Download Protective role of Lipoprotein-Associated Phospholipase A2 Gene

152
Original articles
|
March 2014 - Issue 3
Protective role of Lipoprotein-Associated
Phospholipase A2 Gene (A379V)
Polymorphism against Myocardial Infarction
among Egyptians
Ola Sharaki MD1, Mohamed Sobhi MD2, Doreen Younan MD1, Eman Elkemary MSc1.
1. Clinical Pathology Department, Faculty of Medicine, Alexandria University, Alexandria, Egypt.
2. Cardiology Department, Faculty of Medicine, Alexandria University, Alexandria, Egypt.
Abstract
Background: Oxidation of low density lipoproteins is an initial step of atherogenesis that generates pro-inflammatory
phospholipids, including platelet-activating factor (PAF) and its analogs. Platelet-activating factor is degraded by lipoprotein
associated phospholipase A2 (Lp-PLA2), also known as platelet-activating factor-acetylhydrolase (PAF-AH), a circulating
enzyme having both pro and anti-inflammatory activities. Lipoprotein associated phospholipase A2 activity has been
postulated to be a risk factor for acute coronary syndrome (ACS); however, whether Lp-PLA2 has a causal or protective role
is still unclear. A large number of single nucleotide polymorphisms (SNPs) that affect Lp-PLA2 mass and activity in plasma
have been described.
Aim: The aim of the present work is to determine the prevalence of Lp-PLA2 gene A379V single nucleotide polymorphism
(SNP) in Egyptians suffering from myocardial infarction (MI) in comparison to healthy controls and to correlate this genetic
variant with different cardiovascular risk factors.
Methods: Lp-PLA2 gene A379V polymorphism (rs1051931) was investigated in fifty patients having MI and fifty age and sex
matched healthy controls using real-time PCR.
Results: The homozygous CC genotype, coding for alanine at position 379 of Lp-PLA2 protein, had the highest frequency
among patients (72%) compared with controls (46%) while heterozygous CT genotype had the highest frequency among
controls (46%) compared with patients (24%) with a significant difference (p=0.033). The major “C” allele had the highest
frequency among patients (84%) compared with controls (69%) while the minor “T” allele, coding for valine at the same
position, had the highest frequency among controls (31%) compared with patients (16%) with a significant difference
(p=0.012).
Conclusion: The Lp-PLA2 A379V gene polymorphism was found to be less frequent in MI patients presented with ACS than
in healthy controls, suggesting that this SNP might be protective against the development of MI.
Key words:
lipoprotein associated phospholipase A2, Myocardial infarction, platelet-activating factor-acetylhydrolase, single
nucleotide polymorphism.
Introduction
The recognition that atherosclerosis has a strong inflammatory
component has stimulated a great deal of research on the
role of inflammatory mediators in the atherosclerotic disease
process.1 Oxidation of low density lipoproteins (LDLs) is an
initial step in atherogenesis, that generates a myriad of proinflammatory phospholipids, including platelet-activating factor
(PAF) and its analogs,2, 3 which are implicated in signaling
and activation of pro-inflammatory cells such as platelets,
leukocytes and macrophages.4
Platelet-activating factor exerts its various effects via the
G-protein-coupled PAF-receptor that binds PAF with high
affinity.5 PAF and its biologically active analogs are degraded
by lipoprotein-associated phospholipase A2 (Lp-PLA2), a
circulating enzyme bound mainly to LDLs, and to a lesser extent
to high density lipoproteins (HDLs).6, 7 Lipoprotein-associated
phospholipase A2 is also known as PAF-acetylhydrolase
(PAF-AH). Besides having an anti-inflammatory activity by
degrading PAF, Lp-PLA2 may also exert a pro-inflammatory
activity by massively hydrolyzing phospholipids to generate
lyso-phosphatidylcholine (lyso-PC) and free oxidized fatty acids,
both are pro-inflammatory mediators largely responsible for the
pro-atherogenic activity of oxidized LDL.8
Lipoprotein associated phospholipase A2 is a member of the
group VII family of PLA2 enzymes which are Ca2+-independent
enzymes, consisting of 45.4 kDa polypeptide chains.9
With the classification of this enzyme as a positive risk factor
in coronary heart disease, it has become a very attractive
drug target. A specific inhibitor of this enzyme, Darapladib,
was developed in 2003.10 This drug binds reversibly and noncovalently to human recombinant Lp-PLA2 and inhibits LpPLA2-mediated exogenous substrate hydrolysis in plasma and
LDL in vitro.10 In vivo studies showed that darapladib treatment
reduced the content of lyso-PC in pig atherosclerotic lesions,
owing to inhibition of hydrolysis of endogenous phospholipids.11
The gene for Lp-PLA2, PLA2G7, has 12 exons and is located on
chromosome 6p21.2 to 12. A large number of single nucleotide
polymorphisms (SNPs) that affect Lp-PLA2 mass and activity in
plasma have been described. Some variants are noted mainly
March 2014 - Issue 3
|
153
Original articles
Table 1. Clinical Characteristics of the two studied groups.
