) was amplified in a three-primer PCR
reaction, in which the 58 primer (58 CCACAACCTTCCCTCCTT 38) matched sequence within Aprt intron 2 and two
alternative 38 primers matched a portion of the neo transgene
insertion (58 GAGAACCTGCGTGCAATCCATCTTG 38) or the
38-untranslated region of Aprt (58 CCACCAAGCAGTTCCTAGTG 38). DNA from homozygous wild-type mice produced
only a 700-bp PCR product from the two Aprt-specific primers. DNA from homozygous null mice produced only a 300-bp
0363-6127/98 $5.00 Copyright r 1998 the American Physiological Society
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
Stockelman, Michael G., John N. Lorenz, Frost N.
Smith, Gregory P. Boivin, Amrik Sahota, Jay A. Tischfield, and Peter J. Stambrook. Chronic renal failure in a
mouse model of human adenine phosphoribosyltransferase
deficiency. Am. J. Physiol. 275 (Renal Physiol. 44): F154–
F163, 1998.—In humans, adenine phosphoribosyltransferase
(APRT, EC 2.4.2.7) deficiency can manifest as nephrolithiasis,
interstitial nephritis, and chronic renal failure. APRT catalyzes synthesis of AMP from adenine and 5-phosphoribosyl-1pyrophosphate. In the absence of APRT, 2,8-dihydroxyadenine (DHA) is produced from adenine by xanthine
dehydrogenase (XDH) and can precipitate in the renal interstitium, resulting in kidney disease. Treatment with allopurinol controls formation of DHA stones by inhibiting XDH
activity. Kidney disease in APRT-deficient mice resembles
that seen in humans. By age 12 wk, APRT-deficient male mice
are, on average, mildly anemic and smaller than normal
males. They have extensive renal interstitial damage (assessed by image analysis) and elevated blood urea nitrogen
(BUN), and their creatinine clearance rates, which measure
excretion of infused creatinine as an estimate of glomerular
filtration rate (GFR), are about half that of wild-type males.
APRT-deficient males treated with allopurinol in the drinking
water had normal BUN and less extensive visible renal
damage, but creatinine clearance remained low. Throughout
their lifespans, homozygous null female mice manifested
significantly less renal damage than homozygous null males
of the same age. APRT-deficient females showed no significant impairment of GFR at age 12 wk. Consequences of APRT
deficiency in male mice are more pronounced than in females,
possibly due to differences in rates of adenine or DHA
synthesis or to sex-determined responses of the kidneys.
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
Fig. 1. Simultaneous clearance of infused creatinine and FITCinulin in mice. Mice (n 5 7) were infused with both creatinine and
FITC-inulin, and clearance of each was determined at four time
points. Mice were untreated during the first two sampling periods
and were treated with cimetidine during the first two sampling
periods. A: inulin clearance and creatinine clearance. B: ratio of
creatinine clearance (Ccr ) to inulin clearance (Ci ) at each data point.
observed to decrease the secretion of creatinine (26), possibly
improving its performance as a marker for GFR. Figure 1A
shows average Ccr and Ci in the four periods (n 5 7). Figure 1B
shows the ratio of Ccr to Ci in each period. These data
demonstrate that, although Ccr does overestimate GFR somewhat (as expected), the relationship between Ccr and Ci is
quite consistent and supports the validity of Ccr differences as
an accurate reflection of differences in GFR.
Mice in the third to fifth generation of sibling mating from
129/Sv crossed with Black Swiss founders were used in Ccr
measurements. The mice were 12 wk of age, weighed 25–35 g,
had not been bred previously, and were apparently in normal
health. Mice were transported to the physiology laboratory 1
day prior to the procedure and kept overnight, with food and
water ad libitum. On the following day, at ,3 h into the light
cycle, mice were anesthetized with an injection of Inactin
(thiobutabarbital, 100–150 µg/g ip) and, after 15 min, were
placed ventral side up on a heated surgical table, fitted with a
rectal thermometer to monitor and maintain body temperature, and surgically instrumented with a tracheotomy tube
and catheters to the femoral artery, the femoral vein, and the
urinary bladder. Blood losses from surgery were replaced
with 100 µl of donor blood or 6% bovine serum albumin in
saline immediately after the instrumentation was complete.
After surgery, blood pressure and heart rate were monitored
through the arterial line. At the same time, creatinine (5% in
saline) was infused through the femoral vein. Mice were given
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
PCR product from the 58 Aprt-specific primer and the 38 neo
primer. DNA of heterozygous animals produced both PCR
products.
Mice received ad libitum water and Teklad LM-485 mouse/
rat sterilizable diet (Harlan-Teklad, Madison, WI) and were
kept on a 14:10-h light-dark cycle in microisolator cages. In
allopurinol experiments, ad libitum water contained 62 µg/ml
allopurinol (Sigma Chemical, St. Louis, MO). The rate of
water consumption by the mice was not affected by the
presence of allopurinol. Water bottles were weighed at the
time of filling, and the rate of water consumption per cage and
the number of mice in each cage were used to estimate
allopurinol dosage. Adult mice drank in the range of 10 ml
water/day, resulting in a dose of ,25 mg · kg body wt21 · day21
for a typical 25-g mouse. Mating pairs were started on this
regimen at weaning. Offspring raised from birth on allopurinol were examined for changes in kidney structure and
function in comparison with normal and untreated APRTdeficient mice.
Histology and measurement of renal pathology. All specimens were fixed in neutral-buffered Formalin and processed
through a gradient of alcohols for paraffin embedding. Fourmicrometer sections, at intervals of 250 to 500 µm through
the kidney, were stained with hematoxylin and eosin (20).
