Download `Knock down` of DNA polymerase Я by RNA interference

DNA Repair xxx (2004) xxx–xxx
‘Knock down’ of DNA polymerase ␤ by RNA interference:
recapitulation of null phenotype
Yaroslava Y. Polosina a , Thomas A. Rosenquist b , Arthur P. Grollman a , Holly Miller a,∗
a
Laboratory of Chemical Biology, Department of Pharmacological Sciences, State University of New York, Stony Brook, NY 11794, USA
b Department of Pharmacological Sciences, State University of New York, Stony Brook, NY 11794, USA
Received 9 February 2004; received in revised form 12 April 2004; accepted 14 May 2004
Abstract
DNA polymerase ␤ (pol ␤) is the major DNA polymerase involved in the base excision repair (BER) pathway in mammalian cells and, as
a consequence, BER is severely compromised in cells lacking pol ␤. Pol ␤ null (−/−) mouse embryos are not viable and pol ␤ null cells are
hypersensitive to alkylating agents. Using RNA interference (RNAi) technology in mouse cells, we have reduced the pol ␤ protein and mRNA
to undetectable levels. Pol ␤ knockdown cell lines display a pattern of hypersensitivity to DNA damaging agents similar to that observed in
pol ␤ null cells. Generation of pol ␤ knock down cells makes it possible to combine the pol ␤ null phenotype with deficiencies in other DNA
repair proteins, thereby helping to elucidate the role of pol ␤ and its interactions with other proteins in mammalian cells.
© 2004 Elsevier B.V. All rights reserved.
Keywords: DNA polymerase ␤; Base excision repair; RNA interference
1. Introduction
Complex DNA repair mechanisms have evolved that differ both in the type of damage repaired and the proteins
involved. Abasic sites and small, non-bulky base modifications are repaired through base excision repair (BER) [1].
DNA polymerase ␤ (pol ␤), the major DNA repair polymerase in the BER pathway in mammalian cells, has both
deoxyribose phosphate (dRP) lyase and DNA polymerase
activities [2–4]. Pol ␤ −/− mouse embryos are not viable
[5]; corresponding pol ␤ null (−/−) embryonic cells survive
in culture but are severely compromised in their ability to
carry out short patch BER resulting in their hypersensitivity to alkylating agents [6]. Pol ␤ null cells are able to perform long-patch BER which could be responsible for some
protection and for the slow kinetics of repair observed for
Abbreviations: ATP, adenosine triphosphate; BER, base excision repair; dRP, deoxyribose phosphate; DTT, 1,4-dithiothreitol; Na–EDTA, disodium ethylene-diaminetetraacetic acid; PAGE, polyacrylamide gel electrophoresis; SDS, sodium dodecyl sulfate; Tris–HCl, 2-amino-2-(hydroxymethyl)-1,3-propanediol hydrochloride; PBS, phosphate-buffered saline
∗ Corresponding author. Tel.: +1 631 444 6665; fax: +1 631 444 7641.
E-mail address: [email protected] (H. Miller).
1568-7864/$ – see front matter © 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.dnarep.2004.05.011
methylation lesions [7,8]. Expression of the 8 kDa amino
terminal dRP lyase domain of pol ␤ reverses the alkylation
sensitivity of pol ␤ null cells indicating that dRP removal
is the rate limiting step in alkylation repair [9]. Conflicting
data have been reported regarding the sensitivity of pol ␤
null cells to oxidative damaging agents such as H2 O2 . Pol ␤
null cells have been reported to show reduced survival upon
H2 O2 treatment [8] or have similar or slightly higher sensitivity than wild-type cells [6,9,10]. It has been proposed
that the sensitivity of pol ␤ null cells increases with the passage number of the cells and that may explain the observed
differences [11].
RNA interference (RNAi), a conserved cellular function,
can be exploited to specifically decrease or ‘knockdown’
the expression of a given protein in cells or animals [12].