Parameter
(mean±SD)
Patients
(n=50)
Controls
(n=50)
Age (years)
48.34 ± 7.67
45.16 ± 8.73
Male
23 (46%)
25 (50%)
Female
27 (54%)
25 (50%)
TG (mg/dl)
187.82 ± 92.50*
112.82 ± 29.73
Cholesterol (mg/dl)
228.26 ± 71.98*
165.88 ± 30.11
LDL (mg/dl)
152.32 ± 62.08*
85.80 ± 25.36
HDL (mg/dl)
38.06 ± 13.77*
56.18 ± 12.64
CK (U/L)
1654.46 ± 1390.38*
80.04 ± 32.39
CK-MB (ng/ml)
163.06 ± 185.24*
0.47 ± 0.32
Troponin I (ng/ml)
61.92 ± 74.46*
0.0 ± 0.0
AST (U/L)
324.42 ± 266.37*
23.22 ± 10.09
LDH (U/L)
1261.64 ± 965.39*
151.16 ± 30.61
Hs-CRP (mg/L)
138.48 ± 145.80*
8.54 ± 10.17
Glucose (mg/dl)
110.88 ± 33.02*
97.74 ± 16.41
TG: Triglycerides, LDL: Low denisty lipoprotein, HDL: High
denisty lipoprotein, CK: Total creatine kinase,
CKMB: Creatine kinase MB isoform, AST: Aspartate
transaminase, LDH: Lactate dehydrogenase, Hs-CRP: High
sensitivity C-reactive protein.
*p value < 0.05 compared with controls.
in certain ethnic groups. The most frequently studied SNPs
are R92H (rs1805017), I198T (rs1805018), V279P and A379V
(rs1051931).12-14
The missense mutation of the PLA2G7 gene, which results
in alanine (ACG) to valine (ATG) transition at position 379
of Lp-PLA2 protein, A379V (rs 1051931) (46672943 C > T),
has been observed in Caucasians, Chinese, Taiwanese and
South Koreans.15, 16, 17, 18, 19 This polymorphism is thought to
decrease the substrate affinity of Lp-PLA2, possibly prolonging
the activity of PAF, which in turn is associated with many
inflammatory diseases.13
Materials and Methods
Study Population:
This study was conducted on fifty Egyptian patients; 23 males
(46%) and 27 females (54%), all suffering from MI which
was confirmed by ECG changes (ST segment elevation) and
elevation of cardiac enzymes (CK-MB and troponin). All patients
were recruited from the Cardiology Department at Alexandria
Main University Hospital and their ages ranged between 32-65
years with a mean of 48 years. Patients with inflammatory
or liver diseases were excluded to eliminate the relationship
between this gene polymorphism and diseases other than MI.
Fifty healthy individuals, 25 males (50%) and 25 females (50%),
whose ages ranged between 30-70 years with a mean of 45
years, were included as a control group. They had no history of
hypertension, DM, atherosclerosis or cancer.
Full history was taken from all participants; including smoking
habits, physical activity, alcohol consumption, drug history and
medical history for hypertension and DM. Also, supine blood
pressure was measured for all participants. All subjects signed
a written informed consent before enrollment in the study.