Samples were viewed in bright-field or polarized light with an
Olympus BH2 microscope (Olympus, New Hyde Park, NY).
Kidneys were evaluated using general histological criteria for
renal damage. Lesions were limited to tubular changes
(tubular dilation, tubular degeneration, tubular necrosis, and
loss of tubules) with secondary interstitial changes (fibrous
tissue infiltration and lymphocyte and plasma cell infiltration).
Images of kidney cross sections were captured, using a
Sony video camera and video printer (Sony, Tokyo, Japan)
and a Scion Frame Grabber (Scion, Frederick, MD), then
imported to the public domain software NIH Image (developed at National Institutes of Health, Bethesda, MD; http://
rsb.info.nih.gov/nih-image) on a Macintosh Quadra computer
(Apple Computers, Cupertino, CA). Lesioned areas in kidney
sections were visually identified and outlined on screen, and
their area in pixels were determined by NIH Image. Histological lesions quantified included areas of crystal deposition,
inflammation, tubule loss with replacement fibrosis, tubule
dilation, and tubule damage with regeneration of tubular
epthelium. The total area of the kidney cross section in the
image was outlined on the basis of its relative darkness in the
image (density slicing), and its area in pixels was determined
by NIH Image.
Protocol for determination of creatinine clearance. Because
of technical limitations at the time of these experiments
prevented the use of inulin, the clearance of infused creatinine was used to estimate glomerular filtration rate (GFR). To
minimize the effect of creatinine secretion on the measured
clearance by saturating the secretion mechanism, we infused
very large amounts of creatinine. To validate this approach,
we later compared the clearance of creatinine (Ccr ) to the
simultaneous clearance of fluorescein-labeled inulin (FITCinulin) (Ci ). (A microassay of FITC-inulin requiring 3 µl
plasma had not yet been standardized in the laboratory for
the experiments reported here but became available later.)
The results of these comparison studies are shown in Fig. 1.
Animals were prepared as described below, except that an
infusion containing both creatinine and FITC-inulin was
maintained. Inulin and creatinine were determined in parallel during four consecutive periods. The first two periods were
control periods. During the second two periods, cimetidine
was infused. Under some circumstances, cimetidine has been
F155
F156
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
RESULTS
Structural damage in the kidneys of APRT-deficient
mice. The kidneys of APRT-deficient mice exhibit DHA
deposition and consequent pathological changes (12).
Figure 2 shows representative sections of kidney from
wild-type and homozygous null mice, as well as from
allopurinol-treated homozygous null males. A brightfield image from the kidney of a homozygous null male
(Fig. 2A) illustrates the extensive renal interstitial
pathology resulting from APRT deficiency, whereas the
same field viewed in polarized light (Fig. 2B) reveals
the deposition of crystals in the renal interstitium.
APRT-positive animals have no apparent kidney damage (Fig. 2C) and no crystals visible in polarized light
(not shown). Untreated homozygous null males were
more severely affected than homozygous null females,
based on the extent of renal tubular damage seen in
kidney sections (see Tables 1 and 2; Fig. 2D). Because
kidney damage is expected to progress over time in
affected mice, the extent of renal lesions in histological
samples from mice of various ages was determined. The
incidence of kidney damage in homozygous null mice
compared with normal animals of wild-type or heterozygous genotypes is shown in Table 1. As early as 4 wk of
age, 50% of homozygous null male mice excreted crystals in their urine (data not shown) and had tubular
damage with dilation, fibrosis, tubular necrosis, and
lymphoplasmacytic infiltration. Of homozygous null
males ages 12 wk or greater, 85% had renal tubular
damage visible in histological preparations. Representative lesions are shown in Fig. 3. Lymphocyte infiltration (Fig. 3A) was associated with diffuse crystal deposition (Fig. 3B). Other lesions in the kidney included
fibrosis (Fig. 3C), dilation of tubules (Fig. 3D), and
atrophy and collapse of tubules (Fig. 3E). Homozygous
null female mice had a much lower incidence of kidney
pathology, a pattern that appeared to hold true throughout the animals’ lives. Crystals were also occasionally
observed in other tissues, including muscle and testes,
of homozygous null males ages 20–40 wk (Fig. 4),
whereas similar deposits were not detected in mice
with APRT activity.
The extent of renal damage and crystal deposition
observed in cross sections from kidneys of 12-wk-old
animals is quantified in Table 2. Although there was no
significant difference in the number of sites of crystal
deposition observed in sections from null males and
females, the extent of damage was considerably greater
in sections examined from the APRT-deficient males
than their female counterparts. No crystal deposition
or other pathology were observed in kidney sections
from wild-type or heterozygous animals.
Renal histopathology of allopurinol-treated homozygous null males. Microscopic analysis of the kidneys of
12-wk-old allopurinol-treated, APRT-deficient males
suggested that allopurinol decreased the severity of
kidney pathology compared with untreated null males.
Tubule pathology was observed in four of five kidney
sections from treated null males that were examined
(Table 1; Fig. 2E). However, the area of involvement in
those sections was significantly less than that observed
in comparable sections from untreated APRT-deficient
males (Table 2). Similarly, the formation of crystals was
reduced in allopurinol-treated null males. Crystals
were observed in a lower proportion of sections from
allopurinol-treated homozygous null males (2 of 5) than
sections from untreated homozygous null males (6 of 7),
and the number of sites of crystal deposit per section
examined was significantly lower (Table 2). Because
consequences of APRT deficiency were mild in un-
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
a priming dose of 1.3 µl/g body wt, then continuously infused
throughout the procedure at a rate of 0.1 µl·g body wt21 ·min21,
using a model 200 pump from KD Scientific (Boston, MA) and
a 1-ml syringe (Becton-Dickinson, Franklin Lakes, NJ).