RNAi methods are easier to implement than those utilized
in gene knockout technology and offer a rapid path to the
development of cell lines in which specific gene functions
are selectively suppressed. RNAi’s usefulness in DNA repair research has been highlighted in this journal [13] as
exemplified by knockdown of the DNA glycosylase Neil1
[14] and the translesion DNA polymerase ␩ [15]. Here
we describe the generation of a stable cell line in which
pol ␤ expression has been decreased >90% using RNA
2
Y.Y. Polosina et al. / DNA Repair xxx (2004) xxx–xxx
interference and the characterization of this cells in comparison to pol ␤ −/− cells.
2. Materials and methods
2.1. Cell lines and culture conditions
Mouse embryonic fibroblast lines Mß16tsA (wild-type)
and Mß19tsA (pol ␤ null) [5] were purchased from the
American Type Culture Collection. All cells were grown as
monolayers in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, at 34 ◦ C in a 5%
CO2 humidified atmosphere.
2.2. Construction of vectors
The vector, pmH1P-pgkneo [14], was made from a pUC18
backbone (Ap resistance), 100 bp mouse RNAseP H1 pol
III promoter, pgk-neo for G418 selection in mammalian
cells. The vector was linearized with SalI and HindIII. Pairs
of DNA oligonucleotides encoding hairpin RNAs were designed based on three different DNA pol ␤ gene specific targeted sequences (Fig. 1A). Nineteen nt sequences from the
target transcript were separated by a short spacer from the reverse complement of the same sequence, and five thymidine
residues were added as termination signal and sequences of
sites for endonucleases XhoI and HindIII resulting in the
following sequence:
5 -TCGAGCC(19 nts insert)TTCAAGAGA
(19 nts rev comp)TTTTTGGAAA
2.3. Transfection
The indicated DNA constructs (1 ␮g) were transfected
into Mß16tsA and Mß19tsA using FUGENE according
to the manufacturer’s protocol (Roche) and cells were
selected with G418 for 10 days. In addition to the experimental vectors pmH1P-pgkneoA, pmH1P-pgkneoB, and
pmH1P-pgkneoC, cells were transfected with the empty
vector, pmH1P-pgkneo.
2.4. Western blot analysis
Cell lysates were prepared from confluent monolayer
cells as described [16]. Briefly, cells were washed with
PBS, collected and resuspended at 106 cells/20 ␮l in buffer
I (10 mM Tris–Cl, pH 7.8, and 200 mM KCl). After adding
an equal volume of buffer II (10 mM Tris–Cl, pH 7.8,
200 mM KCl, 2 mM EDTA, 40% glycerol, 0.2% Nonidet
P-40, 2 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl
fluoride, 10 ␮g/ml aprotinin, 5 ␮g/ml leupeptin, 1 ␮g/ml
pepstatin), the cell suspension was rocked at 4 ◦ C for
2 h and then centrifuged at 16,000 × g for 15 min. The
Fig. 1. Vector-based suppression of pol ␤ gene expression in mouse
fibroblasts. (A) The sequences in the pol ␤ cDNA chosen for the gene
specific targeting and their location in the pol ␤ gene (numbers show
the position where the sequence starts). (B) RT-PCR analysis of pol
␤ (upper band) and actin (lower band) in wild-type (M␤16tsA), pol ␤
null cells (M␤19tsA), and wild-type (M␤16tsA) cells stably transfected
with a plasmid (pmH1P-pgkneoA, pmH1P-pgkneoB, or pmH1P-pgkneoC)
encoding shRNA against pol ␤ or the empty vector (pmH1P-pgkneo). (C)
Western blot analysis of pol ␤ (upper band) and Neil1 (lower band) in
wild-type (M␤16tsA), pol ␤ null (M␤19tsA), and cells stably transfected
with a plasmid (pmH1P-pgkneoA, pmH1P-pgkneoB, or pmH1P-pgkneoC)
encoding shRNA against pol ␤.
supernatant was recovered and stored at −20 ◦ C. Equal
amounts of cellular protein (70 ␮g) were resolved by 12%
SDS–PAGE and transferred to nitrocellulose membrane.
