Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
2/26/2014 Cloning a gene in the blackleg fungus, Leptosphaeria maculans conferring avirulence towards Brassica juncea Resistance and avirulence genes • Plant contains resistance genes (R genes) • Pathogen contains avirulence genes (Avr genes) corresponding to R genes Fungus Genotype: AvrRml1 (Avirulent) Angela Van de Wouw, Rohan Lowe, Candace Elliott, David Dubois, Barbara Howlett School of Botany, The University of Melbourne Plant Genotype: Rlm1 Four avirulence genes have been cloned from L. maculans Resistance and avirulence genes • Plant contains resistance genes (R genes) • Pathogen contains avirulence genes (Avr genes) corresponding to R genes • • • • AvrLm1 = Rlm1 (AV-Garnet) AvrLm4 = Rlm4 (CB-Telfer) AvrLm6 = Rlm6 (B. juncea) AvrLm11 = Rlm11 (B. rapa) – All located in gene-poor regions of the genome and highly upregulated in planta Fungus Genotype: avrRml1 (Virulent) Plant Genotype: Rlm1 Plant recognises fungus - Defence mechanisms - NO INFECTION Fungus undetected by plant INFECTION/DISEASE Molecular markers can be developed for avirulence genes Molecular markers can be used to monitor changes in allele frequencies in the field Frequency of virulence allele Absence/presence of a band Nucleotide polymorphism (SNP) detection Pyrosequencing of AvrLm4 A4: C/ GAAATATAACTCCAGGTGCTGAGCTA C: 4% G: 96% 250 200 150 100 50 0 E S T C G A T A T A 5 Van de Wouw et al (2010) Plant Pathology 59, 809-818 Van de Wouw et al (2010) PLoS Pathogens 6(11)e1001180 5 Van de Wouw and Howlett (2012) Journal of Applied Microbiology 113, 1145-1153 Monola76 AvrLm4 AvrLm1 1 2/26/2014 Candidate B. juncea avirulence gene A/Virulence towards juncea mapped onto SuperContig7 of L.maculans Super Contig 7 • Previous work in Howlett lab identified junceaattacking blackleg isolates – These isolates attack all 92 B. juncea lines screened – Virulence towards B. juncea segregated as a single gene – Species-specific a/virulence gene in L. maculans • Crosses set up between a junceaattacking isolate (IBCN18) and a nonattacking isolate (04P014). • Both isolates virulent towards Rlm6, a juncea-resistance gene introgressed into B. napus. • 66 progeny were screened for virulence on juncea and with molecular markers • A/virulence mapped to SC7 Purwantara et al (1998) Candidate gene identified using RNAseq • RNA-seq data from infected cotyledons (7 dpi) and in vitro growth used to identify genes highly upregulated in planta. • Within mapped region on SC7, three SSPs identified – two had low expression in planta – one (LemaT070880) up-regulated 5380 fold in planta 57 kb gene expression in planta (FPKM) Marker MinLm935-2 SSR104 10.6 MinLm1139 AvrLmJ1 12.1 MinLm1377 21.3 MinLm2007 LemaT070880 is candidate avirulence gene • LemaT070880 encodes a small secreted, cysteine rich protein located in AT-rich region • RNA-seq data showed incorrect gene prediction in reference genome; correct annotation has earlier start codon. • Gene sequenced from attacking and non-attacking isolates 33 kb 25 genes 7 genes 886 kb cM 25.8 24.6 27 genes 1102 kb AvrLmJ1 1500 1000 500 0 Premature stop-codon in junceaattacking isolates • Stop codon identified in juncea-attacking isolates • Presence of stop codon shows 100% correlation with virulence in progeny Isolates # of nucleotide Coding sequence Phenotype on B. Allele (frequency) changes change juncea cultivars Lema_uP070880.2_0 34 (43%) N/A N/A Avirulent Lema_uP070880.2_1 18 (23%) 1 K55R Avirulent Lema_uP070880.2_2 15 (19%) 1 K55T Avirulent Lema_uP070880.2_3 9 (12%) 2 R38L, K55R Avirulent Lema_uP070880.2_4 2 (3%) 3 R29Stop, R38L, K55R Virulent LemaT070880 confers avirulence towards Juncea cultivars - I • Complementation construct made and transformed into juncea-attacking isolate B. napus cv. Westar B. juncea cv. Aurea IBCN18 IBCN18 +AvrLmJ1 #1 2 2/26/2014 LemaT070880 confers avirulence towards Juncea cultivars - II Westar Stoke 9.0 • LemaT070880 (AvrLmJ1) confers avirulence towards three B. juncea lines tested. Aurea Forge 8.0 Average pathogenicity score Conclusions – Possibly confers species-specific avirulence – Corresponding R gene unknown. 7.0 6.0 • Typical characteristics of avirulence genes 5.0 4.0 – Secretion signal, cystiene rich, no homolgy, located in AT-rich region and highly up-regulated in planta 3.0 2.0 1.0 0.0 IBCN18 IBCN18 +AvrLmJ1#1 IBCN18 +AvrLmJ1#2 IBCN18 +AvrLmJ1#3 IBCN18 +AvrLmJ1#4 IBCN18 +AvrLmJ1#5 • RNAseq data in combination with mapping allowed identification of candidate gene 3