Ccr was measured in four 30-min sampling periods beginning 30 min after surgery. The first two sampling periods
established the baseline for the animal, followed by treatment (volume expansion) and two periods of experimental
measurement. Volume expansion consisted of increasing the
maintenance infusion from 0.1 to 1.0 µl · g body wt21 · min21,
with the appropriate decrease in creatinine concentration to
keep the rate of creatinine infusion constant. A 30-min
stabilization time was allowed following the switch to the
volume challenge, during which the urine flow rate typically
increased markedly. During each sampling period, urine was
quantitatively collected, and, at the midpoint of the sampling
period, a blood sample of 60 µl was collected into an NH4heparin hematocrit capillary (Fisher Scientific, Pittsburgh,
PA) from the arterial line. Blood volume was restored after
each sampling by infusion of donor mouse blood. The volume
of the urine sample was determined by weight, and the urine
was stored at 4°C in a polyethylene microcentrifuge tube.
Blood was fractionated in a hematocrit centrifuge for determining the blood cell fraction, then the plasma was collected
into a polyethylene microcentrifuge tube. Urine and plasma
samples were overlaid with mineral oil and assayed within a
week for creatinine. After two baseline measurements and
two volume expansion measurements were obtained, the
experiment was terminated by infusion of concentrated potassium chloride. The kidneys were removed, individually
weighed, and fixed in 10% neutral-buffered Formalin.
Biochemical determinations. Urine and plasma samples
were assayed for creatinine, using a spectrophotometric
assay modified from Folin and Wu (13). For the assay, urine
was diluted 1:50 in water. Three microliters plasma or diluted
urine and 300 µl picric acid reagent (consisting of saturated
aqueous picric acid diluted 5-fold in 0.25 M NaOH) were
dispensed in duplicate, using a MicroLab dilutor (Hamilton,
Reno, NV) into wells of a microtiter plate. After incubation for
15 min at room temperature, absorbance was read at 515 nm
in a microplate reader. Ccr in milliliters of plasma per minute
was calculated by Ccr 5 (Cu/Cp ) 3 V, where Cu is the
concentration of creatinine in urine, Cp is the concentration of
creatinine in plasma at the midpoint of urine collection, and V
is the urine flow rate in milliliters per minute.
Measurement of blood urea nitrogen (BUN) was used as an
alternative assay of kidney function. This assay measures
plasma levels of the nitrogenous waste product urea, which
accumulates in blood with the development of kidney failure.
Blood samples for BUN determination were collected in
sodium heparin capillaries from the orbital sinus. BUN
values were measured spectrophotometrically in an enzymebased assay (Sigma Chemical).
Statistics. Because of the differences in standard deviations among the groups for some variables, statistical results
were evaluated by analysis of variance.
F157
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
treated APRT-deficient females, the effects of allopurinol treatment on APRT-deficient females were not
studied.
Creatinine clearance rates and kidney function in
APRT-deficient mice. By 12 wk of age, homozygous null
male mice but not female mice differed significantly
from normal counterparts. As shown in Table 3, APRTdeficient male mice had smaller average body sizes and
kidney weights than normal males and had lower
hematocrits. Body weights, kidney weights, and hematocrits of allopurinol-treated, APRT-deficient males were
intermediate between those of normal males and untreated homozygous null males, although the differences from either group were not statistically significant. Ccr in 12-wk-old homozygous null males was
significantly lower than Ccr rates in control animals
Table 1. Occurrence of histologically observable lesions in kidneys of APRT-deficient mice at various ages
Fraction of Mice With Lesions
Group
Male, 2/2
Male, 1/1, 1/2
Allopurinol male, 2/2
Female, 2/2
Female, 1/1, 1/2
Age, wk
n
Dilation
Degeneration
Regeneration
Fibrosis
Inflammation
Any Lesion
12
15–20
30–40
12
15–20
30–40
12
12
15–20
30–40
12
15–20
30–40
10
9
7
7
5
5
5
11
10
6
10
6
6
0.70
0.78
0.86
0
0
0
0.40
0.45
0.30
0.33
0
0
0.17
0.70
0.89
0.86
0
0
0
0.60
0.64
0.70
0.17
0
0
0
0.50
0.78
0.86
0
0
0
0.40
0.18
0.20
0.17
0
0
0
0.60
0.89
0.86
0
0
0
0.60
0.64
0.70
0.17
0
0
0
0.50
0.89
0.86
0
0
0
0.60
0.64
0.40
0.33
0
0
0
0.80
0.89
0.86
0
0
0
0.80
0.64
0.70
0.50
0
0
0.17
Three longitudinal sections from left kidney and three cross sections from right kidney of each mouse (at intervals of 250 µm) were examined
for the lesions indicated. Results are the fraction of mice with observable lesions in any section. APRT, adenine phosphoribosyltransferase.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
Fig. 2. Hematoxylin and eosin stain of renal cortex from adenine phosphoribosyltransferase (APRT)-deficient and
normal mice. A: APRT-deficient male mouse, age 10 wk. Fibrosis, inflammation, and tubular dilation are evident in
bright-field view. B: same field of view as A; illumination with polarized light emphasizes deposition of crystals in
tubules and interstitium. C: wild-type male mouse, age 13 wk. No lesions are visible. D: APRT-deficient female
mouse, age 14 wk. Single interstitial crystal is seen (arrow). E: APRT-deficient male mouse, age 12 wk, treated with
allopurinol. * Large dilated tubule containing several crystals. Magnification, 350.