Blots were incubated with monoclonal anti-pol ␤ (NeoMarkers), anti-actin (Santa Cruz), or anti-Neil1 antibodies
[14]. Immunoblots were carried out with secondary antibody conjugated to horseradish peroxidase (Santa Cruz),
detected by MB chemiluminescence kit (Pierce).
2.5. RT-PCR analysis
RNA was isolated from cells using RNeasy MinElute
(Qiagen, Cat. No.: 74204). RT-PCR was performed using SuperScript One-Step RT-PCR with Platinum Taq kit
(Invitrogen, Cat. No.: 10928-042) with 1 ␮g of RNA as
template and products subjected to electrophoresis in a 1%
agarose gel. Primers for DNA pol ␤ (GACATGCTCACAGAACTCG, CGGATGGTGTACTCATTGAT), for actin
(ACAGATCATGTTTGAGACC, CCACCGATCCACACA-
Y.Y. Polosina et al. / DNA Repair xxx (2004) xxx–xxx
GAGTA), and for Stat1 (GCCTATGATGTCTCGTTG,
AATCAGTGTTCTGAGTGAGC) were used.
3
Cells were resuspended in Mg2+ /Ca2+ -free phosphate
buffer at 10,000 cells per ml and irradiated using a
Gammacell-40 137 Cs irradiation unit with a dose rate of
0.75 Gy/min for 0–20 min and plated in six-well plates.
Cells were grown for 7 days. Cells were counted and results
were expressed as the number of treated cells relative to
controls (percent control growth).
SV40-transformed mouse embryonic fibroblasts [5], stable
cell lines were selected but individual clones were not isolated. The resulting heterogenous population of neomycin
resistant cells were analyzed for pol ␤ mRNA and protein
levels (Fig. 1B and C). Semi-quantitative reverse transcription (RT) PCR was used to measure the level of pol ␤ mRNA
(Fig. 1B). Whereas pol ␤ mRNA was clearly detected after 30 cycles in wild-type cells and cells transfected with
the empty vector or sequence A, pol ␤ mRNA could not
be detected in cells transfected with sequence B or C. The
RT-PCR results were confirmed by analysis of pol ␤ protein levels by immunoblotting. While pol ␤ protein could be
readily detected in wild-type cells and cells transfected with
pmH1P-pgkneoA, no protein was detected in cells transfected with pmH1P-pgkneoB or C, similar to the result obtained with null cells. Levels of actin (not shown) and the
DNA glycosylase, Neil1 (Fig. 1C), remained unchanged,
indicating the relative specificity of the RNA interference
effect. Recently, it has been shown that the presence of
siRNAs in cell can stimulate up-regulation of the interferon
response [18,19]. RT-RCR analysis of the mRNA for Stat1,
a protein involved in the interferon response [19], does not
increase in cells transfected with pmH1P-pgkneoA, B or C
(data not shown). Controls included wild-type cells transfected with the empty vector and null cells transfected with
functional shRNA expressing plasmid (sequence B). In both
cases, neomycin resistant cells behaved identically to parent
wild-type or null cells demonstrating that the vector had no
effect on the cell and that the expressed shRNA was specific
for pol ␤.
2.8. UV treatment
3.2. Cell sensitivity to DNA-damaging agents
Cells were transferred into six-well plates at 40,000 cells
per well. Cells were washed with PBS, then irradiated with
UV light (Stratagene UV-C bulb, 254 nm) at various doses
(0–25 J/m2 ). Cells were grown in fresh media for 7 days,
then counted, and the results expressed as a percentage of
the untreated control.