Table 2. Clinical Characteristics of the two studied groups.
Lipid Profile
Genotype
CC
(n= 36)
CT
(n= 12)
TT
(n=2)
TG (mg/dl)
Mean ±SD.
191.44 ±
93.18
188.92 ±
97.42
116.0 ±
11.31
Cholesterol (mg/dl)
Mean ±SD.
224.92 ±
77.55
240.0 ±
57.18
213.50 ±
68.59
LDL (mg/dl)
Mean ±SD.
149.31 ±
63.09
163.25 ±
61.73
141.0 ±
74.95
HDL (mg/dl)
Mean ±SD.
37.75 ±
15.13
37.17 ±
9.59
49.0 ±
4.24
Test
of sig.
p: p value for comparing between the three genotype
KW: Kruskal Wallis test
F: F test (ANOVA)
*: Statistically significant at p ≤ 0.05
The study protocol conforms to the ethical guidelines of the
1975 Declaration of Helsinki and has obtained the approval
of the Medical Ethics Committee of the Faculty of Medicine,
Alexandria University
Routine Laboratory Investigations:
Three milliliters of whole blood were collected from every
subject by aseptic veni-puncture in a plain red-topped
vacutainer, left to clot slowly at room temperature for 15-30
minutes. The clot was removed by centrifugation at 1000-1200
g for 10 minutes, then the serum was used for measurement
of lipid profile (triglycerides, total cholesterol, LDL and HDL),
cardiac enzymes (CK- total, CK-MB, troponin, LDH, AST), hsCRP and fasting blood glucose. All parameters were measured
by chemistry auto-analyzer Dimension RxL Max (Siemens
Health Care Diagnostics, USA).
Genomic Analysis for Detection of Lp-PLA2 A379V (rs 1051931)
Gene Polymorphism by 5` Nuclease Allele Discrimination Assay
using Real-Time PCR:
1- DNA Extraction:
Another 2 milliliters of whole blood were aseptically drawn into
lavender-topped EDTA vacutainer. Genomic DNA was extracted
from EDTA whole blood samples, using QIAGEN total DNA
purification kit (QIAamp DNA blood mini kit, QIAGEN, Germany,
cat. no. 51104) according to the manufacturer’s instructions.
The DNA samples were stored at -20°C until use.
2- 5´Nuclease Allele Discrimination Assay using Real-Time
PCR:
Ready-made “TaqMan SNP Genotyping Assay” (Assay ID
C_2032800_20, catalog # 4351379, Applied Biosystems,
USA) was used to detect Lp-PLA2 A379V SNP (rs1051931).
In Lp-PLA2 A379V polymorphism (46672943 C > T), alanine
(ACG) is replaced with valine (ATG), with the C allele being
the major allele (coding for alanine) and the T allele being the
minor one (coding for valine). This assay kit contains primer/
probe mixes (40X); 2 unlabeled sequence-specific forward and
reverse primers to amplify the sequence of interest harboring
the polymorphism and 2 labeled TaqMan minor groove binder
(MGB) probes for detecting both the major C and the minor T
alleles.
The first probe, labeled with FAM (green fluorescence) as the
154
Original articles
Table 3. Relation between the different genotypes and patients’ cardiac enzyme levels.
Cardiac
Enzymes
CK (U/L)
Mean ±SD.
CK-MB (ng/ml)
Mean ±SD.
TnI (ng/ml)
Mean ±SD.
AST (U/L)
Mean ±SD.
LDH (U/L)
Mean ±SD.
Genotype
CC
CT
(n= 36)
(n= 12)
1629.94 ± 1435.48 1929.67 ± 1296.0
Test of sig.
TT
(n=2)
444.50 ± 518.31
149.95 ± 130.17
222.49 ± 302.60
42.40 ± 57.28
63.03 ± 70.99
68.12 ± 89.58
4.86 ± 0.40
323.81 ± 255.50
353.0 ± 315.25
164.0 ± 193.75
1213.61 ± 818.83
1555.08 ± 1330.47
365.50 ± 74.25
KWp = 0.128
p: p value for comparing between the three genotypes. KW: Kruskal Wallis test
*: Statistically significant at p ≤ 0.05
Table 4. Relation between the different genotypes and patients’ glucose and hs-CRP levels.