F158
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
Table 2. Morphometric analysis of lesions
in the kidneys of 12-wk-old transgenic mice
Group
Area of
Involvement
n
Crystal Sites/
Kidney Section
n
Male, 2/2
Male, 1/1
Allopurinol male, 2/2
Female, 2/2
Female, 1/1
18.8 6 7.9
0
4.4 6 2.7
1.6 6 0.5*
0
7
6
5
6
9
7.7 6 2.7
0
261
9.8 6 5.3
0
6
5
2
4
4
(51% of values in wild-type males), and continuous
treatment with allopurinol resulted in only marginally
improved Ccr in homozygous null males, as shown in
Fig. 5.
The kidneys’ capacity to regulate urine output was
tested by increasing the flow of creatinine infusion.
This volume expansion did not significantly alter Ccr in
Fig. 3. Pathology of 2,8-dihydroxyadenine (DHA) nephropathy in APRT-deficient mice. A: lymphocytic infiltration
into renal interstitium, in association with diffuse crystal deposition; 10-wk-old null male; magnification, 3200. B:
same field as in A, viewed in polarized light. C: fibrosis of renal parenchyma; 10-wk-old null male; magnification,
3200. D: dilation of tubules and formation of casts in tubular lumina; 12-wk-old null male; magnification, 3100. E:
condensation of renal cortex. Loss of tubules leads to high density of glomeruli in affected region; 20-wk-old null
male; magnification, 3100.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
Values are means 6 SE. Digital micrographs of cross sections of
kidneys (3 sections/mouse at 250-µm intervals) were analyzed.
Lesions including tubular dilation, fibrosis, necrosis, and regeneration were traced by hand. Results are lesion area as percent of total
cross-sectional area, as calculated using NIH Image software. Number of sites of crystal deposition visible in polarized light were counted.
Some samples from APRT-deficient mice had no crystals visible. Only
sections with crystals were measured here. * Three other samples
examined from homozygous null females had no lesions in the
sections observed. Only sections with lesions were measured here.
any group (Fig. 5). We did not specifically measure
urine concentrating ability, but observations from the
volume expansion suggested that homozygous null
males may have a poor capacity to conserve water.
When mice were receiving the high-volume infusion,
the urine flow rates were not significantly different
(14.9 6 6.2 µl/min in homozygous null males vs. 13.0 6
8.6 µl/min in wild-type males), but when receiving the
low rate of infusion, the homozygous null males had a
significantly higher flow rate (7.5 6 1.9 µl/min vs. 3.6 6
2.2 µl/min in wild-type males). Homozygous null males
also tended to have higher rates of urine excretion and
water consumption rates, which is consistent with the
hypothesis that the affected mice have impaired ability
to concentrate urine.
BUN levels in normal, homozygous null, and allopurinol-treated homozygous null animals are shown in
Fig. 6. Consistent with histology and Ccr data, the only
group that was significantly affected was the homozygous null males, in which BUN levels, although highly
variable, were two to three times higher than in normal
animals of the same age. In older homozygous null
males, ages 30–50 wk, there is an apparent improvement in BUN values, compared with homozygous null
males ages 10–20 wk. This may be due to early death of
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
F159
severely affected mice and greater survival to advanced
age of mildly affected individuals, with few severely
affected mice surviving as long as 30 wk. The data are
consistent with this hypothesis. In the younger homozygous null male group, 50% of the mice examined had
BUN values .100 mg/dl, whereas, in the older homozygous null male group, one individual, which had severely damaged kidneys and was sick at the time of
sample collection, had a BUN of 265 mg/dl, whereas the
remaining samples all had values of 65 mg/dl or less.
Table 3. Characteristics of 12-wk-old mice used
in measurement of creatinine clearance
Group
Male, 1/1
Male, 1/2
Male, 2/2
Allopurinol
male, 2/2
Female, 1/1
Female, 1/2
Female, 2/2
n
Body
Wt, g
Kidney
Wt, mg
Relative
Kidney Wt,
% body wt
Hematocrit
5 30.4 6 7.37 428.8 6 82.6 1.4 6 0.06 46.4 6 2.3
7 31.6 6 3.61 511.7 6 62.4 1.6 6 0.08 49.0 6 3.6
7 24.9 6 1.77† 306.5 6 49.4* 1.2 6 0.06* 40.4 6 3.9*
4
5
7
6
26.3 6 2.87
25.0 6 1.41
23.4 6 1.40
23.3 6 4.37
346.5 6 33.9†
409.0 6 24.3
382.3 6 35.0
327.9 6 89.0
1.3 6 0.04†
1.6 6 0.06
1.6 6 0.07
1.4 6 0.08
41.5 6 5.7†
47.8 6 3.0
49.9 6 3.6
48.3 6 1.9
Values are means 6 SE. * P , 0.05 by ANOVA: statistically
significant difference vs. male 1/1, 1/2; † statistically significant
difference vs. male 1/2.
Fig. 5. Creatinine clearance in APRT-deficient and normal mice.
Creatinine clearance was measured in anesthetized, surgically instrumented 12-wk-old mice (see Table 3) receiving infused creatinine (5%
creatinine in saline, 0.1 µl · g body wt21 · min21 ). Untreated males and
females of all genotypes were tested, as were homozygous null males
that had been raised on drinking water containing 62 µg/ml allopurinol (M 2/2, allopurinol). Solid bars, female groups according to
genotype; open bars, male groups according to genotype and treatment. Hatched bars, results from volume expansion experiments on
each group. Sample sizes are indicated in Table 3. Results are means 6
SE, expressed in ml plasma cleared · min21 · g body wt21. * P , 0.05,
statistically significant difference vs. heterozygous or wild-type males.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
Fig. 4. Crystal deposits in nonrenal tissue of APRT-deficient mice. Examination under polarized light of tissues
from APRT-deficient mice occasionally revealed isolated crystals (identified by arrows) resembling urinary crystals
previously identified as DHA (12). A and B: skeletal muscle (magnification, 3400). C and D: testis (magnification,
3200). Sections from a 20-wk-old homozygous null male, viewed under polarized (A and C) and bright-field (B and
D) optics.