Pol ␤ null cells are hypersensitive to the cytotoxic effects
of monofunctional DNA-methylating agents such as methyl
methanesulfonate [6,9]. To establish the sensitivity of pol
␤ knockdown cells to DNA-methylating agents, cells were
treated with different concentrations of MMS (Fig. 2A).
Pol ␤ null cells, wild-type cells and cells transfected with
pmH1P-pgkneo and pmH1P-pgkneoA, B or C were exposed to varying concentrations of MMS (0–1.5 mM). The
level of survival after MMS treatment for cells transfected
with pmH1P-pgkneoB (Fig. 2A) and pmH1P-pgkneoC
(data not shown) was significantly decreased in comparison with wild-type cells and similar to that observed for
pol ␤ null cells. Cell transfected with pmH1P-pgkneo
and pmH1P-pgkneoA show similar levels of sensitivity
as wild-type cells and pol ␤ null cells transfected with
pmH1P-pgkneo and pmH1P-pgkneoB show similar levels
of sensitivity as untransfected pol ␤ null cells (data not
shown).
BER is the major repair system for oxidative as well as
alkylation damage [20]; induction of pol ␤ while responding
to oxidative stress has been shown in cultured cells [21,22]
and in organisms [23]. However, experiments testing the
sensitivity of pol ␤ null cells to oxidizing agents such H2 O2
2.6. Cytotoxicity assay
Cells were plated into six-well plates at 40,000 cells
per well and grown for 1 day. The cells were then
treated by methyl methanesulfonate (MMS), H2 O2 , cisplatin, bleomycin, or methylene blue. For MMS, cisplatin,
bleomycin and H2 O2 sensitivity cells were treated for 1 h
with different concentration of MMS, cisplatin or bleomycin
in media or H2 O2 in phosphate buffer. To test methylene
blue sensitivity, cells were treated with different concentrations of the dye in the dark for 15 min and then exposed to
visible light for 5 min. Immediately after all treatments, the
media was changed and cultures were grown for 4–5 days
until control (untreated) cells were approximately 90% confluent. Cells in each sample were counted and results were
expressed as the number of cells in drug-treated samples
relative to controls (percent control growth).
2.7. Irradiation assay
3. Results and discussion
3.1. Knockdown of mouse DNA pol β using
plasmid-encoded shRNA
Three 19 bp sequences (A, B, C) within the coding region
of the mouse cDNA were chosen according to the general
criteria described by Tuschl [17] to induce RNA interference (Fig. 1A). Each sequence was cloned into the vector
pmH1P-pgkneo [14] behind the mouse H1 promoter and in
front of the RNA pol III transcription termination signal.
The resultant vectors (pmH1P-pgkneoA, pmH1P-pgkneoB,
pmH1P-pgkneoC) contained the neomycin resistance gene
to facilitate generation of stable cell lines. After transfection
into the wild-type (M␤16tsA) and pol ␤ null (M␤19tsA),
4
Y.Y. Polosina et al. / DNA Repair xxx (2004) xxx–xxx
Fig. 2. The sensitivity of wild-type cells (M␤16tsA; circles), pol ␤ null cells (M␤19tsA; squares), and wild-type cells stably transfected with a
pmH1P-pgkneoB (triangle symbols) to DNA damaging agents. Cells were exposed to MMS (A), cisplatin (B), H2 O2 (C), methylene blue (D), ionizing
radiation (E), and bleomycin (F) (as described in Section 2). Values presented are the mean ± S.E. of three to six independent experiments. Within each
experiment, means are calculated from triplicate values.
have yielded varied results [6,8,10]. Recently, H2 O2 sensitivity was shown to increase with the passage number of the
cells [11]. The early passage pol ␤ null cell are not hypersensitive to oxidizing agents [6], but late passage cells are hypersensitive to H2 O2 [11]. To determine the sensitivity of pol
␤ knockdown cells to oxidative agents, H2 O2 (Fig. 2C) and
methylene blue treatment (Fig. 2D) were used. Methylene
blue generates 8-oxoguanine in the presence of oxygen and
visible light [24,25]. When H2 O2 was used, there was very
small difference between the pol ␤ knock down and null cells
and the wild-type cells. This difference may be attributable
to the passage number (∼40) of the cells [11]. Neither cells
transfected by pmH1P-pgkneoB or pmH1P-pgkneoC nor pol
␤ null cells show differences in sensitivity to methylene blue
compared to wild-type cells (Fig. 2D).