Genotype
Parameter
CC
(n= 36)
CT
(n= 12)
TT
(n=2)
Genotype
112.72 ± 37.58
108.83 ± 15.99
444.50 ± 518.31
hs-CRP (mg/L) Mean ±SD.
161.93 ± 144.53 90.02 ± 143.96
MWp1
0.100
MWp2
p: p value for comparing between the three genotypes
p1 : p value for comparing between CC with each of CT and TT
p2 : p value for comparing between AG and AA
MC: Monte Carlo test
FE: Fisher Exact test
KW: Kruskal Wallis test
MW: Mann Whitney test
*: Statistically significant at p ≤ 0.05
reporter dye at the 5’ end, detects the major C allele, present in
alanine (ACG).
(AGCTTTGTTGCTAAGATCAATAGC TGC
ATTTGAATCTATGTCTCCCTTTAA).
The second probe, labeled with VIC (yellow fluorescence) as the
reporter dye at the 5’ end, detects the minor T allele, present in
valine (ATG).
(AGCTTTGTTGCTAAGATCAATAGC TAC
ATTTGAATCTATGTCTCCCTTTAA).
The PCR reaction mix was prepared. This 5´nuclease allele
discrimination assay, using real-time PCR, was used to detect
this genetic variant using the following thermal profile: holding
at 95°C for 10 minutes followed by 40 cycles of denaturation
(92°C for 15 seconds) and annealing/extension (60°C for 1
minute) in the Rotor Gene thermal cycler machine (serial no
R0211172). A no template control (NTC) containing nucleasefree water, instead of DNA, was included in each run to exclude
contamination.
The fluorescence profile of each sample was measured by
the Rotor Gene software which plots a graphic presentation
of the fluorescence against the number of cycles. The plotted
fluorescence signals indicate which alleles are in each sample.
The threshold cycle (Ct): is the cycle at which the instrument
can distinguish the amplification generated fluorescence
as being above the background signal. Positive cases are
4.86 ± 0.40
0.049*
0.100
Test
of
sig.
|
March 2014 - Issue 3
those with a Ct before cycle 40,
while cases in whom no Ct was
detected were considered negative.
Amplification plot curve for A379
(FAM labeled) was constructed
(Figure1) and another for 379V (VIC
labeled).
3- Statistical Analysis of the Data
(20)
Data were fed to the computer and
analyzed using IBM SPSS software
package version 20.0. (21)
Qualitative data were described
using number and percent.
Quantitative data were described
using mean and standard deviation,
median, minimum and maximum.
Comparison between different
groups regarding categorical
variables was tested using Chisquare test. When more than
20% of the cells have expected
count less than 5, correction for
chi-square was conducted using
Fisher’s Exact test or Monte Carlo
correction.
The distributions of quantitative
variables were tested for normality
using Kolmogorov-Smirnov test,
Shapiro-Wilk test and D’Agstino
test, also Histogram and QQ plot
were used for vision test. If it
reveals normal data distribution,
parametric tests were applied. If the
data were abnormally distributed, nonparametric tests were used.
For normally distributed data, comparison between two
independent populations was done using independent t-test
while more than two populations were analyzed F-test (ANOVA)
to be used and Post Hoc test (Scheffe). For abnormally
distributed data, comparison between two independent
populations were done using Mann Whitney test while Kruskal
Wallis test was used to compare between different groups.
Significant test results are quoted as two-tailed probabilities.
Significance of the obtained results was judged at the 5% level.