F160
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
Allopurinol-treated null males did not have elevated
BUN levels compared with normal males at 12 wk.
Allopurinol treatment apparently helped preserve kidney function in this respect. This is consistent with the
significant decrease in renal histological lesions seen in
allopurinol-treated homozygous null males compared
with untreated null males.
DISCUSSION
In this and a previous report (12), we describe some
phenotypic characteristics of transgenic mice that lack
functional APRT. The absence of APRT activity in mice
homozygous for an Aprt null allele results in a phenotype much like that seen in APRT-deficient humans
(29). Specifically, the mice have high levels of urinary
adenine and adenine metabolites, including DHA, and
they develop pathological changes in the kidney following the formation of stones in the lumina of renal
tubules and in the renal interstitium (12).
The current study was intended to establish the
extent of renal pathology and some of the functional
consequences of kidney damage suffered by the APRTdeficient mice. Creatinine clearance in wild-type, heterozygous, and homozygous null mice was measured and
related to the extent of kidney damage in normal and
mutant mice. The efficacy of allopurinol in controlling
the renal pathology associated with APRT deficiency
was evaluated. The ability of a simple noninvasive
assay (BUN determination) to measure kidney function
in this system was also assessed.
Mice were markedly affected by APRT deficiency. The
consequences of APRT deficiency manifested as kidney
lesions typical of chronic interstitial nephritis (7) and
were apparent in homozygous null mice at all ages
examined (Table 1 and Figs. 2 and 3). Female APRTdeficient mice were much less severely affected than
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
Fig. 6. Blood urea nitrogen (BUN) in APRT-deficient and normal
mice. BUN was measured in plasma samples from mice at ages
10–20 and 30–50 wk. Hatched bars, normal males (Aprt 1/1 and
1/2). Latticed bars, homozygous null males. Light shaded bars,
allopurinol-treated null males. Darkly shaded bars, normal females
(Aprt 1/1 and 1/2). Solid bars, homozygous null females. Open bars,
allopurinol-treated null females. Results are means of BUN (mg/dl) 6
SE; sample sizes indicated at bottom. * P , 0.05, statistically
significant difference compared with other groups by ANOVA.
males. Consistent with the kidney histopathology was
physiological impairment of renal function. Twelveweek-old homozygous null males had an average GFR
about half that of normal animals (Fig. 5). At 12 wk of
age, the homozygous null males suffered moderate
chronic renal failure (1), manifesting as low GFR,
depressed hematocrit, azotemia (indicated by elevated
BUN values, Fig. 6), and possible reduced urine concentrating ability. The severity of the phenotype in homozygous null males was highly variable, with creatinine
clearance values ranging from 10 to 90% of normal.
Homozygous null females may also have had a slight
trend toward lower creatinine clearance, compared
with heterozygous and wild-type females, although this
difference was not statistically significant.
The results from BUN measurement were similar to
the creatinine clearance results (Figs. 5 and 6). Compared with creatinine clearance, however, BUN has the
advantage of being relatively noninvasive; animals
may be sampled regularly without impairing health.
Thus this assay will allow sequential determinations of
the progression of renal disease as a function of time in
this model system and may prove especially useful for
genetic mapping of modifier loci, which determine the
severity of renal pathology in APRT-deficient mice.
A striking observation is the sex difference in the
severity of kidney damage and dysfunction in homozygous null mice (Tables 1 and 2 and Fig. 5). Homozygous
null female mice had comparatively mild symptoms of
tubule pathology. Their GFRs were not significantly
lower than normal. Histologically, less than 2% of
kidney cross-sectional area was affected in 12-wk-old
females, and, even at 30–40 wk, only three of six
animals had notable kidney damage in sections examined. In contrast, homozygous null male mice developed more severe renal lesions at a much earlier age. At
12 wk of age, null males had a significant reduction in
GFR, and 80% of kidneys examined had visible lesions,
affecting on average 18.8% of kidney cross-sectional
area.
The sex-related differences in the severity of the
phenotype may simply reflect an increased susceptibility of males to a range of renal pathology, a pattern seen
both in humans and in many model systems. This issue
is reviewed extensively by Silbiger and Neugarten (27).
They suggest that intrinsic sex-based differences in
kidney structure and function, as well as blood pressure or hormonal environment, may account for the
higher frequency and greater severity of kidney dysfunctions seen in males. Similarly, renal stone disease in
humans occurs in males at four times the frequency
seen in females (summarized in Ref. 34). However, this
observation cannot be generalized to all types of renal
stone disease. For example, 75% of calcium oxalate
stones, which account for 50–80% of all cases of nephrolithiasis, occur in males. In contrast, two-thirds of
magnesium ammonium phosphate stones are in females (15, 34), whereas uric acid stones are equally
distributed among females and males (34). The factors
determining sex-based differences in susceptibility to
kidney stones are probably individual to each stone
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
Allopurinol treatment appeared to provide partial
protection from the nephrotoxic consequences of APRT
deficiency. Allopurinol, an inhibitor of XDH (11), was
added to drinking water at 62 µg/ml H2O to inhibit
production of DHA, with the intent of lessening the
severity of renal disease in APRT-deficient mice. Based
on water consumption, the mice received ,25 mg · kg
body wt21 · day21; the presence of allopurinol in the
drinking water did not appear to inhibit water consumption by the mice. Allopurinol is used routinely to control
DHA nephrotoxicity in APRT-deficient patients (28), as
well as to manage gout and hyperuricemia in humans
with excessive production of uric acid (14). Allopurinol
has also been shown to inhibit XDH activity in mice.