It has been shown previously that pol ␤ null cells have
the same sensitivity to ionizing radiation as wild-type cells
[6,26]. However, cells that overexpress full length pol ␤
or the N-terminal DNA-binding domain of pol ␤ show
radioresistance and the level of this resistance was dependent on expression level [27]. To determine the sensitivity
of pol ␤ knockdown cells, we treated pol ␤ knockdown,
wild-type and pol ␤ null cells with increasing doses of radiation (Fig. 2E). Cells tested include those transfected with
pmH1P-pgkneo and pmH1P-pgkneoA (data not shown),
which demonstrated similar sensitivity to ionizing radiation. These data confirm that pol ␤ is not required for the
repair of most pre-toxic DNA damage induced by ionizing radiation. Cells transfected with pmH1P-pgkneoB and
pmH1P-pgkneoC treated with varying concentrations of the
Y.Y. Polosina et al. / DNA Repair xxx (2004) xxx–xxx
radiomimetic agent, bleomycin, also showed no difference
in sensitivity in comparison to pol ␤ null and wild-type
cells (Fig. 2F).
Pol ␤ can bypass the principal adducts formed following UV radiation, thymine–thymine cyclobutane pyrimidine
dimers and thymine–thymine pyrimidine–pyrimidone (6–4)
photoproducts, in vitro [28]. Mammalian cells overexpressing pol ␤ are hypermutagenic to UV irradiation and are
more resistant to killing than wild-type cells [28]; however, pol ␤ null cells and wild-type cells have similar levels
of UV-resistance and mutagenesis [29]. We treated pol ␤
knockdown, pol ␤ null and wild-type cells with several doses
of UV. All cells showed similar sensitivity to UV treatment
(data not shown). Similarly, pol ␤ can bypass crosslinked
adducts formed by cisplatin in vitro [30]; however, pol ␤ null
cell are not hypersensitive to cisplatin [31]. Consistent with
these reports, treatment of pol ␤ knockout cells with different concentration of cisplatin shows that these cells have the
same sensitivity as wild-type and pol ␤ null cells (Fig. 2B).
In conclusion, by expressing shRNA specific for pol ␤
we have generated stable cell lines that lack detectable pol
␤ mRNA or protein. These cells behave identically to pol
␤ null cells constructed via genetic knock out techniques.
The availability of pol ␤ knockdown cell lines make it possible to combine deficits in several proteins in one cell without generating viable mice or performing lengthy crosses.
In addition, we have used the same vector to decrease expression of pol ␤ in normal rat kidney (NRK) cells (unpublished data). Therefore, using RNA interference, it may be
possible to decrease pol ␤ expression in a variety of mammalian cell types making it feasible to perform experiments
that were previously impossible, extremely difficult or time
consuming.
Acknowledgements
The authors thank Cecilia Torres and Maryanne Wente
for oligonucleotide synthesis. We are indebted to Dr. Julie
Horton for helpful suggestions and critical reading of the
manuscript. This research was supported by grants CA47995
and CA17395 from the National Cancer Institute to APG,
and ES90013 to TAR.
References
[1] H. Nilsen, H.E. Krokan, Base excision repair in a network of defence
and tolerance, Carcinogenesis 22 (2001) 987–998.
[2] G. Dianov, A. Price, T. Lindahl, Generation of single-nucleotide
repair patches following excision of uracil residues from DNA, Mol.
Cell Biol. 12 (1992) 1605–1612.