Results
Patients of both sexes were more often smokers, had a higher
prevalence of hypertension, diabetes and a more unfavorable
lipid profile compared with controls. The inflammatory marker,
hs-CRP, was markedly increased in patients compared with
controls. Also, CK-total, CK-MB, troponin, AST and LDH were
markedly increased in patients compared with controls. (Table 1)
Regarding the different PLA2G7 A379V genotype distributions
between the 2 studied groups, we found that homozygous
CC genotype had the highest frequency among patients
(72%) compared with controls (46%), while we found that
heterozygous CT genotype had the highest frequency among
controls (46%) compared with patients (24%) with a statistically
significant difference (p=0.033). (Figure 1)
March 2014 - Issue 3
|
155
Original articles
Figure
Figure
Percentage Percentage PrecentagePrecentage
80
CK-MB, troponin, AST, LDH, (Table 3)]. However, a statistically
significant difference (p=0.043) was found between different
genotypes regarding hs-CRP, (Table 4).
Validity of Hardy-Weinberg equilibrium regarding the
3 genotypes of the Lp-PLA2 A379V in all the studied
population:
As shown in table 5, the incidence of the C allele (p) = [(2X59)
+ 35]/ 200= 0.765 and the incidence of the T allele (q) = [35
+ (2X6)]/ 200 =0.235. {p+q=1}. The observed and expected
values were found nearly identical. This means that the Egyptian
population is in Hardy-Weinberg equilibrium for the Lp-PLA2
A379V gene variant.
Patients
70
80
Controls
60
70
Patients
Controls
50
60
40
50
30
40
20
30
10
20
0
10
CC
TC
TT
Genotype
Genotype 0
CC
TC
TT
Genotype
Genotype Percentage Percentage PrecentagePrecentage
90
Patients
80
90
70
80
60
70
50
60
40
50
30
40
20
30
10
20
0
10
Validity of Hardy-Weinberg equilibrium regarding the 3
genotypes of the Lp-PLA2 A379V gene among patients:
As shown in table 6, the incidence of the C allele (p) = [(2X36)
+ 12] / 100 = 0.84 and the incidence of the T allele (q) = [12 +
(2X2)]/ 100 = 0.16. {p+q=1}. The observed and expected values
were found to be quite similar denoting that Egyptian patients
having MI are in Hardy-Weinberg equilibrium for the Lp-PLA2
A379V gene variant.
Controls
Patients
Controls
C
T
Allele
Allele 0
C
T
Allele
Allele Validity of Hardy-Weinberg equilibrium regarding the 3
of the Lp-PLA2 A379V gene among healthy
subjects:
genotype
As shown in table 7, the incidence of the C allele (p) = [(2X23)
24 + 23]/ 100 = 0.69 and the incidence of the T allele (q) = [23 +
24 (2X4)]/ 100 =0.31. {p+q=1}. The observed and expected values
were found to be quite similar meaning that the controls are
also in Hardy-Weinberg equilibrium for the Lp-PLA2 A379V
gene variant.
Figure 1: Comparison
between the
the two
groups groups
according to different genotype genotypes
Comparison
between
twostudied
studied
distributions (p=0.033) and allele frequencies (p=0.012).
Figure 1:
according toFigure
different
genotype distributions (p=0.033) and
1: Comparison between the two studied groups according to different
distributions
(p=0.033) and allele frequencies (p=0.012).
allele frequencies
(p=0.012).
Table 5. The observed and expected values of the Lp-PLA2
A379V genotype frequencies among the whole studied
population, among patients and among controls.
Genotype
Observed
Expected
Difference
CC
59
58.5
(p2X 100)
0.5
TC
35
35.9
(2pqX 100) 0.9
TT
6
5.5
In all subjects
(q2X 100)
0.5
Total =100
Among patients
CC
36
35.28
(p2X 50)
0.72
TC
12
13.44
TT
2
1.28
(q2X 50)
(2pqX50)
1.44
0.72
(p2X 50)
0.8
(2pqX50)
1.6
Total =50
Among controls
CC
23
23.8
TC
23
21.4
TT
4
4.8
(q2X 50)
0.8
Total =50
Discussion
In our study, we found that homozygous CC genotype, coding
for alanine at position 379 of Lp-PLA2 protein, had the highest
frequency among patients compared with controls and was
associated with increased incidence of MI, while we found
that heterozygous CT genotype had the highest frequency
among controls compared with patients and was associated
with decreased incidence of MI, with a statistically significant
difference (p=0.033) between patients and controls. The allelic
frequencies for Lp-PLA2 A379V (46672943 C > T) SNP in our
studied population did not show any deviation from HardyWeinberg equilibrium.