Early studies in mice found that single oral doses of
12.5–25 mg/kg body wt effectively suppressed the
catabolism of oxypurines by XDH (10). Continuous
administration of allopurinol in drinking water has
been shown to be effective in controlling hyperuricemia
and urate nephropathy in uricase-deficient mice (39).
Effective doses, in terms of increased survival of neonates and decrease in serum uric acid, ranged from 45
to 150 µg/ml. In the present study, 12-wk-old male mice
treated with a similar dose of allopurinol exhibited a
significant decrease in lesioned area in the kidney
(4.4% of cross-sectional area vs. 18.8% in untreated
homozygous null male mice; see Table 2) and an
apparent decrease in the number of sites of crystal
deposition in the kidneys of treated animals. However,
the majority of the sections examined contained at least
one lesion. The lesions included tubule dilation, fibrosis, and one group of large crystals (Fig. 2E). The
allopurinol-treated males had GFR values that were
intermediate between those of wild-type and homozygous null males (Fig. 5) and had normal BUN values
(Fig. 6). Because visible lesions were not completely
prevented and creatinine clearance may be impaired in
allopurinol-treated APRT-deficient male mice, it may
be that XDH activity was not sufficiently inhibited at
the administered allopurinol dose to prevent formation
of DHA.
Alternatively, allopurinol may have had beneficial
effects in control of DHA nephrotoxicity, as reflected in
normal BUN values and less extensive structural damage and crystal deposition, while exerting its own
deleterious effect on creatinine clearance. In normal
rats, allopurinol treatment (400 µg/ml H2O) for 15 wk
resulted in minor kidney lesions and a 30% lower GFR
compared with untreated rats (33). However, 400 µg
allopurinol/ml H2O in drinking water is probably a
toxic dose. In our own observations (unpublished), mice
continuously receiving 310 µg/ml H2O allopurinol in
drinking water sometimes developed bladder stones
composed of xanthine and oxipurinol (a poorly soluble
metabolite of allopurinol). Another study (36) gave
daily subcutaneous injections of allopurinol at ,12.5–
100 mg/kg body wt to healthy male rats; at 25
mg · kg21 · day21, 74–100% of animals had slight kidney
lesions after 10 days. The mechanism for allopurinolinduced nephrotoxicity is not known. There is evidence
to suggest that oxidative damage may be involved, a
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
type. APRT deficiency in humans can result in severe
pathology in both males and females. Sixty percent of
symptomatic APRT-deficient humans are males; however, the significance of this observation has not been
statistically validated.
In the case of APRT deficiency, the more serious
pathology observed in males may be a result of males
producing more DHA than females. The kidney has a
threshold tolerance to DHA. In adenine toxicity studies, intravenous administration of adenine at doses of
,10 mg/kg resulted in elevation of excreted adenine
and adenine metabolites, including DHA and 8-hydroxyadenine. Doses that exceeded the capacity to metabolize or excrete the administered adenine resulted in the
deposition of progressively more DHA, first in the distal
tubules and then the proximal tubules and the kidney
interstitium. Very high doses led to acute renal failure
and death. After subacute doses, subjects recovered
with minimal permanent damage (3, 4, 6, 23).
It is possible that more adenine is generated in males
than in females. In mammals, the major source of free
adenine is polyamine biosynthesis, of which adenine is
a by-product (29). The 58-methylthioadenosine that is
generated in the synthesis of the polyamines spermidine and spermine is rapidly cleaved to produce molar
equivalents of adenine and 5-methylthioribose. There
is a suggestion that males produce more polyamines in
both their urogenital tissues and some other organs. In
the male, the prostate gland produces a high level of
polyamines (32, 37). The kidney of the male mouse also
contains higher levels of polyamines than that of the
female; this difference is testosterone dependent (16).
The liver, on the other hand, is a major polyamineproducing organ, which, in the rat, shows no sex
differences (24, 25). If male mice produce more polyamines and consequently more adenine, this could
predispose male APRT-deficient mice to more severe
renal disease.
Because DHA is produced by the oxidation of adenine
by XDH, higher XDH activities in males would also
predispose them to disease. Although there is evidence
that XDH activity, found at high levels in the liver (35)
and in the small intestine in mice (22), may be higher in
males than in females, studies of XDH activity in mice
have produced contradictory findings. In one case, XDH
was 25% higher in the livers of males and 12.5% higher
in male small intestine (22). Another study (19) showed
no significant difference between males and females.
The variations in reported XDH activity in mice may be
due to differences in genetic background (18). This
might also account for the variations in the severity of
symptoms that we see in our mice, since they are of
mixed genetic background (129/Sv and Black Swiss). If
males do have higher XDH activity than females, a
higher proportion of adenine would be converted to
DHA, resulting in more extensive deposition and a
greater burden on the kidney. As noted, in humans,
60% of reported clinical cases of symptomatic APRT
deficiency occur in males (29). It is not clear whether
similar mechanisms account for the sex difference in
mice and humans.
F161
F162
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
We thank David Hellard of the Molecular Physiology Core Facility
at the University of Cincinnati for expert technical assistance.