[3] R.K. Singhal, R. Prasad, S.H. Wilson, DNA polymerase beta conducts
the gap-filling step in uracil-initiated base excision repair in a bovine
testis nuclear extract, J. Biol. Chem. 270 (1995) 949–957.
[4] R.K. Singhal, S.H. Wilson, Short gap-filling synthesis by DNA polymerase beta is processive, J. Biol. Chem. 268 (1993) 15906–15911.
5
[5] H. Gu, J.D. Marth, P.C. Orban, H. Mossmann, K. Rajewsky, Deletion of a DNA polymerase ␤ gene segment in T cells using cell
type-specific gene targeting, Science 265 (1994) 103–106.
[6] R.W. Sobol, J.K. Horton, R. Kuhn, H. Gu, R.K. Singhal, R.
Prasad, K. Rajewsky, S.H. Wilson, Requirement of mammalian DNA
polymerase-␤ in base-excision repair, Nature 379 (1996) 183–186.
[7] K. Ochs, J. Lips, S. Profittlich, B. Kaina, Deficiency in DNA
polymerase {␤} provokes replication-dependent apoptosis via DNA
breakage, Bcl-2 decline and caspase-3/9 activation, Cancer Res. 62
(2002) 1524–1530.
[8] P. Fortini, B. Pascucci, F. Belisario, E. Dogliotti, DNA polymerase ␤
is required for efficient DNA strand break repair induced by methyl
methanesulfonate but not by hydrogen peroxide, Nucleic Acids Res.
28 (2000) 3040–3046.
[9] R.W. Sobol, R. Prasad, A. Evenski, A. Baker, X.P. Yang, J.K. Horton, S.H. Wilson, The lyase activity of the DNA repair protein
␤-polymerase protects from DNA-damage-induced cytotoxicity, Nature 405 (2000) 807–810.
[10] B. Kaina, K. Ochs, S. Grosch, G. Fritz, J. Lips, M. Tomicic, T.
Dunkern, M. Christmann, BER, MGMT, and MMR in defense against
alkylation-induced genotoxicity and apoptosis, Prog. Nucleic Acid
Res. Mol. Biol. 68 (2001) 41–54.
[11] J.K. Horton, A. Baker, B.J. Berg, R.W. Sobol, S.H. Wilson, Involvement of DNA polymerase ␤ in protection against the cytotoxicity of
oxidative DNA damage, DNA Repair (Amst.) 1 (2002) 317–333.
[12] P.J. Paddison, G.J. Hannon, siRNAs and shRNAs: skeleton keys to
the human genome, Curr. Opin. Mol. Ther. 5 (2003) 217–224.
[13] H. Miller, A.P. Grollman, DNA repair investigations using siRNA,
DNA Repair (Amst.) 2 (2003) 759–763.
[14] T.A. Rosenquist, E. Zaika, A.S. Fernandes, D.O. Zharkov, H. Miller,
A.P. Grollman, The novel DNA glycosylase, NEIL1, protects mammalian cells from radiation-mediated cell death, DNA Repair (Amst.)
2 (2003) 581–591.
[15] R.R. Laposa, L. Feeney, J.E. Cleaver, Recapitulation of the cellular
xeroderma pigmentosum-variant phenotypes using short interfering
RNA for DNA polymerase ␤, Cancer Res. 63 (2003) 3909–3912.
[16] S. Biade, R.W. Sobol, S.H. Wilson, Y. Matsumoto, Impairment of
proliferating cell nuclear antigen-dependent apurinic/apyrimidinic site
repair on linear DNA, J. Biol. Chem. 273 (1998) 898–902.
[17] T. Tuschl, RNA interference and small interfering RNAs, Chembiochem 2 (2001) 239–245.
[18] C.A. Sledz, M. Holko, M.J. de Veer, R.H. Silverman, B.R. Williams,
Activation of the interferon system by short-interfering RNAs, Nat.
Cell Biol. 5 (2003) 834–839.