Also, we found that the major “C” allele, coding for alanine,
had the highest frequency among patients compared with
controls and was associated with increased incidence of MI,
while we found that the minor “T” allele, coding for valine, had
the highest frequency among controls compared with patients
and was associated with decreased incidence of MI. So, there
is a significant difference (p=0.012) between patients and
controls with predominance of C allele in patients and T allele in
controls.
Also, we found that the major “C” allele had the highest
frequency among patients (84%) compared with controls
(69%), while we found that the minor “T” allele had the highest
frequency among controls (31%) compared with patients (16%)
with a significant difference (p=0.012) between both groups
with predominance of the “C” allele, coding for alanine, among
patients and the minor “T” allele, coding for valine among
controls. (Figure 1)
In agreement with our study, Ninio E et al., 22 Abuzeid AM et
al., 23 and Ling LC et al., 24 reported that the homozygous (TT)
and heterozygous (CT) forms of 379V polymorphism were less
frequent in MI patients than in controls, suggesting that this
allele might be protective against the development of CAD while
A379 variant was more prevalent among patients.
Our results showed no difference in genotype distributions or
allele frequencies among patients regarding their sex. Also,
there was no statistically significant difference between the
different genotypes regarding the patients’ lipid profile [TG,
cholesterol, LDL, HDL, (Table 2)] or cardiac enzyme levels [CK,
In contrast to our study, Liu PY et al.,25 and Casas JP et
al.,16 reported that 379V gene variant was more prevalent
in Taiwanese patients who presented with acute coronary
syndrome (ACS) than in controls. Also, Sutton et al.,26 reported
that 379V polymorphism was more prevalent among MI patients
156
than controls with a significant difference (p=0.002) which
was against our results. This dissimilarity in results may be
due to differences in ethnic groups, sample size and selection
criteria of patients and controls. However, Wotton P et al.,27
reported absence of any significant association between this
polymorphism and coronary heart disease complications.
In a Chinese study, the risk of MI was found to be higher among
cardiovascular patients harboring the minor T allele compared
with the major C allele.17 In a Taiwanese study, the T allele (379V
polymorphism) was associated with lower Lp-PLA2 activity
and increased risk of MI.18 In contrast, a study of European
Caucasians revealed that T allele was associated with reduced
risk of MI.23 But other studies on European Caucasians reported
no association with CHD risk.16, 28 In South Koreans, a similar
lack of association between A379V and CVD was reported.19
Personalized medicine is of growing interest, with a number of
pharmacogenetic drug examples, like clopedogril and warfarin,
where genetic variants influence the rate of drug metabolism
and efficacy.29 Among the limitations of our study are the
relatively small sample size and the inability to correlate the
studied polymorphism with enzyme activity or mass.
It could be concluded from this study that the Lp-PLA2 A379V
polymorphism was less frequent in Egyptians having MI than
in healthy controls and was associated with a lower risk of
cardiovascular events, suggesting that the minor T allele,
coding for valine, might be protective against the development
of MI while A379 variant was more prevalent among patients
than controls, suggesting that the major “C” allele, coding for
alanine could be used a risk factor for the development of MI.
Moreover, there was no significant correlation between A379
and lipid profile, suggesting that the action of this enzyme
is independent of other traditional risk factors. So, patients
harboring the Lp-PLA2 A379 gene variant, or the C allele,
might be candidates for specific Lp-PLA2 enzyme inhibitors, as
darapladib.
Correspondence to:
Dr. Doreen Nazeih Assaad Younan
Mobile: +2 012 222 82681
Tel: +2 03 582 2492
Fax: +2 03 582 4124
Postal Address: 596 Horreya Ave., Zizinya, Apt# 105,
Alexandria, Egypt.
E-mail: [email protected]
References
1. Ross R. ‘Atherosclerosis- an inflammatory disease’. N Engl J Med 1999;
340(2): 115–26.