This work was supported by National Institute of Diabetes and
Digestive and Kidney Diseases Grant DK-38185 and by National
Institute of Environmental Health Sciences Grants ES-05652 and
ES-06096.
Address for reprint requests: P. J. Stambrook, Dept. of Cell
Biology, Neurobiology, and Anatomy, Univ. of Cincinnati College of
Medicine, Cincinnati, OH 45267-0521.
Received 25 August 1997; accepted in final form 27 February 1998.
REFERENCES
1. Abuelo, J. G. Renal Pathophysiology: The Essentials (1st ed.).
Baltimore, MD: Williams and Wilkins, 1989, p. 322.
2. Ansari, N. H., and S. Rajaraman. Allopurinol-induced nephrotoxicity: protection by the antioxidant, butylated hydroxytoluene. Res. Commun. Chem. Pathol. Pharmacol. 75: 221–229,
1992.
3. Bartlett, G. R. Metabolism by man of intravenously administered adenine. Transfusion 17: 367–373, 1977.
4. Bartlett, G. R. Metabolism by the rabbit of intravenously
administered adenine. Transfusion 17: 351–357, 1977.
5. Broderick, T. P., D. A. Schaff, A. M. Bertino, M. K. Dush,
J. A. Tischfield, and P. J. Stambrook. Comparative anatomy
of the human APRT gene and enzyme: nucleotide sequence
divergence and conservation of a nonrandom CpG dinucleotide
arrangement. Proc. Natl. Acad. Sci. USA 84: 3349–3353, 1987.
6. Cameron, J. S., H. A. Simmonds, A. Cadenhead, and D.
Farebrother. Metabolism of intravenous adenine in the pig.
Adv. Exp. Med. Biol. 76A: 196–205, 1977.
7. Cotran, R. S., V. Kumar, and S. L. Robbins. Robbins’ Pathological Basis of Disease. Philadelphia, PA: Saunders, 1989.
8. De Vries, A., and O. Sperling. Implications of disorders of
purine metabolism for the kidney and the urinary tract. Ciba
Found. Symp. 48: 179–206, 1977.
9. Elion, G. B. Enzymatic and metabolic studies with allopurinol.
Ann. Rheum. Dis. 25: 608–614, 1966.
10. Elion, G. B., F. M. Benezra, I. Canellas, L. O. Carrington,
and G. H. Hitchings. Effects of xanthine oxidase inhibitors on
purine catabolism. Israel J. Chem. 6: 787–796, 1968.
11. Elion, G. B., A. Kovensky, and G. H. Hitchings. Metabolic
studies of allopurinol, an inhibitor of xanthine oxidase. Biochem.
Pharmacol. 15: 863–880, 1966.
12. Engle, S. J., M. G. Stockelman, J. Chen, G. Boivin, M.-N.
Yum, P. M. Davies, M. Y. Ying, A. Sahota, H. A. Simmonds,
P. J. Stambrook, and J. A. Tischfield. Adenine phosphoribosyltransferase-deficient mice develop 2,8-dihydroxyadenine nephrolithiasis. Proc. Natl. Acad. Sci. USA 93: 5307–5312, 1996.
13. Folin, O., and H. Wu. A system of blood analysis. J. Biol. Chem.
38: 81–110, 1919.
14. Frayha, R. A. Allopurinol. A review. Lebanese Med. J. 24:
463–71, 1971.
15. Gault, M. H., L. Chafe, P. Parfrey, and W. G. Robertson. The
kidney-ureter stone sexual paradox: a possible explanation. J.
Urol. 141: 1104–1106, 1989.
16. Goldstone, A., H. Koenig, and C. Lu. Testosterone-dependent
sexual dimorphism of the mouse kidney is mediated by polyamines. Biochem. Biophys. Res. Commun. 104: 165–172, 1982.
17. Greenwood, M. C., M. J. Dillon, H. A. Simmonds, T. M.
Barratt, J. R. Pincott, and C. Metreweli. Renal failure due to
2,8-dihydroxyadenine urolithiasis. Eur. J. Pediatr. 138: 346–349,
1982.
18. Henderson, J. F., G. Zombor, M. M. Johnson, and C. M.
Smith. Variation in erythrocyte purine metabolism among mouse
strains. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 76:
419–422, 1983.
19. Huh, K., I. Yamamoto, E. Gohda, and H. Iwata. Tissue
distribution and characteristics of xanthine oxidase and allopurinol oxidizing enzyme. Jpn. J. Pharmacol. 26: 719–724, 1976.
20. Humason, G. L. Animal Tissue Techniques. San Francisco, CA:
Freeman, 1979.
21. Laird, P. W., A. Zijderveld, K. Linders, M. A. Rudnicki, R.
Jaenisch, and A. Berns. Simplified mammalian DNA isolation
procedure (Abstract). Nucleic Acids Res. 19: 4293, 1991.
22. Lee, P. C. Developmental changes of adenosine deaminase,
xanthine oxidase, and uricase in mouse tissues. Dev. Biol. 31:
227–233, 1973.
23. Lindblad, G., G. Jonsson, and J. Falk. Adenine toxicity: a
three week intravenous study in dogs. Acta Pharmacol. Toxicol.
32: 246–256, 1973.
24. McAnulty, P. A., and J. P. Williams. Polyamines and their
biosynthetic decarboxylases in various tissues of the young rat
during recovery from undernutrition. Biochem. J. 162: 109–121,
1977.
25. Neish, W. J., and L. Key. Polyamines and glutathione in livers
of normal rats of different ages and in livers of pregnant rats.
Biochem. Pharmacol. 17: 497–502, 1968.