[19] A.J. Bridge, S. Pebernard, A. Ducraux, A.L. Nicoulaz, R. Iggo,
Induction of an interferon response by RNAi vectors in mammalian
cells, Nat. Genet. 34 (2003) 263–264.
[20] T. Lindahl, D.E. Barnes, Repair of endogenous DNA damage, Cold
Spring Harb. Symp. Quant. Biol. 65 (2000) 127–133.
[21] D.C. Cabelof, J.J. Raffoul, S. Yanamadala, Z. Guo, A.R. Heydari,
Induction of DNA polymerase ␤-dependent base excision repair in
response to oxidative stress in vivo, Carcinogenesis 23 (2002) 1419–
1425.
[22] K.H. Chen, F.M. Yakes, D.K. Srivastava, R.K. Singhal, R.W. Sobol,
J.K. Horton, B. Van Houten, S.H. Wilson, Up-regulation of base
excision repair correlates with enhanced protection against a DNA
damaging agent in mouse cell lines, Nucleic Acids Res. 26 (1998)
2001–2007.
[23] L.-H. Lin, S. Cao, L. Yu, J. Cui, W.J. Hamilton, P.K. Liu,
Up-regulation of base excision repair activity for 8-hydroxy-2 -deoxyguanosine in the mouse brain after forebrain ischemia-reperfusion,
J. Neurochem. 74 (2000) 1098–1105.
[24] J.E. Schneider Jr., J.R. Phillips, Q. Pye, M.L. Maidt, S. Price, R.A.
Floyd, Methylene blue and rose bengal photoinactivation of RNA
bacteriophages: comparative studies of 8-oxoguanine formation in
isolated RNA, Arch. Biochem. Biophys. 301 (1993) 91–97.
6
Y.Y. Polosina et al. / DNA Repair xxx (2004) xxx–xxx
[25] K. Conlon, A.P. Grollman, M. Berrios, Immunolocalization of
8-oxoguanine in nutrient-deprived mammalian tissue culture cells, J.
Histotech. 23 (2000) 37–44.
[26] M. Miura, H. Watanabe, K. Okochi, T. Sasaki, H. Shibuya, Biological
response to ionizing radiation in mouse embryo fibroblasts with a
targeted disruption of the DNA polymerase ␤ gene, Radiat. Res. 153
(2000) 773–780.
[27] C. Vens, E. Dahmen-Mooren, M. Verwijs-Janssen, W. Blyweert, L.
Graversen, H. Bartelink, A.C. Begg, The role of DNA polymerase
␤ in determining sensitivity to ionizing radiation in human tumor
cells, Nucleic Acids Res. 30 (2002) 2995–3004.
[28] L. Servant, C. Cazaux, A. Bieth, S. Iwai, F. Hanaoka, J.-S. Hoffmann,
A role for DNA polymerase ␤ in mutagenic UV lesion bypass, J.
Biol. Chem. 277 (2002) 50046–50053.
[29] R.W. Sobol, D.E. Watson, J. Nakamura, F.M. Yakes, E. Hou, J.K.
Horton, J. Ladapo, B. Van Houten, J.A. Swenberg, K.R. Tindall,
L.D. Samson, S.H. Wilson, Mutations associated with base excision
repair deficiency and methylation-induced genotoxic stress, Proc.
Natl. Acad. Sci. U.S.A. 99 (2002) 6860–6865.
[30] Y. Canitrot, J.S. Hoffmann, P. Calsou, H. Hayakawa, B. Salles, C.
Cazaux, Nucleotide excision repair DNA synthesis by excess DNA
polymerase ␤: a potential source of genetic instability in cancer cells,
FASEB J. 14 (2000) 1765–1774.
[31] K. Ochs, R.W. Sobol, S.H. Wilson, B. Kaina, Cells deficient in
DNA polymerase ␤ are hypersensitive to alkylating agent-induced
apoptosis and chromosomal breakage, Cancer Res. 59 (1999) 1544–
1551.