2.Tsoukatos DC, Arborati M, Liapikos T, Clay KL, Murphy RC, Chapman
MJ, et al. ‘Copper-catalyzed oxidation mediates PAF formation in human
LDL subspecies. Protective role of PAF: acetylhydrolase in dense LDL’.
Arterioscler Thromb Vasc Biol. 1997; 17(12): 3505–12.
3. Heery JM, Kozak M, Stafforini DM, Jones DA, Zimmerman GA, McIntyre
TM, et al. ‘Oxidatively modified LDL contains phospholipids with plateletactivating factor-like activity and stimulates the growth of smooth muscle
cells’. J Clin Invest. 1995; 96(5): 2322–30.
4.Prescott SM, Zimmerman GA, Stafforini DM, McIntyre TM. ‘Plateletactivating factor and related lipid mediators’. Annu Rev Biochem. 2000; 69:
419–45.
5. Nakamura M, Honda Z, Izumi T, Sakanaka C, Mutoh H, Minami M, et al.
‘Molecular cloning and expression of platelet-activating factor receptor
from human leukocytes’. J Biol Chem. 1991; 266(30): 20400–5.
6. Stafforini DM, McIntyre TM, Carter ME, Prescott SM. ‘Human plasma
platelet-activating factor acetylhydrolase. Association with lipoprotein
particles and role in the degradation of platelet-activating factor’. J Biol
Chem. 1987; 262(9): 4215–22.
7.Tselepis AD, Dentan C, Karabina SA, Chapman MJ, Ninio E. ‘PAFdegrading acetylhydrolase is preferentially associated with dense LDL
and VHDL-1 in human plasma: Catalytic characteristics and relation to the
Original articles
|
March 2014 - Issue 3
monocyte-derived enzyme’. Arterioscler Thromb Vasc Biol. 1995; 15(10):
1764–73.
8.Steinberg D. ‘Low density lipoprotein oxidation and its pathobiological
significance’. J Biol Chem. 1997; 272(34): 20963–6.
9. Farr RS, Cox CP, Wardlow ML, Jorgensen R. ‘Preliminary studies of an
acid-labile factor (ALF) in human sera that inactivates platelet activating
factor (PAF)’. Clin Immunol Immunopathol. 1980; 15(3): 318-30.
10. Blackie JA, Bloomer JC, Brown MJ, Cheng HY, Hammond B, Hickey DM,
et al. ‘The identification of clinical candidate SB-480848: a potent inhibitor
of lipoprotein-associated phospholipase A2’. Bioorg Med Chem Lett. 2003;
13(6): 1067-70.
11. Wilensky RL, Shi Y, Mohler ER 3rd, Hamamdzic D, Burgert ME, Li J, et al.
‘Inhibition of lipoprotein-associated phospholipase A2 reduces complex
coronary atherosclerotic plaque development’. Nat Med. 2008; 14(10):
1059-66.
12.Bell R, Collier DA, Rice SQ, Roberts GW, MacPhee CH, Kerwin RW, et al.
‘Systematic screening of the LDL-PLA2 gene for polymorphic variants and
case control analysis in schizophrenia’. Biochem Biophys Res Commun.
1997; 241(3): 630-5.
13.Kruse S, Mao XQ, Heinzmann A, Blattmann S, Roberts MH, Braun S, et al.
‘The Ile198Thr and Ala379Val variants of plasmatic PAF-acetylhydrolase
impair catalytical activities and are associated with atopy and asthma’. Am
J Hum Genet. 2000; 66(5): 1522-30.
14.Stafforini DM, Satoh K, Atkinson DL, Tjoelker LW, Eberhardt C, Yoshida
H, et al. ‘Platelet-activating factor acetylhydrolase deficiency. A missense
mutation near the active site of an anti-inflammatory phospholipase’. J Clin
Invest. 1996; 97(12): 2784-91.
15.Stafforini DM. ‘Functional consequences of mutations and polymorphisms
in the coding region of the PAF acetylhydrolase (PAF-AH) gene’.
Pharmaceuticals. 2009; 2: 94-117.