26. Olsen, N. V., S. D. Ladefoged, B. Feldt-Rasmussen, N.
Fogh-Andersen, H. Jordening, and O. Munck. The effects of
cimetidine on creatinine excretion, glomerular filtration rate and
tubular function in renal transplant recipients. Scand. J. Clin.
Lab. Invest. 49: 155–159, 1989.
27. Silbiger, S. R., and J. Neugarten. The impact of gender on the
progression of chronic renal disease. Am. J. Kidney Dis. 25:
515–533, 1995.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
surprising conclusion, since XDH is a source of reactive
oxygen species, and the inhibition of XDH activity
might be predicted to have antioxidant effects. Nonetheless, butylated hydroxytoluene, an antioxidant, has
been shown to protect from allopurinol toxicity (2).
Furthermore, allopurinol treatment increases renal
xanthine oxidase activity and decreases renal activity
of superoxide dismutase and catalase in rats (31),
thereby increasing an activity that generates reactive
oxygen species and decreasing an activity which eliminates them.
The present data show that APRT-deficient mice can
develop chronic renal failure in association with nephrolithiasis and that this pathology is reflected in lower
GFR. As a murine model that closely mimics the known
features of human APRT deficiency, this system provides an opportunity to address questions of clinical
interest, such as the biochemical consequences of APRT
deficiency in multiple tissues not available from human
subjects and the role of genetic modifier loci in the
development of the APRT-deficient phenotype. In mice,
the consequences of APRT deficiency on enzymes and
substrates of nucleotide metabolism may be studied in
specific tissues and organs, such as the brain and bone
marrow, which may be particularly dependent on purine salvage reactions for nucleotides (35). The genetics
of APRT deficiency also may be more fully studied in
mice than in humans. APRT-deficient humans manifest
considerable differences in the age of onset and the
severity of disease. Although diet and environment
may contribute to this variability, it is likely that
genetic factors in addition to Aprt also modulate the
progression of the disease. Initial results with APRTdeficient mice indicated that mice of C57Bl/6 background were affected earlier and more severely by
APRT deficiency than mice of Black Swiss derivation
(12). Appropriate breeding of APRT deficiency into
different murine genetic backgrounds will provide a
valuable tool for the characterization of loci, whose
alleles modify the severity of renal disease in APRT
deficiency.
RENAL FAILURE IN MICE WITH DEFECTIVE ADENINE SALVAGE
35.
36.
37.
38.
39.
40.
Prevention and Treatment, edited by C. Y. C. Pak. Boston, MA:
Martinus Nijhoff, 1987, p. 85–120.
Watts, R. W. Molecular variation in relation to purine metabolism. J. Clin. Pathol., Suppl. 8: 48–63, 1974.
Wexler, B. C., and B. P. Greenberg. Allopurinol-induced
myocardial and renal damage in nonarteriosclerotic (virgin) and
arteriosclerotic (breeder) Sprague-Dawley rats. Proc. Soc. Exp.
Biol. Med. 157: 541–549, 1978.
Williams-Ashman, H. G., A. E. Pegg, and D. H. Lockwood.
Mechanisms and regulation of polyamine and putrescine biosynthesis in male genital glands and other tissues of mammals. Adv.
Enzyme Regul. 7: 291–323, 1969.
Williams-Ashman, H. G., J. Seidenfeld, and P. Galletti.
Trends in the biochemical pharmacology of 58-deoxy-58-methylthioadenosine. Biochem. Pharmacol. 31: 277–288, 1982.
Wu, X., M. Wakamiya, S. Vaishnav, R. Geske, C. Montgomery, Jr., P. Jones, A. Bradley, and C. T. Caskey. Hyperuricemia and urate nephropathy in urate oxidase-deficient mice. Proc.
Natl. Acad. Sci. USA 91: 742–746, 1994.
Wyngaarden, J. B., and J. T. Dunn. 8-hydroxyadenine as the
metabolic intermediate in the oxidation of adenine to 2,8dihydroxyadenine by xanthine oxidase. Arch. Biochem. Biophys.
70: 150–6, 1957.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.4 on June 18, 2017
28. Simmonds, H. A. 2,8-Dihydroxyadenine lithiasis. Clin. Chim.
Acta 160: 103–108, 1986.
29. Simmonds, H. A., A. Sahota, and K. J. Van Acker. APRT
deficiency: 2,8-dihydroxyadenine lithiasis. In: The Metabolic and
Molecular Bases of Inherited Disease (7th ed.), edited by J. B.
Stanbury, J. B. Wyngaarden, and D. G. Fredrickson. New York:
McGraw-Hill, 1995.
30. Simmonds, H. A., K. J. Van Acker, J. S. Cameron, and A.
McBurney. Purine excretion in complete adenine phosphoribosyltransferase deficiency: effect of diet and allopurinol therapy.
Adv. Exp. Med. Biol. 76B: 304–311, 1977.
31. Suzuki, Y., and J. Sudo. Possible mechanism responsible for
allopurinol-nephrotoxicity: lipid peroxidation and systems of
producing- and scavenging oxygen radicals. Jpn. J. Pharmacol.
45: 271–279, 1987.
32. Tabor, H., and C. W. Tabor. Biosynthesis and metabolism of
1,4-diaminobutane, spermidine, spermine, and related amines.
Adv. Enzymol. Relat. Areas Mol. Biol. 36: 203–268, 1972.
33. Trachtman, H., E. Valderrama, and S. Futterweit. Nephrotoxicity of allopurinol is enhanced in experimental hypertension.
Hypertension 17: 194–202, 1991.
34. Wainer, L., V. A. Resnick, and M. I. Resnick. Nutritional
aspects of stone disease. In: Renal Stone Disease: Pathogenesis,
F163