16.Casas JP, Ninio E, Panayiotou A, Palmen J, Cooper JA, Ricketts SL, et
al. ‘PLA2G7 genotype, lipoprotein-associated phospholipase A2 activity
and coronary heart disease risk in 10 494 cases and 15 624 controls of
European ancestry’. Circulation. 2010; 121(21): 2284-93.
17. Li L, Qi L, Lv N, Gao Q, Cheng Y, Wei Y, et al. ‘Association between
lipoprotein-associated phospholipase A2 gene polymorphism and coronary
artery disease in the Chinese Han population’. Ann Hum Genet. 2011;
75(5): 605-11.
18. Liu PY, Li YH, Wu HL, Chao TH, Tsai LM, Lin LJ, et al. ‘Platelet-activating
factor-acetylhydrolase A379V (exon 11) gene polymorphism is an
independent and functional risk factor for premature myocardial infarction’.
J Thromb Haemost. 2006; 4(5): 1023-8.
19. Jang Y, Kim OY, Koh SJ, Chae JS, Ko YG, Kim JY, et al. ‘The Val279Phe
variant of the lipoprotein-associated phospholipase A2 gene is associated
with catalytic activities and cardiovascular disease in Korean men’. J Clin
Endocrinol Metab. 2006; 91(9): 3521-7.
20. Leslie E, Geoffrey J and James M(eds). ‘Statistical analysis. In:
Interpretation and uses of medical statistics’ (4th ed). Oxford Scientific
Publications. 1991, pp.411-6.
21. Kirkpatrick LA, Feeney BC. ‘A simple guide to IBM SPSS statistics for
version 20.0’. Student ed. Belmont, Calif.: Wadsworth, Cengage Learning.
2013; 115.
22. Ninio E, Tregouet D, Carrier JL, Stengel D, Bickel C, Perret C, et al.
‘Platelet-activating factor-acetylhydrolase and PAF-receptor gene
haplotypes in relation to future cardiovascular event in patients with
coronary artery disease’. Hum Mol Genet. 2004; 13(13): 1341–51.
23. Abuzeid AM, Hawe E, Humphries SE, Talmud PJ. ‘Association between
the Ala379Val variant of the lipoprotein associated phospholipase A2
and risk of myocardial infarction in the north and south of Europe’.
Atherosclerosis 2003; 168(2): 283-8.
24. Ling LC, Ai-Jun MA, Kun W. ‘Association between Lp-PLA2 Gene A379V
Polymorphism and TOAST Classification’. Chinese Journal of Stroke. 2012;
7(11): 858-63.
25. Liu PY, Chung HC, Chen JY, Lee CH, Chan SH, Li YH, et al. ‘Plateletactivating factor-acetylhydrolase (PLA2G7) A379V (Exon 11) gene
polymorphism is functionally associated with coronary artery disease
severity but not the onset of acute coronary syndrome’. Act Cardiol Sin.
2006; 22: 212-20.
26. Sutton BS, Crosslin DR, Shah SH, Nelson SC, Bassil A, Hale AB, et
al. ‘Comprehensive genetic analysis of the platelet activating factor
acetylhydrolase (PLA2G7) gene and cardiovascular disease in case-control
and family data sets’. Hum Mol Genet. 2008; 17(9): 1318-28.
27. Wootton PT, Stephens JW, Hurel SJ, Durand H, Cooper J, Ninio E, et al.
‘Lp-PLA2 activity and PLA2G7 A379V genotype in patients with diabetes
mellitus’. Atherosclerosis. 2006; 189(1): 149-56.
28. Grallert H, Dupuis J, Bis JC, Dehghan A, Barbalic M, Baumert J, et al.
‘Eight genetic loci associated with variation in lipoprotein-associated
phospholipase A2 mass and activity and coronary heart disease: metaanalysis of genome-wide association studies from five community-based
studies’. Eur Heart J. 2012; 33(2): 238-51.
29.Morner S, Henein M. Cardiovascular genetics: the ultimate investigation
for optimum management?. International cardiovascular forum. 2013; 1(2):
57-8.